Avinash Puri ·

Nithyanandam Mahalakshmi ·
Tanya Chauhan · Alka Mishra ·
Preeti Bhatnagar Editors

Fundamentals
of Forensic
Biology
Fundamentals of Forensic Biology
Avinash Puri •
Nithyanandam Mahalakshmi •
Tanya Chauhan • Alka Mishra •
Preeti Bhatnagar
Editors

Fundamentals of Forensic
Biology
Editors
Avinash Puri Nithyanandam Mahalakshmi
Department of DNA and Forensic Biology Department of DNA
Regional Forensic Science Laboratory Forensic Sciences
Indore, Madhya Pradesh, India Chennai, Tamil Nadu, India

Tanya Chauhan Alka Mishra

Department of Forensic Science Department of Biology
National Forensic Science University Regional Forensic Science Laboratory
Delhi Campus (LNJN NICFS) Gwalior, Madhya Pradesh, India
New Delhi, Delhi, India

Preeti Bhatnagar
Department of DNA
Regional Forensic Science Laboratory
Bhopal, Madhya Pradesh, India

ISBN 978-981-99-3160-6 ISBN 978-981-99-3161-3 (eBook)

https://doi.org/10.1007/978-981-99-3161-3

# The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Nature Singapore
Pte Ltd. 2024
This work is subject to copyright. All rights are solely and exclusively licensed by the Publisher, whether
the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse of
illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way, and
transmission or information storage and retrieval, electronic adaptation, computer software, or by
similar or dissimilar methodology now known or hereafter developed.
The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication
does not imply, even in the absence of a specific statement, that such names are exempt from the relevant
protective laws and regulations and therefore free for general use.
The publisher, the authors, and the editors are safe to assume that the advice and information in this
book are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or
the editors give a warranty, expressed or implied, with respect to the material contained herein or for any
errors or omissions that may have been made. The publisher remains neutral with regard to jurisdictional
claims in published maps and institutional affiliations.

This Springer imprint is published by the registered company Springer Nature Singapore Pte Ltd.
The registered company address is: 152 Beach Road, #21-01/04 Gateway East, Singapore 189721,
Singapore

Paper in this product is recyclable.

Preface

Forensic science is the application of different disciplines of science in crime scene

investigation. While criminal activities diversify and become complex in the modern
world, the principles of forensic science remain instrumental in assisting enforce-
ment agencies solve crimes. Biological evidences are an integral discipline of
forensic science, since humans and living beings alike are often central to commonly
occurring crimes. Homicides, assault, paternity/maternity disputes, accidents, iden-
tification, trafficking, and many other crimes depend on forensic biology to find
answers and achieve justice.
Forensic biology uses different principles and applications of biological sciences
to help identify and analyze biological evidences from the scene of crime and
otherwise. DNA profiling, a prominent subfield of forensic biology, is now a
fundamental part of crime scene investigation throughout the world. It has helped
deliver justice to millions and solve many cold cases and exonerate innocent people.
Other disciplines of the field, such as anthropology, serology, pathology, blood stain
pattern analysis, botany, entomology, wildlife forensics, and odontology help ana-
lyze a diverse range of evidences found at crime scenes.
The book entitled Fundamentals of Forensic Biology aims to introduce the fields
of Forensic Biology to students and forensic scientists alike. The book will cover the
theory, principles, and application of the mentioned disciplines of forensic biology
with a focus on easier understanding of the applicability of the topics. It discusses the
subject with an aim to enhance the theoretical and practical knowledge of the subject
and explore the potentials of the fields in modern-day crime scene investigation for
researchers and practitioners of the field.
This book will be supported through infographics, visual cues, and illustrations to
make the learning process engaging for readers. This book will be supplemented
with real-life case studies from national and international cases, significant to the
discipline or unique in their approach towards evidence analysis. At the last of each
chapter of the book will be filled contain summaries and revision sections for
enhanced learning experience.

v
vi Preface

This book aims to break the monotony of higher education learning resources and
help students conceptualize complex topics through detailed deconstruction of the
topic and using real-life examples and visual learning tools. The book will cover a
range of important subdisciplines of the field with important emphasis on under-
standing the fundamentals.

Indore, Madhya Pradesh, India Avinash Puri

Chennai, Tamil Nadu, India Nithyanandam Mahalakshmi
New Delhi, Delhi, India Tanya Chauhan
Gwalior, Madhya Pradesh, India Alka Mishra
Bhopal, Madhya Pradesh, India Preeti Bhatnagar
Contents

1 Introduction: Forensic Biology . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1

Avinash Puri and Neelam Arya
2 Investigation of Biological Evidence . . . . . . . . . . . . . . . . . . . . . . . . 9
Neelam Arya and Avinash Puri
3 Investigation of the Dead Body . . . . . . . . . . . . . . . . . . . . . . . . . . . . 25
Alok Atreya, Rutwik Shedge, and Tanuj Kanchan
4 Bloodstain Pattern Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 43
Aditi Mishra, Ragini Pandey, and Sarthak Misra
5 Identification of Blood . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 61
Shivam Chourasiya, Varsha Rani Patel, Himani Sharma, Moumita
Sinha, and Tilak Ram Chandrakar
6 Serology Concept and Techniques . . . . . . . . . . . . . . . . . . . . . . . . . . 77
Arjun Rao Isukapatla, Mehar Chadha, and Moumita Sinha
7 Identification of Semen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 101
Anuj Bharadwaj and Tanya Chauhan
8 Introduction to Saliva and Its Forensic Analysis . . . . . . . . . . . . . . . 117
Aditya Kumar Kar, Radha Patel, and Ankit Debnath
9 Identification of Vaginal Secretions and Menstrual Blood . . . . . . . . 127
Arjun Rao Isukapatla, Mehar Chadha, Nisha Kaushik, and Sunanda
Dhenge
10 Urine . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 145
Rudresh Channe, H. Manderiya, Tanya Chauhan, Alka Mishra, Preeti
Bhatnagar, Avinash Puri, and Nithyanandam Mahalakshmi
11 Introduction to Sweat and Its Forensic Analysis . . . . . . . . . . . . . . . 157
Aditya Kumar Kar, Radha Patel, and Tanima Nandi

vii
viii Contents

12 Forensic Significance and Examination of Faecal Matter . . . . . . . . 167

Varsha Rani Patel, Himani Sharma, Shivam Chourasiya, and Tilak
Ram Chandrakar
13 Introduction to Vomitus and Its Forensic Analysis . . . . . . . . . . . . . 177
Aditya Kumar Kar, Chitrita Chakraborty, and Pooja Uppal
14 Nucleic Acids: DNA and RNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 183
Rutwik Shedge, Aditi Iyengar, Monisha Samuel, and Tanya Chauhan
15 Quantitation and Quality Assessment of DNA . . . . . . . . . . . . . . . . . 199
Monisha Samuel, Rutwik Shedge, and Tanya Chauhan
16 Polymerase Chain Reaction: An Indispensable Molecular Biology
Tool of 21st Century . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 209
Parth Sharma, Aditi Mishra, Sarthak Misra, Ulhas Gondhali,
and Tanya Chauhan
17 DNA Electrophoresis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 227
Aditi Mishra, Pratiksha H. Nimbkar, and Tanya Chauhan
18 Short Tandem Repeats Profiling . . . . . . . . . . . . . . . . . . . . . . . . . . . 245
Tanya Chauhan, Shreya Arora, Rutwik Shedge, and Astha
19 Sex Chromosome Haplotyping . . . . . . . . . . . . . . . . . . . . . . . . . . . . 261
Monisha Samuel and Rutwik Shedge
20 Mitochondrial DNA Profiling . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 271
Pratiksha H. Nimbkar, Aditi Mishra, Ulhas Gondhali, Sarthak Misra,
and Tanya Chauhan
21 Single Nucleotide Polymorphism as Evolutionary Evidence of
Individuality . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 283
Sarthak Misra, Parth Sharma, Aditi Mishra, Ulhas Gondhali,
and Tanya Chauhan
22 Insect DNA Testing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 305
Moumita Sinha, Arjun Rao Isukapatla, Prashant Kumar, Paromita
Banerjee, and Neelam Ahirwar
23 Animal DNA Testing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 317
Tilak Ram Chandrakar and Ajay Biswas
24 Microbial DNA Testing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 325
Paromita Banerjee and Prashant Kumar
25 DNA Phenotyping . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 339
Astha, Tanya Chauhan, Shreya Arora, and Rutwik Shedge
26 Forensic Anthropology . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 357
Rutwik Shedge, Kam Salem Guite, Varsha Warrier, Tanuj Kanchan,
and Kewal Krishan
Contents ix

27 Forensic Odontology . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 385

Rutwik Shedge, Anuj Bhardwaj, and Tanya Chauhan
28 Forensic Botany . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 401
Neelam Arya
29 Forensic Entomology . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 415
Kamsalem Guite, Rutwik Shedge, Varsha Warrier, and Tanuj
Kanchan
30 Wildlife Forensics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 451
Arjun Rao Isukapatla, Prachi Yadav, and Moumita Sinha
31 Evidence and Identification . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 477
Rahul Ravindra Darunde, Hansi Bansal, and Avinash Puri
32 Forensics in Bioterrorism . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 491
Monisha Samuel and Rutwik Shedge
33 Hair Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 505
Avinash Puri and Neelam Arya
34 Forensic DNA Database . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 515
Rutwik Shedge, Aditi Iyengar, Monisha Samuel, and Tanya Chauhan
35 Diatom Testing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 523
Preetika M. Chatterjee
36 Nanotechnology and Its Uses in Forensic Science . . . . . . . . . . . . . . 537
Prashant Kumar and Paromita Banerjee
Editors and Contributors

About the Editors

Avinash Puri is working as a Scientific Officer in Forensic Biology and DNA

division of Regional Forensic Science Laboratory, Home Ministry, Govt. of Madhya
Pradesh. He has more than 7 years of experience in forensic biology, DNA, and
serology. He has analyzed thousands of forensic exhibits of biological origin along
with material objects of the deceased such as bone, muscle tissue, teeth, etc. paternity
dispute cases using DNA typing and submitted reports and deposed evidence in the
Courts of Law, M.P. India. His research interest includes forensic serology, forensic
biology, population genetics, forensic DNA testing, and molecular biology. He has
delivered and organized lectures at various institutes in forensic field for officers of
the Criminal Justice System. He has published many research articles in peer-
reviewed journals. He has developed and patented software regarding chain of
custody (ACP). He has also published several books.

Tanya Chauhan is working as Assistant Professor in Forensic Biology Division of

LNJN National Institute of Criminology and Forensic Science, Ministry of Home
Affairs, Govt. of India, at Delhi. She has more than 11 years of experience in forensic
biology, serology, and DNA profiling. Her research focuses on forensic DNA and
molecular biology. She has organized short-term training programs in forensic field
for senior officers of the Criminal Justice System. She has published 14 research
articles in peer-reviewed journals. She has also contributed to the preparation and
editing of several books. She is a member of Association for the promotion of DNA
Fingerprinting and other DNA Technologies (ADNAT), Bio-informatics organiza-
tion, Massachusetts, and Science Advisory Board, United States.

Nithyanandam Mahalakshmi is working as a deputy director, DNA Division,

Forensic Sciences Department. She has also generated a database for forensically
relevant DNA markers (such as autosomal and Y-STRs and mtDNA) and
HLA-DRB1 system for endogamous population of Tamil Nadu. She has published
many research articles along with books.

xi
xii Editors and Contributors

Alka Mishra is presently working as a Scientific Officer in Regional Forensic

Science Laboratory, Gwalior. She has 7 years of experience in forensic biology
and published various publications in national and international journals.

Preeti Bhatnagar is presently working as a Scientific Officer in DNA Fingerprint-

ing Unit-Regional Forensic Science Laboratory Bhopal. She has 7 years of experi-
ence in forensic biology and DNA and also served as Assistant Professor of
Microbiology in various educational institutions for more than 6 years. An eminent
scholar and winner of the Young Scientist Award, she has various publications in
national and international journals.

Contributors

Neelam Ahirwar Department of Microbiology, Kalinga University, Raipur, India

Shreya Arora CTM IRTE, Faridabad, Haryana, India
Neelam Arya FSL, Haryana, Madhuban, Haryana, India
DNA UNIT, Regional Forensic Science Laboratory, Indore, India
Astha LNJN National Institute of Criminology and Forensic Science, Delhi, India
Alok Atreya Department of Forensic Medicine, Lumbini Medical College, Tansen,
Palpa, Nepal
Paromita Banerjee Department of Microbiology, Kalinga University, Raipur,
India
Department of Bioinformatics, Kalinga University, Raipur, Chhattisgarh, India
Hansi Bansal Department of Forensic Science, Government Institute of Forensic
Science, Nagpur, India
Anuj Bharadwaj CFSL Chandigarh, Chandigarh, India
Preeti Bhatnagar Department of DNA, Regional Forensic Science Laboratory,
Bhopal, Madhya Pradesh, India
Ajay Biswas Department of Forensic Science, Medi-Caps University, Indore,
Madhya Pradesh, India
Mehar Chadha Department of Life Sciences, Christ University, Bangalore,
Karnataka, India
Chitrita Chakraborty Department of Forensic Science, Adamas University,
Kolkata, India
Tilak Ram Chandrakar Faculty of Science, Department of Forensic Science,
Medi-Caps University, Indore, Madhya Pradesh, India
Faculty of Forensic Science, Medi-Caps University, Indore, Madhya Pradesh, India
Editors and Contributors xiii

Rudresh Channe Department of Forensic Science, Institute for Excellence in

Higher Education, Bhopal, Madhya Pradesh, India
Preetika M. Chatterjee Department of Forensic Science, MATS University,
Raipur, Chhattisgarh, India
Tanya Chauhan Department of Forensic Science, National Forensic Science Uni-
versity Delhi Campus (LNJN NICFS), New Delhi, Delhi, India
Shivam Chourasiya Faculty of Science, Department of Forensic Science, Medi-
Caps University, Indore, Madhya Pradesh, India
Rahul Ravindra Darunde Department of Forensic Science, Medi-Caps Univer-
sity, Indore, India
Ankit Debnath Department of Forensic Science, Adamas University, Kolkata,
India
Sunanda Dhenge Forensic Science Education Society, Raipur, Chhattisgarh, India
Ulhas Gondhali Jindal Institute of Behavioural Sciences, O.P. Jindal Global Uni-
versity, Sonipat, India
Kam Salem Guite Department of Forensic Medicine and Toxicology, All India
Institute of Medical Sciences, Jodhpur, Rajasthan, India
Arjun Rao Isukapatla Faculty of Forensic Science, Department of Life Sciences,
Christ University, Bangalore, Karnataka, India
Department of Microbiology, Kalinga University, Raipur, India
Faculty of Forensic Science, School of Life Sciences, Christ (Deemed to be Univer-
sity), Bengaluru, Karnataka, India
Aditi Iyengar Impact Science, Cactus Communications, Mumbai, India
Tanuj Kanchan Department of Forensic Medicine and Toxicology, All India
Institute of Medical Sciences, Jodhpur, Rajasthan, India
Aditya Kumar Kar Department of Forensic Science, Adamas University, Kolkata,
India
Nisha Kaushik Forensic Science Education Society, Raipur, Chhattisgarh, India
Kewal Krishan Department of Anthropology, Panjab University, Chandigarh,
India
Prashant Kumar Department of Microbiology, Kalinga University, Raipur, India
Department of Bioinformatics, Kalinga University, Raipur, Chhattisgarh, India
Nithyanandam Mahalakshmi Department of DNA, Forensic Sciences, Chennai,
Tamil Nadu, India
H. Manderiya Department of Forensic Science, Institute for Excellence in Higher
Education, Bhopal, Madhya Pradesh, India
xiv Editors and Contributors

Aditi Mishra Kristu Jayanti College, Bangalore, India

Alka Mishra Department of Biology, Regional Forensic Science Laboratory,
Gwalior, Madhya Pradesh, India
Sarthak Misra Indira Gandhi Institute of Medical Sciences, Patna, India
Tanima Nandi Department of Forensic Science, Adamas University, Kolkata,
India
Pratiksha H. Nimbkar School of Applied Sciences and Technology, Gujarat
Technological University, Ahmedabad, Gujarat, India
Ragini Pandey Department of Forensic Science, Jain University, Bangalore, India
Radha Patel Department of Forensic Science, Adamas University, Kolkata, India
Varsha Rani Patel Faculty of Science, Department of Forensic Science, Medi-
Caps University, Indore, Madhya Pradesh, India
Avinash Puri Department of DNA and Forensic Biology, Regional Forensic Sci-
ence Laboratory, Indore, Madhya Pradesh, India
Monisha Samuel Department of Forensic Science, National Forensic Sciences
University, Delhi Campus (LNJN NICFS), New Delhi, Delhi, India
Himani Sharma Faculty of Science, Department of Forensic Science, Medi-Caps
University, Indore, Madhya Pradesh, India
Parth Sharma School of Applied Sciences and Technology, Gujarat Technologi-
cal University, Ahmedabad, Gujarat, India
Rutwik Shedge School of Forensic Science, National Forensic Sciences Univer-
sity, Gandhinagar, Gujarat, India
Moumita Sinha Department of Forensic Science, Kalinga University, Raipur,
Chhattisgarh, India
Department of Microbiology, Kalinga University, Raipur, India
Pooja Uppal Department of Forensic Science, Adamas University, Kolkata, India
Varsha Warrier Department of Forensic Medicine and Toxicology, All India
Institute of Medical Sciences, Jodhpur, India
Prachi Yadav Department of Forensic Science, Guru Ghasidas Vishwavidyalaya,
Bilaspur, Chhattisgarh, India
Introduction: Forensic Biology
1
Avinash Puri and Neelam Arya

Abstract

Forensic science is the accumulation and application of a wide field of combined

knowledge borrowed from a large number of scientific disciplines to reveal facts
about ambiguous situations pertaining to unexplained occurrence that holds
relevance to the legal system of society. One of the most important and nowadays
necessary aspects of investigation is scientific investigation implementing foren-
sic science or the practice of scientifically examining physical evidence collected
from the scene of a crime or a person of interest in a crime. Forensic biology is the
scientific analysis of biological evidence to provide objective information on
legal matters. Over the years, the application of scientific methods in the investi-
gation of crime has developed into a full-fledged field of specialization such as
forensic biology.
Every crime takes place at a certain time at a certain place or places and
involves a victim and the person or persons committing the crime. The perpetrator
may or may not use a weapon. Depending upon the case circumstances, the
biological material is transferred between the scene, the victim, the perpetrator
and the weapon. Using technology, forensic biologists collect and analyse
biological evidence/material found on clothing, weapons and other surfaces to
determine the time and cause of death and other crucial information. Forensic
biologists examine blood and other bodily fluids, hair, bones, insects and plant
and animal remains to help identify the perpetrator. For example, evidence/items
found in a perpetrator’s possession may be linked to a victim. This also applies to

A. Puri (✉)
Department of DNA and Forensic Biology, Regional Forensic Science Laboratory, Indore, Madhya
Pradesh, India
N. Arya
Forensic science laboratory, Madhuban, Haryana, India

# The Author(s), under exclusive license to Springer Nature Singapore Pte 1

Ltd. 2024
A. Puri et al. (eds.), Fundamentals of Forensic Biology,
https://doi.org/10.1007/978-981-99-3161-3_1
2 A. Puri and N. Arya

the transfer of evidence based on the principles of exchange material theory, also
known as Locard’s exchange principle, which theorizes that the cross-transfer of
evidence occurs when a perpetrator came in contact with the victim.
In addition, forensic biology includes a number of disciplines and a number of
principles to analyse different kinds of biological evidence taking advantage of
DNA sequencing and other biomolecular techniques. As a result, DNA evidence
has been used to help identify perpetrators of crimes and to exonerate innocent
people before they become suspects. It is clear that forensic biological technology
is here to stay and will continue to help forensic investigations, though it will keep
advancing at a rapid pace, necessitating constant updating of relevant information
on the part of investigative agencies, forensic professionals and biologists.

Keywords

Forensic biology · Scientific investigation · Biological evidence · DNA

sequencing · Crime scene · Exchange of material

Forensic biology is the scientific analysis of biological evidence to provide objective

information on legal matters. Over the years, the application of scientific methods in
the investigation of crime has developed into a full-fledged field of specialization
such as forensic biology. The field of forensic biology deals with the examination of
the evidence pertaining to living beings, and their associated biological materials,
commonly found at the scene of a crime. Forensic biologists analyse physiological
fluids tissue and cellular samples that are relevant to crime investigation.
By comparison of the DNA profile from crime scene samples to known samples,
the results can serve to link victims and suspects with the crime scene or can rule out
a suspect from association with that particular crime. Moreover, scientific analysis of
biological evidence may provide unbiased information to substantiate case
circumstances, corroborate or refute an alibi or identify and establish a weapon
used in a crime. Additionally, it is necessary because no human eyewitnesses are
present to help solve the mysterious murder and rape, but forensic biology provides
critical leads concerning the people who committed the crime. The society for its
continued welfare and progress wishes to keep the crime in check by bringing into
play all the forces at its command. It involves the dispensation of justice which is the
role of the criminal justice system.

1.1 History and Development

The application of science and technology to the detection and investigation of crime
and the administration of justice is not new to India. Although our ancestors did not
know forensics in its present form but applied forensics in various fields, without
knowing the science behind it. Now, forensics has turned into a wide branch, which
is used to solve crimes and for other purposes also.
1 Introduction: Forensic Biology 3

The recent technological and scientific development in the field of forensic

biology is certainly stamping a huge impact in convicting criminals without any
doubt. Forensic biology today has been expanded with numerous innovative tech-
nological advances and molecular discoveries. Following refinement and rigorous
testing, many technologies/protocols have been standardized by forensic
laboratories, including polymerase chain reaction, Genetic Analyzers, expert soft-
ware systems and automated liquid handling.
In the ancient world, the king used to decide the culprits and punish them. These
punishments were applied in favour of their existence, just to show how powerful
they are. With the passage of time, everything changed; the man with knowledge
replaced the king, and punishments were given with respect to the intensity of the
crime the culprit had committed. Now when a crime occurs, the court of law decides
the culprit, and punishment is based on the scientific evidence and statements
produced by the investigating agency and prosecution before the court. In Roman
times, the incident was narrated in front of the public. The culprit and the victim were
given a chance to deliver their words based on their side of the story to prove their
innocence and escape from the punishment. The person with the best argument
would win the debate of proving the crime, and based on the points of argument, the
public or the people with higher power determine the consequences.
Various branches have their own root of origin that gives us a simple outline of
forensic biology itself. Forensics cannot be limited to a few branches; it is a wide
stream of science that relates each and every branch to solve the mystery behind each
crime. With each passing day, the technology develops, and its applications in
forensic science also get increased. The advanced techniques help the investigating
officers’ prosecution and judiciary to solve a crime and come to a conclusion easily.
As technology improves, the type and manner of crime also get improved. Still,
many scientists are working on advanced techniques for the application of forensic
biology.

1.2 Common Discipline

Forensic biology is a broad discipline that includes various areas of specialization

such as DNA analysis, forensic anthropology, forensic entomology, forensic
odontology, forensic pathology, forensic toxicology, forensic botany, forensic serol-
ogy, forensic microbiology and diatom examination. This deals with the following
analysis

1. Examination and identification of biological fluids like blood, urine, semen,

sweat, saliva, milk, tears, juice and determining their origin either come from
human, plant or animal sources (Fig. 1.1).
2. Examination and identification of materials like wood, fibre, faecal matter, nails,
bones, teeth, leaves, seeds, pollen and other plant material.
3. Identification and examination of diatom in the water, human viscera and food
items.
4 A. Puri and N. Arya

Fig. 1.1 Common discipline

of forensic biology Forensic Anthropology

Forensic Entomology

Forensic Biology
Forensic Odontology

Forensic Pathology

Forensic Toxicology

Forensic Botany

Forensic Serology

Forensic Microbiology

4. Determination of the group of blood, semen, sweat and saliva if found to be of

human origin.
5. Determination of paternity/maternity and identity of an unknown individual by
DNA profiling.
6. Determining the time since death by examining the bones and teeth.
7. Determining the age and sex of human beings by examining the skeleton remains.
8. Determining the time since death and manner of death by examining the insects
found on and near the dead body.

1.3 Basic Principles of Forensic Science

Science and technology have captured the mind of all agencies in the criminal justice
delivery system. Forensic science is the scientific discipline which is engaged to the
recognition, identification, individualization and evaluation of physical evidence by
using the laws and principles of natural science for the purpose of administration to
terminate doubtful questions in the court of law. All these principles of forensic
1 Introduction: Forensic Biology 5

science are essential in crime scene investigation to link a suspect/criminal with the
scene of the crime as well as the victim.

1. Law of Individuality
This law states that ‘Every object whether natural or man-made has a
distinctive quality or characteristic in it which is not duplicated in any
other object’, in other words, no two things in this universe are alike. The
most common example is the human fingerprints, they are unique and permanent
and prove the individuality of a person. Even twins do not have the same
fingerprints. This principle is considered the most basic elementary unit of
forensic science. Fingerprints, footprints, tool marks and marks on fired bullets
obtained from the crime scene are studied and analysed on the principle of
individuality.
2. Law of Progressive Change
Change is inevitable. ‘Longer the delay, greater the changes’. This principle
emphasizes that ‘Everything changes with the passage of time and nothing
remains constant’. The changing frequency varies from sample to sample and on
different objects. The scene of occurrence undergoes rapid changes and it must be
secured in time otherwise a change in weather like rain, heat, wind and presence
of animals/humans affects the crime scene. Samples degrade with time, bodies
decompose, tyre marks, footmarks and bite marks fade, the firearm barrel loosens,
metal objects rust, etc. Without an appropriate preservative, tissue samples start
degrading immediately and they need immediate analysis. The criminals undergo
progressive changes with time. If he is not apprehended in time, he becomes
unrecognizable except for his fingerprints or other characteristics of permanent
nature.
3. Locard’s Principle of Exchange (Law of exchange of material)
This principle was stated by French scientist Edmond Locard (a pioneer in
criminology and forensic science). Law of exchange states that, ‘As soon as
two things come in connection with each other, they mutually interchange
the traces between them’.
Whenever a criminal or his weapon of crime comes in contact with the victim
made a connection with the victim or the things surrounding him, they leave
traces. Likewise, the criminal or his weapon picks up traces from the same
contact. These traces are very helpful for investigation purposes as these traces
are identified by the expert and linked to their original source resulting in the
decisive linkage of the criminal with the crime scene and the victim. This law
forms the basis of scientific crime investigation. The basic requirement of this law
is the correct location of the physical evidence—(a) What are the areas and things
with which the perpetrator or tool actually came in contact during the crime?
(b) Investigating officer should establish the correct points of contact, it leads the
investigation in the correct direction (Fig. 1.2).
4. Principle of Comparison
The law state that ‘Only the likes can be compared’. For laboratory investiga-
tion, this law is very important. It highlights the requirement of providing similar
6 A. Puri and N. Arya

Fig. 1.2 Locard’s exchange

principle

samples and specimens for evaluation with the questioned items. For example, if
the murder is done by a firearm weapon then it is useless to send a knife for
comparison. So, the important condition of this principle is to supply specimens/
samples of similar nature for proper assessment with the questioned sample
discovered from the crime scene.
5. Principle of Analysis
This principle states that ‘The quality of any analysis would be better by
collection of correct sample and its correct preservation in the prescribed
manner’. Improper sampling and contamination render the best analysis useless.
If you collect a hard disk in a paper bag, it can be damaged when it falls within the
range of a strong electromagnetic field, resulting in poor results. Hence, always
appropriate and effective collection and packaging techniques must be used.
6. Law of Probability
This law states that ‘All identifications (definite or indefinite), made con-
sciously or unconsciously on the basis of probability’. The probability is
mostly misunderstood if we say that according to probability a particular finger-
print has come from the given source, but it is not a definite opinion. The
perpetrator blood group is also the blood group of various people is high, but
the probability of the same occurring in the case is low. Probability is a mathe-
matical concept. It determines the chances of occurrence of a particular event in a
particular way.
7. Law of Circumstantial Facts
According to this law, ‘Facts do not lie, cannot be wrong, men can and do’.
This law emphasizes the significance of circumstantial facts and supports that a
statement given by eyewitnesses may or may not be accurate. In an investigation,
identified and discovered facts are more accurate and reliable than any
eyewitness.

Forensic science by these principles is used for recognition, identification; indi-

vidualization of pieces of evidence collected from the scene of crime and guides the
criminal proceedings from the discovery of a crime to the conviction of the accused,
helping the process of investigation.
1 Introduction: Forensic Biology 7

Multiple Choice Questions

1. Locard’s principle of exchange relates to

(a) Exchange of trace evidence material
(b) Exchange of criminal information
(c) Foreign exchange
(d) Exchange of hearts
Answer: (a)
2. Screening tests are performed for
(a) Definite identification
(b) Tentative identification
(c) Quantitative analysis
(d) Semiquantitative analysis
Answer: (b)
3. Which of the following preservatives is used for preserving hair for DNA analysis
(a) Dimethyl sulfoxide
(b) Normal saline
(c) Rectified spirit
(d) No need of preservatives
Answer: (d)
4. In case of poisoning of living persons, the following biological samples are
preserved, except
(a) Vomit
(b) Excereta
(c) Unsoiled clothing
(d) Stomach wash
Answer: (c)
5. Faecal matter as evidence is encountered in cases like
(a) Rape
(b) Murder
(c) Hanging
(d) Bestiality
Answer: (d)
6. The colour of blood in deaths due to burns is
(a) Pink
(b) Blue
(c) Cherry red
(d) Brown
Answer: (c)
7. Forensic palynology is the study of
(a) Fossils
(b) Spores
(c) Pollens
(d) Both (b) and (c)
Answer: (d)
8 A. Puri and N. Arya

8. Following could be analysed from bite marks

(a) Saliva
(b) Denture
(c) Caused by child or adult
(d) All the above
Answer: (d)

Further Reading
Arya N (2014) Advanced molecular biology: as a significant forensic tool. In: Proceedings-next
generation science: vision 2020 and beyond. ISBN 978-81-920945-4-0
Arya N (2017) Microbial Forensics: A newly emerging crime fighting tool. In: Souvenir of
international conference on microbes for health and wealth
Arya N, Jilowa CR (2013) Role and impact of advanced forensic technology in criminal justice
system. Kurukshetra Law J III. ISSN-2231-5519
FBI (1999) Handbook of forensic services: evidence examinations, 1999. U.S. Department of
Justice, FBI, Washington, DC
Federal Bureau of Investigation (2013) ‘Clearances’. Accessed 16 April. http://www.fbi.gov/
aboutus/cjis/ucr/crime-in-the-u.s/2011/crime-in-the-u.s.-2011/clearances
Frippiat C, Zorbo S, Leonard D, Marcotte A, Chaput M, Aelbrecht C, Noel F (2011) Evaluation of
novel forensic DNA storage methodologies. Forensic Sci Int Genet 5(5):386–392. https://doi.
org/10.1016/j.fsigen.2010.08.007
McClintock TJ (2014) Forensic Analysis of Biological Evidence: A Laboratory Guide for
Serological and DNA Typing ISBN 9781466504561
Melton T, Holland C, Holland M (2012) Forensic mitochondrial DNA analysis: current practice and
future potential. Forensic Sci Rev 2012(24):101–122
Ogden R (2010) Forensic Science, genetics and wildlife biology: getting the right mix for a wildlife
DNA forensic lab. Forensic Sci Med Pathol 6:172. https://doi.org/10.1007/s12024-010-9178-5
Rana AK (2018) Crime investigation through DNA methylation analysis. Methods and applications
in forensics. Egypt J Forensic Sci 8:7
Roberts KA, Johnson DJ (2012) Investigations on the use of sample matrix to stabilize crime scene
biological samples for optimized analysis and room temperature storage. U.S. Department of
Justice, Washington, DC, p 296
Schmedes SE, Sajantila A, Budowle B (2016) Expansion of microbial forensics. J Clin Microbiol
2016(54):1964–1974
Tewari RK, Ravikumar KV (2000) History and development of forensic science in India. J Postgrad
Med 46(4):303–308
Investigation of Biological Evidence
2
Neelam Arya and Avinash Puri

Abstract

The investigation of crime is in fact a dynamic process of formulation and testing

of the hypothesis of crime and there is no substitute for a careful and thoughtful
approach. An investigator must not jump to hasty conclusions as to what hap-
pened based upon limited information but must generate several different theories
of the crime, keeping the ones that are not eliminated by incoming information at
the scene.
Physical evidence can range from massive objects to microscopic items,
resulting from a crime and recovered at the scene or relevant locations. The
purpose of the observation and documentation of the crime scene condition is
to note the location of potential evidence and to mentally outline how the scene
will be examined. Considering all sources of information available in
investigations, physical evidence plays a vital role. Physical evidence, when
recognized and properly handled, offers the best prospect for providing objective
and reliable information regarding the incident under investigation. However, the
value of even the most carefully recovered and preserved evidence can be lost if
the chain of custody is not properly maintained. Chain of custody exists to ensure
full transparency in the process of how evidence is collected, handled, and stored.
Once an item is recognized for its evidence value, the collection becomes a
relatively simple matter of performing the following routine tasks; i.e., handling
the evidence properly, marking the evidence for later recognition, packaging the
evidence to prevent alteration or damage, tagging the evidence for package

N. Arya
FSL, Haryana, Madhuban, Haryana, India
A. Puri (✉)
Department of DNA and Forensic Biology, Regional Forensic Science Laboratory, Indore, Madhya
Pradesh, India

# The Author(s), under exclusive license to Springer Nature Singapore Pte 9

Ltd. 2024
A. Puri et al. (eds.), Fundamentals of Forensic Biology,
https://doi.org/10.1007/978-981-99-3161-3_2
10 N. Arya and A. Puri

recognition, and maintaining the chain of custody. The last phase of the crime
scene investigation process aims at selecting the means of transportation and
storage that are appropriate for the type of physical evidence to ensure the
integrity of evidence to be forwarded to the laboratory.
In a broader sense, crime scene management— implementing new
technologies and methodologies in forensic science—is the first and most impor-
tant golden moment in solving any crime and strengthening the criminal justice
system.

Keywords
Crime scene processing · Physical evidence · Biological evidence · Chain of
custody · Collection of evidences · Recreation of crime scene

2.1 Crime Scene Management

One of the most important and nowadays necessary aspects of the criminal justice
system is crime scene management which leads to scientific investigation
implementing forensic biology or the practice of scientifically examining biological
evidence collected from the scene of a crime or a person of interest in a crime. The
investigation begins at the crime scene with the recognition and recovery of physical
evidence. The investigation is basically the art of unearthing the truth for the purpose
of successful detection and prosecution. The success and failure of criminal investi-
gation depend on the thoroughness of the exercise at the scene of crime.
The examination of the scene of crime needs meticulous planning and care. The
investigation may fail due to improper handling of the scene of the crime and may
destroy and contaminate the evidence. There is no substitute for a careful and
thoughtful approach. A thorough crime scene processing can lead to a sequential
collection of evidence that constitutes a crucial part of the legal processing of the
case. “Processing a crime scene” is a long, tedious process that involves purposeful
documentation of the conditions at the scene and the collection of any physical
evidence that could possibly illuminate what happened and point to who did it.
The scene of crime processing is the golden hour of investigation. Golden hour is
the term used for the period immediately after an offence has been committed when
the material is readily available in high volumes to the police which is of crucial
importance in the identity of potential suspects and to obtain relevant facts and data.
Positive action in the period immediately after the report of a crime minimizes the
amount of material that could be lost to the investigation and maximizes the chance
of securing the material that will be admissible in a court of law (Fig. 2.1).
There is no typical crime scene, there is no typical body of evidence, and there is
no typical investigative approach. Each and every crime scene is unique and delicate
in nature. The protocol for the crime scene investigation differs from the scenario
associated with the crime. No specific standard is adopted because the delicacy and
fragility of a crime scene differ with the type of the crime scene it is associated with.
2 Investigation of Biological Evidence 11

Fig. 2.1 Scene of crime processing is the golden hour of investigation

For example, an indoor crime scene is considered more secure than an outdoor scene
of crime. Likewise in a hit-and-run case, the safety of the crime scene is the primary
concern because of the interference of the travelers and on-lookers around.
The crime scene investigator arrives on the scene and makes sure it is secure. The
most important aspect of evidence collection and preservation is protecting the crime
scene. This is to keep the potential evidence uncontaminated until it can be recorded
and collected. Scene preservation starts soon after the incident is discovered and
reported to the police station. The investigator does an initial walk-through to get an
overall feel of the crime scene, finds out if anyone moved anything before he arrived,
generates initial theories based on visual examination, and makes note of potential
evidence. At this point, he touches nothing. Concerns for scene protection end only
when the scene investigation process is completed and the scene is relieved.
Demarcation of the area to be protected is a complex activity, and the boundaries
of the scene may change as the investigation unfolds. What appears to be obvious at
the outset may change and need to be re-evaluated. Once demarcated, the area is
clearly cordoned off using any kind of physical barriers. From the beginning to the
end of the crime scene in the investigation, strict anti-contamination measures are
important like wearing protective clothing and gloves., using a single path when
entering the scene, and avoiding moving anything/anybody, unless it is of absolute
necessity.
Investigators working at crime scenes may be exposed to various health and
safety hazards. Not all hazards are immediately obvious and some may come up as
the investigation unfolds. Potential health and safety hazards may arise from a
number of sources, at a crime scene:

1. Chemicals, either present at the scene such as in the case of clandestine

laboratories or used as part of the investigation.
2. Biological materials like blood and body fluids may be a source of risk for HIV
and other infections.
12 N. Arya and A. Puri

3. Environmental factors, e.g., excessive heat or cold.

4. Unexploded explosives like booby traps and firearms.
5. Insecure environment, when the offender is still present at the scene.
6. Unsafe structure especially when collecting evidence at fire and bombing scenes.
7. Other risks include sharp objects, radiological, nuclear and electrical risks,
gases, etc.

In a broader sense, crime scene management—implementing new technologies

and methodologies in forensic science—is the first and most important golden
moment in solving any crime and strengthening the criminal justice system.

2.2 Documentation and Legal Considerations at Crime Scene

2.2.1 Documentation of the Crime Scene Conditions

The goal of crime scene documentation is to create a visual record that will allow the
prosecution and judiciary to easily recreate an accurate view of the scene. Docu-
mentation aims at producing a permanent, objective record of the scene, the physical
evidence and any changes that take place. The purpose of the observation and
documentation of crime scene condition is to note the location of potential evidence
and to mentally outline how the scene will be examined. The crime scene conditions
should be carefully observed and transient details, such as lighting on/off, weather,
temperature, movement of furniture or other disturbances made, and conditions that
would support or refute suicide/self-defense should be recorded. It is also important
to be able to recognize what should be present at the scene of the crime but is not
there, e.g., keys, watch, ornaments, vehicles, etc. Similarly, the objects which appear
to be out of place and might have been left by the perpetrators should be taken note
of. The most common documentation methods are note taking, drawing sketches,
taking photographs, videography, and three-dimensional mapping of the scene of the
crime (Fig. 2.2).

Note making: Note making at a crime scene is not as straightforward as it may

seem. An expert or investigator training includes the art of scientific observation.

Fig. 2.2 Documentation of scene of crime by note making, photography, videography, and by
three-dimensional (3D) scanner
2 Investigation of Biological Evidence 13

Whereas a layperson may see a large, brownish-red stain on the carpet, spreading
outward from the corpse, and write down “blood spreading outward from underside
of corpse,” an expert would write down “large, brownish-red fluid spreading out-
ward from underside of corpse.” This fluid might be blood or it might also be
decomposition fluid, which resembles blood at a certain stage. In crime scene
investigation, opinions don’t matter and assumptions are harmful. When
describing a crime scene, an expert makes factual observations without drawing
any conclusions. An investigator first makes a rough sketch that is later turned into a
finished sketch showing the positions of persons and objects with a scale.

Sketching: An investigator creates sketches to depict the entire scene, which is

easier to do in a sketch than in notes because a sketch can span several rooms and
particular aspects of the scene that will benefit from exact measurements. The sketch
of the crime scene establishes the distance, size, and relationship between various
objects in the scene. The sketch artist may indicate details like the height of a
window frame, the exact size of the room, the distance from the window to the
door, and the length of skid marks or tire marks on the road.

Photography: An investigator takes pictures of everything before touching or

moving a single piece of evidence. The medical examiner will not touch the corpse
until the investigator has taken photograph of it and of the surrounding area. The
overview, mid-range, and close-up views of the scene should be photographed
successively. Overview shots are the widest possible views of the entire scene.
Mid-range photos come next. These shots show key pieces of evidence in context,
so the photo includes not only the evidence but also its location in a room and its
distance from other pieces of evidence. Close-ups of individual pieces of evidence
show any serial numbers or other identifying marks that includes a ruler for scale.

Videography: Scene documentation may also include a video walk-through, espe-

cially in major cases involving large areas or multiple homicides. A video recording
can offer a better feel for the layout of the crime scene like how long it takes to get
from one room to another and how many turns are involved, for instance. Also, once
the investigation is further along, it may reveal something that was overlooked at the
scene because the investigator didn’t know to look for it. During a video walk-
through, the investigator captures the entire crime scene and surrounding areas from
every angle and provides a constant audio narrative.

Three-dimensional (3D) scanning: This technology has been growing incredibly

fast in just the past few years, changing forensic workflows worldwide. The docu-
mentation of crime scenes is a painstaking process. Once investigators arrive at the
scene, there’s a lot to swallow. First, the evidence can be completely unpredictable
since all evidence is not created equally. Despite that, diagrams supported by various
measurements are essential as the scene is documented. Traditionally, investigators
used tools, such as paper sketchbooks, measuring tape, or rulers, and photography
that was time consuming and often lacked accuracy and consistency. They may
14 N. Arya and A. Puri

measure the length of a piece of evidence, but not how far away it was from another
piece of evidence. In contrast, 3D scanning captures all the measurements in a room
and all the objects, plus photo-realistic colors, textures, and geometry. It is far more
accurate, data-rich, and faster, enabling investigators to explore the scene
reconstructed digitally well after the actual scene is cleaned up. By capturing large
amounts of data quickly, 3D scanners enable investigators to create a complete
360-degree image of a scene in minutes. Besides enabling investigators to clear a
scene faster, this is also valuable if new evidence emerges or suspects change their
narratives. The result is a more comprehensive investigation rather than relying on
photographic imagery alone.

2.2.2 Legal Considerations

The legal considerations determine the admissibility of the evidence collected at the
crime scene. Failure to comply with existing laws, rules, and regulations can result in
a situation where the evidence cannot be used in court. Hence, it is a matter of
importance for personnel working at the scene to be aware of and to ensure proper
compliance with these rules. Local laws, rules, and regulations govern many
activities of the crime scene investigation and forensic process such as how to obtain
authority to enter the scene, to conduct the investigation, to handle evidence, and to
submit physical evidence to the forensic science laboratory or other investigating
agency. Regardless of local rules and regulations, codes of professional conduct
outline the moral obligations of personnel working at crime scenes. Such codes
typically stress on the importance of acting with care and professionalism, objectiv-
ity, open-mindedness, and impartiality. If there is a conflict between the preservation
of evidence and the possibility of saving a human life, priority is always given to
emergency medical care.

2.3 Collection, Packaging, Preservation, and Transportation

of Biological Sample

Once the crime scene has been thoroughly documented, the collection process of
physical evidence begins. Every piece of evidence of the slightest importance should
be collected without any delay. Delay may result in the loosing of material evidence
affecting the solving of the crime properly. Crime scene evidence could be found at
any place where a crime has been committed, i.e., a crime scene. It may be found on
anything worn or carried by the victim during the time of the offence or within or on
the body of any person associated with the crime, i.e., offender/ perpetrator. Hence,
the evidence could be collected not only from the scene of the crime rather than from
the victim/deceased and from his environment. This collection process also involves
the role of the medico-legal doctors or medical men along with the investigating
agency, who deal with the accused or victim in any manner after the crime. It cannot
be generalized as to what are the biological evidence to be collected during the crime
2 Investigation of Biological Evidence 15

investigation. Each kind of crime involves the collection of different types of

evidence which can lead to the investigation of that particular crime. However, as
general guidance following biological evidence and material may have evidentiary
value:

• Blood, semen, saliva, vomit stains, tissue/fetal remains, bones/teeth, hair strands,
nail clippings, sweat, tears, urine/fecal matter, etc.
• Clothing, caps, masks, eyeglasses, and gloves from any involved individual.
• Ligature material, i.e., cloth piece, rope, belt, wire/cable, etc.
• Bedding, i.e., pillow, mattresses, etc.
• Cigarette butts or other smoking devices.
• Licked items like envelopes, stamps, etc.

While packaging the material for dispatch to the laboratory, care should be taken
to see that no article is inadvertently contaminated with extraneous material and for
that purpose, the investigator must choose the proper packaging material and the
same way the size of the packaging material is equally relevant and significant. Too
small packing is likely to be inadequate and if too big it would be difficult to recover.
Ideally, the size of the packing material should be according to the size of the sample.
These are some general principles for the packaging of biological samples:

• Each sample should be separately packed and labeled indicating the serial number
of an item.
• Never pack more than one type of sample together.
• All the packets belonging to one case should be enclosed in one box or an outer
covering.
• Evidence belonging to different cases should not be forwarded under the same
cover. All exhibits should be carefully sealed by the dispatching authority and
packed in such a manner that they cannot be opened without destroying the seal
and the seal should be the same throughout, along with the sample seal.

Certain environmental factors may break down biological evidence into smaller
pieces, and environmental factors may be negated by maintaining the evidence in a
climate-controlled environment, preventing direct exposure to light. If evidence
containing DNA is packaged correctly and stored under proper conditions, it will
be stable and therefore useful for forensic examination indefinitely. The forensic
laboratory has successfully examined cases where the DNA evidence was stored for
more than 25 years (Table 2.1).

• Liquid blood can be collected on cotton gauze cloth piece/thread, air dried in
shade and packed in paper envelope.
• Blood can also be preserved on an FTA card.
• Blood stains can be scratched and placed in paper envelope. Blood-stained earth
should be thoroughly dried and placed in a paper envelope, along with unstained
earth collected as control.
16 N. Arya and A. Puri

Table 2.1 General guidelines for collection, packaging preservation, and transportation of
biological evidence
Biological
evidence/ Collection packaging Transportation/
sample Source/location and preservation precautions
Blood Living person – Collect in an EDTA Maintain cold chain
tube with the coolant pack
– On the FTA card and transport to the lab
at the earliest possible
preferably within 24 h
Blood Crime scene – In an EDTA tube Avoid placing in
– On the FTA card excessive heat and
– Lift on moist cotton transport to the lab at
thread and keep in an the earliest possible
airy envelope
Blood Clothing of victim/suspect – Air dry in the shade – Avoid blower or
or from the scene of the – Wrap in a paper sheet heater to dry blood-
crime separately to avoid any stained clothes
cross contamination transport to the lab at
the earliest possible
Blood/ Dried blood stains on any – Scratch with sterile – Dry in the shade and
vomit/other article/floor/weapon, etc. forceps/scalpel and transport to the lab at
body fluid recovered during the collect in a paper the earliest possible
stains investigation envelope
– If in little amounts, – Avoid air-tight
lift with moist thread containers
and keep in a paper
envelope
– Never mix blood
scrapings
Semen Victim, suspect, crime – Collect the sample – Transport to the lab
scene with a sterile cotton without any delay
swab and pack it in an
airy envelope after
properly drying it
– Medical officer also – Dry in the shade and
need to collect samples transport to the lab at
separately and keep the earliest possible
them in an airy – Avoid air-tight
envelope separately containers
Vaginal/ Victim, suspect, crime – Collect the sample – Transport to the lab
anal stains / scene with a sterile cotton without any delay
swab swab and pack it in an
airy envelope after
properly drying it
– Medical officer also – Dry in the shade and
need to collect samples transport to the lab at
separately and keep the earliest possible
them in an airy – Avoid air-tight
envelope separately containers
(continued)
2 Investigation of Biological Evidence 17

Table 2.1 (continued)

Biological
evidence/ Collection packaging Transportation/
sample Source/location and preservation precautions
Teeth/bone Dead body, at crime site or – Wash and clean to – Transport to the lab
pieces any other suspected place remove debris dry in without any delay
the shade and wrap in a – Dry in the shade and
paper sheet or muslin transport to the lab at
cloth separately the earliest possible
– Bone sample should
remain intact, so
transport in a hard
container or box
– Charred/completely
burnt bones are not
suitable for DNA
profiling
Body Dead body, fragments of – Must be placed in a – Maintain cold chain
tissue/ the body at the crime site sterile container along with a coolant pack and
organ or any other suspected with recommended transport to the lab
place saline for preservation without any delay
– Medical officer need – Never use formalin as
to take samples a preservative
separately
Small/long – Transferred on clothing – Collect with sterile – Dry in the shade and
hair strands and body of victim/ forceps and keep in a transport to the lab at
(pubic hair/ suspect, at crime site or paper envelope or the earliest possible
scalp hair) any other suspected place/ zip-locking envelope
vehicle – Can use cello tape to
collect the samples
– If hair strands are – Never clean or wash
found stuck on any the hair strands
small object, preferably recovered during the
don’t remove them and investigation
pack the whole object
in a paper sheet or airy
envelope
– Collect reference
samples from the victim
and suspect (50–60 hair
strands with root)
Sample for Blood/semen/blood- – On the FTA card – Transport to the lab
DNA stained garments/bedding/ without any delay
profiling bones/teeth/smear slides/ – Lift on moist cotton – Bone sample should
vaginal swab/vehicle/ thread and keep in an remain intact, so
crime scene and vicinity airy envelope transport in a hard
container or box
– Air dry in the shade – Charred/completely
burnt bones are not
(continued)
18 N. Arya and A. Puri

Table 2.1 (continued)

Biological
evidence/ Collection packaging Transportation/
sample Source/location and preservation precautions
suitable for DNA
profiling
– Wrap in a paper sheet
separately to avoid any
cross contamination

• Blood/semen-stained garments should be air dried and packed/wrapped in paper

sheets separately in such a manner that the stained portion (should be marked, if
possible) should not contaminate the unstained area of the garment.
• Blood-stained area of any weapon should be wrapped with paper and packed in a
paper bag.
• Soft tissue or organs taken during postmortem examination should not be pre-
served in formalin, as it affects the DNA typing results.
• Saliva can be lifted with a cotton swab from the bite marks on the victim.
• Hair strands of the victim/suspect should be collected with the help of sterile
forceps and placed in a paper envelope along with control samples of the victim/
suspect.
• Bones/teeth should be washed and dried properly before wrapping them into a
brown paper sheet or envelope. Remnants of burnt bones are very fragile and
need to be handled carefully. They should be collected and placed in a wooden or
hard cardboard box with a shock-absorbing material.
• Ashes from the cremation site should be placed in a wooden or hard
cardboard box.
• Small fibers sticking to the ligature and ligature mark should be collected with the
help of adhesive tape and secured on a glass slide.
• For the detection of diatom, water samples from the site of drowning and bone
samples of dead bodies should be collected and forwarded to the laboratory. Any
material present in the clenched hands should be properly dried and packed.

The investigator should try to collect and transport the exhibits as soon as
possible since the evidentiary value of the collected material decreases with the
passage of time. The proper time to collect the biological evidence is within 24–72 h
of the occurrence; however, this is not applicable in all cases.

2.4 Chain of Custody

Biological evidence, when recognized and properly handled, offers the best prospect
for providing objective and reliable information regarding the incident under inves-
tigation. However, the value of even the most carefully recovered and preserved
evidence can be lost if the chain of custody is not properly maintained. From the first
2 Investigation of Biological Evidence 19

responder to the end user of the information, all personnel involved should have an
adequate understanding of the scientific and legal processing of the scene of crime.
The chain of custody begins from the crime scene itself and continues till the
evidence is presented in the court. The chain of custody exists to ensure full
transparency in the process of how evidence is collected, handled, and stored.
Chain of custody refers to the chronological and careful documentation of evidence
to establish its connection to an alleged crime. It is of the utmost importance in a case
to maintain each and every record of the evidence from the date of collection to the
date of presentation before the court, because if even any one entry is missed, the
evidence will become inadmissible in the court and non-presentation of even one
evidence can assuredly affect the decision given by the court. The chain of custody
helps in maintaining the integrity and authenticity of the evidence through careful
and cautious handling of the evidence.
To prove someone guilty, a prosecutor must prove that the evidence presented in
court is the same evidence that was recovered at the scene of an alleged crime. They
must be able to show that the evidence was handled properly and was not
contaminated or tampered with. If law enforcement does not properly handle
evidence, the evidence can be challenged on the grounds that it was tampered
with, that test results are faulty or inaccurate, or that evidence was planted at the
scene of a crime. Because the prosecutions rely on evidence gathered by police
officers, it is prosecutors who must establish the chain of custody.
Proving a chain of custody can be difficult. If law enforcement does not do it
correctly, a chain of custody can be successfully challenged in a criminal case.
Challenging the chain of custody can be a successful defense strategy to eliminate
evidence that might be used to convict a defendant. If the judge finds that certain
evidence is not admissible, the prosecutor may not have enough evidence to continue
with the case. A typical evidence log will include the date and time the evidence was
collected, the name of the investigator, the location where the evidence was col-
lected, the reason the evidence was collected, relevant serial numbers, a description
of the evidence, and the method that was used to collect the evidence. Any time
evidence is examined by a forensic scientist, the examiner must list everyone who
came in contact with the evidence and everything that was done to the evidence. A
defendant can challenge the chain of custody of a piece of evidence by questioning
whether the evidence presented at trial is the same evidence as what was collected at
the scene of the crime. If there are any discrepancies in the chain of custody and law
enforcement cannot prove who had the evidence at a particular time, the chain of
custody is broken and the defendant can ask to have the evidence declared inadmis-
sible. A broken chain of custody can result in failure to serve justice. When a proper
chain of custody is maintained, it prevents the police officials and other lab or law
officers to tamper with the evidence, as the record of who collected the evidence,
who handled it, period of guardianship of the evidence, safeguarding conditions
while storing the evidence, and how evidence is handed over to the subsequent
custodians, each time a transfer takes place, and through this record, if any evidence
is tampered it can be easily traced as to who played with the evidence and can thus be
punished for the same.
20 N. Arya and A. Puri

2.5 Crime Scene Reconstruction

Reconstruction of the scene of the crime is the development of actions and

circumstances based on the system of evidence discovered and examination in
relation to a particular crime. Crime scene reconstruction is just like putting together
a jigsaw puzzle but doing so without access to the box top. The analyst does not
know what the picture is supposed to look like. Furthermore, not all of the pieces are
likely to be present, so there will be holes in the picture.
The process of crime reconstruction is not an easy one because we are dealing
with human action and are trying to tell details of what happened at a particular time
in the past. In this philosophy, all elements of evidence that came to light in a given
case are treated as interdependent, the significance of each piece, each action, and
each event falls and rises on the backs of the others. Plan of reconstruction based on

• Available information and data

• Findings on the spot
• Sequence of events
• Missing link
• Hypothesis formation
• Human psychology
• Human behavior
• Determination of the significance of the evidence
• Theory formulation

The basic objective is to have an accurate accounting of the crime scene in order
to determine the facts of the crime and to understand the events that might have
occurred during that period. Frequently, the facts don’t match the story, and solving
a case can be in the smallest of details which are easily overlooked. Crime scene
reconstruction or recreation is one of many profiling techniques used to build a
hypothesis for an offender or to solve a crime. First, assumptions are made about
how the crime was carried out. Then deductive and inductive reasoning is used to
support the theory of how the crime occurred. Understanding the area of the crime
scene, the position of physical evidence, etc. helps to get an idea of the events
leading to crime, physical evidence at crime scenes is, in any case, amazingly
important in the remaking of crimes and the action that has occurred at the crime
scene.
Recreation not just includes logical crime scene investigation, understanding of
the scene design evidence, and research center assessment of physical evidence, yet
in addition, includes methodical investigation of related data and the coherent
definition of a hypothesis and supplant the essential things or activities back at a
crime scene through unique scene documentation. Criminal profiling is a procedure
that depends on the mental and measurable investigation of the crime scene, which is
utilized to decide the general attributes of the most probable suspect for the crime.
Critical thinking is a purposeful and goal-directed activity that is based on the
principles of science and the scientific method. Reconstruction not only involves
2 Investigation of Biological Evidence 21

the scientific scene analysis, interpretation of scene pattern evidence, and laboratory
examination of physical evidence but also involves the systematic study of available
information and data. Not all law enforcement personnel can do crime reconstruc-
tion. It must be someone who is a keen observer, understands science, recognizes
evidence, and can apply logic.

Multiple Choice Questions

1. Dried seminal stains from clothing are preserved in

(a) 40% Formalin
(b) 10% Formalin
(c) 20% Formalin
(d) As such
Answer: (d)
2. A wet bloody shirt should be
(a) Packed as soon as possible
(b) Air dried prior to packing
(c) Air dried and not packed
(d) Dried with heat
Answer: (b).
3. In which of the following cases, the study of diatoms will be helpful
(a) Immersion drowning
(b) Secondary drowning
(c) Filigree burns
(d) Dry drowning
Answer: (b)
4. The most prevalent plant fiber is
(a) Polymer
(b) Wool
(c) Hemp
(d) Cotton
Answer: (d)
5. Nodes are seen in the following fiber
(a) Cotton
(b) Linen
(c) Wool
(d) Silk
Answer: (b)
6. In searching the scene for evidentiary clues, one must first lift
(a) Weapon of offense
(b) Bloodstain
(c) Fired bullet/cartridge case
(d) Micro evidence like hair strand, fiber, etc.
Answer: (d)
7. A crime committed in a vehicle falls in the category of an
22 N. Arya and A. Puri

(a) Indoor crime scene

(b) Outdoor crime scene
(c) Both (a) and (b)
(d) None of above
Answer: (a)
8. Sex of the scalp hair can be determined by the examination of
(a) Length of hair
(b) Cross section of hair
(c) Nucleated cells of the hair root
(d) Medullary index ratio
Answer: (c)
9. Comparison of soil to determine its origin can be detected through
(a) Densitometer
(b) Wet chemical analysis
(c) Neutron activation analysis
(d) Density gradient tube method
Answer: (d)
10. Glass pieces broken from a window pane by the action of heat will generally be
found.
(a) Held together in small fragments
(b) Scattered into fine pieces
(c) In same direction as the source of heat
(d) In opposite direction as the source of heat
Answer: (c)

Further Reading
Amankwaa AO, McCartney C (2021) The effectiveness of the current use of forensic DNA in
criminal investigations in England and Wales. https://doi.org/10.1002/wfs2.1414
Arya N (2011) High potential of plant DNA analysis in forensics. Souvneir on biodiversity:
challenges & opportunities
Arya N (2017) Microbial forensics: a newly emerging crime fighting tool. Souvnenir of Interna-
tional Conference on Microbes for Health and Wealth
Arya N (2018) A hand book on forensic science and criminal justice system. Chandigarh Judicial
Academy, Chandigarh
Arya N, Jilowa CR (2013) Role and impact of advanced forensic technology in criminal justice
system. Kurukshetra Law J III. ISSN-2231-5519
Benecke M (2004) Forensic DNA samples—collection and handling. In: Fuchs J, Podda M (eds)
Encyclopedia of medical genomics and proteomics. Dekker encyclopedias series, 1420, chap
103. CRC Press, New York
Caputo M, Bosio LA, Corach D (2011) Long-term room temperature preservation of corpse soft
tissue: an approach for tissue sample storage. Investig Genet 2(17):6. https://doi.org/10.1186/
2041-2223-2-17
Fujita Y, Kubo S (2006) Application of FTA technology to extraction of sperm DNA from mixed
body fluids containing semen. Leg Med (Tokyo) 8(1):43
IvyPanda (2021) Forensic biology in crime scene investigations. https://ivypanda.com/essays/
forensic-biology-in-crime-scene-investigations/
2 Investigation of Biological Evidence 23

Li R (2008) A book on forensic biology. ISBN 13:978-1-4200-4344-0. eBook PDF

National Institute of Justice (2000) Crime scene investigation: a guide for law enforcement. NCJ
178280. U.S. Department of Justice, Office of Justice Programs, National Institute of Justice,
Technical Working Group on Crime Scene Investigation, 58, Washington, DC
Pathak AG, Gadhari RK, Gavle PS (2018) Importance of visit to the scene of crime to determine
manner of death-a case report. JKIMSU, vol 7-1. ISSN 2231-4261
Rana P, Ranjan AR (2020) Use of forensic science in investigation of crimes; a critical legal study.
IJESC 10:7
Zhang ZL, Liang WB, Sun HB, Yang X, Ma LY (2021) Forensic application of plant. Evidence
37(1):87–90. https://doi.org/10.12116/j.issn.1004-5619.2019.490708
Investigation of the Dead Body
3
Alok Atreya, Rutwik Shedge, and Tanuj Kanchan

Abstract

One of the greatest sources of physical evidence is the dead body of the victim
itself. A cadaver is a plethora of clues, that forensic scientists can investigate and
reconstruct the circumstances surrounding the crime. Death can be defined as the
permanent and irreversible cessation of functions of the three vital organs: the
brain, the heart, and the lungs. Once an individual dies, the body undergoes
certain orderly changes, that may be documented and used for the estimation of
time passed since the individual’s death, also known as the post-mortem interval
(PMI) (Shedge et al., Postmortem changes, StatPearls Publishing, Treasure
Island, 2020). The investigation of a dead body involves examination at the
scene of crime, autopsy or post-mortem examination, and determination of
miscellaneous information such as the mode, manner, and cause of death. This
chapter is divided into three parts: First, it discusses the examination of a dead
body at the scene of the crime, the post-mortem examination and its documenta-
tion, and then the determination of miscellaneous information.

Keywords
Death · Cadaver · Post-mortem examination · Post-mortem interval · Post-mortem
changes

A. Atreya (✉)
Department of Forensic Medicine, Lumbini Medical College, Tansen, Palpa, Nepal
R. Shedge
School of Forensic Science, National Forensic Sciences University, Gandhinagar, Gujarat, India
T. Kanchan
Department of Forensic Medicine and Toxicology, All India Institute of Medical Sciences, Jodhpur,
India

# The Author(s), under exclusive license to Springer Nature Singapore Pte 25

Ltd. 2024
A. Puri et al. (eds.), Fundamentals of Forensic Biology,
https://doi.org/10.1007/978-981-99-3161-3_3
26 A. Atreya et al.

3.1 Definitions

• Autopsy: an examination of a dead body conducted primarily to ascertain the

cause of death
• Death: the permanent and irreversible cessation of the functions of the brain,
heart, and lungs
• Inquest: the legal inquiry into the cause of death
• Post-mortem changes: the changes that a cadaver undergoes after an
individual’s death
• Post-mortem interval: the time elapsed since an individual died

3.2 Introduction

Investigation of death starts immediately if there are evidence suggestive of death

that has occurred with or without the presence of the dead body. For, e.g. there is a
pool of human blood at the scene of the crime which is suggestive that the person
would not survive with such exsanguination. The presence of a dead body is a prima
facie that death has occurred. During homicidal trials in court, a dead body is
considered ‘corpus delicti’ (Knight and Saukko 2016).
The practice of investigation of death and examination differs as per the jurisdic-
tion and also upon who is conducting the inquest. In those countries where a medical
examiner conducts the inquest, the investigation into the death and preliminary
investigation are carried out in the scene of the crime itself. In countries where a
police inquest or the coroner’s inquest is followed, the body is sent to the mortuary
where an examination of the dead body (autopsy) is carried out by a forensic
pathologist. In the latter type, the forensic pathologist visits the scene of the crime
as per the nature of the individual case. Irrespective of the type of inquest, the main
objective of the examination of the dead however remains the same (De Matteis et al.
2020).

3.3 Examination of the Cadaver at the Scene of Crime

At any scene of the crime, if there is a cadaver present, the majority of the attention
of forensic scientists goes towards the dead body. While the deceased has to be
shifted to a nearby mortuary for a detailed post-mortem examination, some prelimi-
nary examination can be conducted at the scene itself. This preliminary examination
of the cadaver includes making a detailed record of the following:

1. The position and location of the cadaver

2. The state of the cadaver (freshly dead, early stages of putrefaction, later stages of
putrefaction, etc.)
3. Presence of any overt injuries, bleeding, etc.
4. The number, dimensions, and location of such injuries
3 Investigation of the Dead Body 27

5. Nature of injuries (abrasions, bruises, lacerations, stab wounds, incised

wounds, etc.)
6. Presence of extrusion of fluids from such injuries
7. Complete photography of the cadaver (overview, mid-ranged, and close up
photographs)
8. Sketching of the cadaver to denote injuries and their dimensions

3.4 Autopsy

An autopsy is a scientific examination of the dead body. Etymologically it is derived

from the Greek word autopsia (autos—oneself, opsis—see). It is also popularly
called post-mortem examination (Latin: mors-death). Autopsy of non-humans is
generally referred to as necropsy (Greek: nekrós—dead). In all cases of unnatural
deaths, an autopsy is done following the requisition from the authority. In cases of
natural deaths where the cause of death is not known, a clinical (hospital) autopsy is
conducted to find out the underlying pathology. Medicolegal autopsy in cases of
unnatural deaths is part of death investigation globally. However, clinical (hospital)
autopsies are not mandatory and are not done in all countries. In medicolegal
autopsies, the law requires the examination of the body, so the consent of the
relatives of the deceased is not required. However, in a clinical autopsy, the doctor
wants to find out the underlying cause of death for a better understanding of the
disease process therefore, the consent of the relatives is mandatory. In a broad sense,
an autopsy is either conducted for medicolegal purposes or for education and
research purposes, hence its classification:

• Medicolegal autopsy
• Clinical (hospital) autopsy
• Anatomical autopsy

Objectives of Autopsy
• To determine the cause of death
• To determine the mechanism of death
• To determine the manner of death
• To establish the time since death
• To ascertain whether the injuries sustained are antemortem or post-mortem
in nature
• In the case of newborn
– To distinguish live birth, dead born, or still birth
– To estimate whether the child was viable or not
– In the case of live birth—to find out the period of survival

(continued)
28 A. Atreya et al.

• To establish the identity of the deceased (in case of a mutilated body,

decomposed body, and mass disasters)
• To determine the type of weapon/object used to cause death
• To establish the link between the crime and the criminal to aid in justice
• To establish the reason for death if possible.

A complete autopsy consists of external examination, internal examination, and

ancillary procedures (Knight and Saukko 2016).
External examination refers to the examination and documentation of all the
external features present on the body surface which includes clothing, the external
genitalia (sex), any injuries, post-mortem feature, personal belongings like
wristwatches, jewellery, identifying features like tattoos, scars, congenital defor-
mity, acquired peculiarity, body length, body weight, hair color and eye color. All
the injuries are to be measured and documented which are then photographed for
later evidence. In cases of unidentified bodies, photographs should be obtained for
identification purposes (Menezes and Monteiro 2022).
After the external examination is complete, internal examination is done which
involves the opening of the body, and removal of the organs for dissection in order to
examine and document the injury and/or underlying pathology (Cordner 1993). A
complete autopsy involves the opening of four body cavities, i.e. cranial cavity,
thoracic cavity, abdominal cavity, and pelvic cavity; and examination of their
contents. Even if the lesion is evident in any one of the body cavities and the
cause of death could be ascertained, for, e.g. a gunshot wound on the head, all the
body cavities are to be opened. Further dissection of the body may be necessary apart
from opening the four body cavities. However, there are instances where the internal
examination is not conducted. In case of severe decomposition or in case of highly
infectious disease, the autopsy may be limited to the examination of a particular
organ/structure (Menezes and Monteiro 2022).
After a meticulous external and internal examination, the cause pertaining to
death is not found. This leads to an obscure autopsy (Knight 1980). When the need
arises, special procedures are conducted during, before, or after autopsy known as
ancillary procedures. These procedures are either conducted in the mortuary itself in
the presence of the forensic specialist or the body fluid sample, tissue sample, or
trace evidence is subjected to laboratory testing. Even after the complete autopsy and
ancillary procedures, the cause of death could not be identified which results in a
negative autopsy (Cohle and Sampson 2001).
A forensic pathologist may at times need to interview the family members to
know the circumstance and manner of death which is known as a follow-up investi-
gation. At times, hospital treatment records need to be examined to fully understand
the clinical picture and source of injury (venous catheter, injection marks, and
fractured rib in case of cardiopulmonary resuscitation).
3 Investigation of the Dead Body 29

3.5 Cause of Death

After the completion of the autopsy, the forensic pathologist should document all the
findings in detail that he/she encountered during the autopsy. After documentation,
he/she is required to provide an opinion as to the cause of death and manner of death
(Cordner 1993). It is therefore important and mandatory to mention the cause and
manner of death in the autopsy report, which would aid the judiciary in solving the
crime.
Death is an irreversible condition where there is a cessation of function of all three
vital systems (respiratory, circulatory, and nervous system) of the body (Knight and
Saukko 2016). If one system of the body ceases to function, the other two will
ultimately fail. However, based upon which system failed first the mode of death is
determined as asphyxia, syncope, or coma. Mode of death as such is not the cause or
mechanism of death, therefore should not be used in death certification or autopsy
reports.

3.6 Manner of Death

Manner of death hints at the circumstances surrounding the death and can be
categorized into natural, unnatural, or undetermined (Advenier et al. 2016). When-
ever a person dies due to old age or due to the ordinary course of a disease, the
manner of death in such a case is considered to be natural. Unnatural manner of death
could be further classified into homicide, suicide, or accidental. The manner of death
when an individual is killed by someone else is a homicide, when the person kills
themselves is a suicide, and when the person dies due to an accident such as a train
derailment is accidental. Whenever there is no sufficient evidence that points to the
mode being natural or unnatural, it is defined to be the undetermined manner of
death.

3.7 Autopsy Proper

The autopsy starts with an external examination of the body. The body should be
photographed before the removal of the clothes, jewellery, and other belongings.

Photographs
• Photographs should be preferably taken by a high-resolution camera.
• However, in case of unavailability any camera can be used provided the
picture quality is good and the findings could be reviewed later on.
• Photographs should include a scale, autopsy number, and date.

(continued)
30 A. Atreya et al.

• Serial photographs should be taken at each and every step of the external
examination.
• Photographs should be obtained before undressing, washing, or shaving
and also thereafter.
• Wide-range photographs should supplement the close-up photographs for
orientation and identification. All the injuries and special features present in
the body should be depicted by close-range photographs.

3.8 External Examination

3.8.1 Clothing

The clothes should be examined for any stains and tears. The clothing should be
noted in terms of colour, texture, material, type, design, size, manufacturer, and
tears, stains and the sequence in which it was present in relation to other clothing. If
any trace evidence is found it should be described and secured for further analysis.
Similarly, all the belongings from the dead body are to be removed and documented
with a description.

3.8.2 Identifying Features

Following the removal of the cloth, the body is examined for external identifying
features like external genitalia, body length, body weight, nutritional status, hair
distribution, colour of skin, colour of hair, and colour of eyes. In the case of foetuses
and infants, apart from the body length, head circumference, crown-rump length, and
crown heel length are also measured. In the case of an unidentified body, the
fingerprints of all the fingers should be obtained. Furthermore, in the case of an
unidentified body, the body should be examined for peculiar identifying features like
congenital malformation (cleft lip, cleft palate, syndactyly, polydactyly, etc.), tattoo,
scars, birthmarks, and acquired deformity (amputation of fingers/ limbs, club foot,
kyphosis, scoliosis, etc.).

3.8.3 Post-Mortem Lividity/Livor Mortis/Post Mortem Hypostasis

After an individual dies, their heart stops circulating the blood throughout the entire
body. As a result, the blood present in the vessels, start coalescing towards the
dependent regions of the body (Shedge et al. 2020). For example, in the case of a
person lying on their back, the dependent regions will be the back and the buttocks of
the individual. Within 1–3 h after death, patches of reddish-blue discolourations can
3 Investigation of the Dead Body 31

Fig. 3.1 Presence of livor mortis on a deceased’s back

be seen in the dependent regions. Within 4–6 h, these patches coalesce and increase
in size. Complete development of the livor mortis can be observed between 6 and 8 h
after death. Before 6–8 h after death, if the cadaver’s position is shifted, there is a
shift in the post-mortem staining as well. This shifting may not be possible at 6–8 h
after death, and the lividity is said to be ‘fixed’ in this case. This ‘fixation of post-
mortem staining’ occurs as the capillaries of the dependent region that contain the
blood rupture, and the blood that comes out of them stains the neighbouring tissues.
This reddish-blue staining of the dead body discolourations after death is known as
post-mortem lividity, livor mortis, hypostasis, or post-mortem staining. Post-mortem
lividity is recorded in terms of colour, position, and whether it is fixed or not
(Fig. 3.1).

3.8.4 Rigor Mortis

Immediately after death, the muscles of the cadaver get relaxed, a phenomenon
which is known as primary relaxation. However, as time goes on, the muscles of the
cadaver undergo stiffening, which is resolved only after the onset of putrefaction.
This stiffening of muscles is known as rigor mortis or post-mortem rigidity/stiffening
(Shedge et al. 2020). When an individual dies, there is a steady depletion of levels of
adenosine triphosphate (ATP). ATP is necessary for the relaxation of muscles, and
its lack causes the body to remain in the position it had acquired immediately after
death. Rigor mortis is first observed in the eyelids, followed by the muscles of lower
jaw, neck, chest, arms, abdomen, legs, and finally the fingers and the toes. Post-
mortem rigidity appears within 1–2 h after death, is completely formed within 12 h
of death, stays for another 12 h, and vanishes in the same order it appeared in the next
12 h. This order of appearance and disappearance is known as the ‘march of rigor’.
The body is examined for the degree of rigor mortis whether it is developing or
fully developed. The rigor is evaluated in all the joints starting from the face and
downwards towards the limbs and is noted in terms of the presence or absence of
stiffness (Fig. 3.2).
32 A. Atreya et al.

Fig. 3.2 Deceased showing rigor mortis in their lower limbs (Mesri M, Behzadnia M, Dorooshi
G. Accelerated rigor mortis: A case letter. J Res Med Sci 2017; 22:126)

3.8.5 Algor Mortis

After the death of a person, the temperature of their body falls steadily with respect to
the ambient environmental temperature. This fall in temperature is known as algor
mortis (Shedge et al. 2020).
The body temperature is recorded at the mortuary. The temperature recorded is
core body temperature, the measurement of which is obtained from a natural body
orifice, most preferably the rectum. An electric thermocouple is used for recording
the body temperature, the electrode of which is inserted into the rectum. However, in
case of the absence of an electric thermocouple, a chemical thermometer can be
used. If the body is refrigerated in the mortuary cold chamber, then recording the
temperature is not necessary.

3.8.6 Injuries

All the external injuries are then to be examined and described. The injury is
described as per their type, location in relation to anatomic landmark, shape, colour,
and dimension. Photographs should be obtained for all the injuries. In cases where
the body hair has masked the injury, shaving should be done prior to examination of
such an injury. Sometimes the actual injury is masked by the blood stain which
should be cleaned prior to the examination. In a suspected case of sexual-homicide,
3 Investigation of the Dead Body 33

ano-genital swabs are obtained during the external examination. The swabs should
be obtained before the measurement of body temperature.

3.8.7 Decomposition/Putrefaction

After the death of a person, on account of the natural flora within the body, the
body’s own enzymes, and the presence of external microorganisms, the body starts
undergoing decomposition (Shedge et al. 2020). The action of the body’s own
enzymes is known as autolysis, while the rest is known as putrefaction. The different
microorganisms act in a different manner, and the chief perpetrator amongst all the
microbes is Clostridium perfrigens (previously known as Clostridium welchii)
which causes putrefaction by secreting an enzyme known as lecithinase. Lecithinase
causes haemolysis of the blood within the blood vessels and tissues.
The action of different microbes leads to the production of different putrefactive
gases such as hydrogen sulphide, carbon dioxide, ammonia, and methane. The first
external sign of putrefaction is the greenish discolouration of the right iliac fossa
(Fig. 3.3). The greenish discolouration is due to the conversion of haemoglobin into
sulphmethaemoglobin because of the action of hydrogen sulphide. Since the
microorganisms use blood vessels as means of traversing throughout the body, the
superficial vessels of the arms, thorax, and abdomen develop a deep green colour.
These coloured vessels give an appearance similar to veins present over marble tiles,
and hence the phenomenon is known as marbling (Fig. 3.4).
As the gases keep on developing in the body, they start accumulating in
the different cavities of the body. The accumulation of gases causes bloating of
the cadaver (Fig. 3.5). The gases lead to other findings such as distension of the
abdomen, protrusion of eyes, lips, and tongue, swelling of face and external genita-
lia, and purging of putrefactive liquids from natural orifices of the body. The skin of
the cadaver may slip, and there may be a formation of putrefactive bullae on the

Fig. 3.3 Greenish

discolouration of the right
iliac fossa (Mesri M,
Behzadnia M, Dorooshi
G. Accelerated rigor mortis: A
case letter. J Res Med Sci
2017; 22:126)
34 A. Atreya et al.

Fig. 3.4 Marbling (Mesri M,

Behzadnia M, Dorooshi
G. Accelerated rigor mortis: A
case letter. J Res Med Sci
2017; 22:126)

Fig. 3.5 Bloating (Mesri M,

Behzadnia M, Dorooshi
G. Accelerated rigor mortis: A
case letter. J Res Med Sci
2017; 22:126)

cadaver (Fig. 3.6). Eventually, there is liquefaction of most of the organs, and the
abdomen may rupture due to the continued gaseous pressure. During the post-
mortem examination, the sign and degree of decomposition are to be examined.

3.8.8 Miscellaneous

Furthermore, the oral cavity is to be examined for any injuries (laceration of the
frenulum, denture, tongue bite, and gagging). Nails are to be examined for disease
and any peculiarity notes (break and heaping of tissue in nail bed). The nails in a
suspected case of homicide are clipped and the contents of the nail bed are scrapped
off with a toothpick and collected for further examination. In case of suspected
firearm injury, a dermal nitrate test is done for the presence of gunshot residue.
3 Investigation of the Dead Body 35

Fig. 3.6 Putrefactive blisters

on the cadaver (Mesri M,
Behzadnia M, Dorooshi
G. Accelerated rigor mortis: A
case letter. J Res Med Sci
2017; 22:126)

3.9 Internal Examination

After the external examination is complete, an internal examination is done which

consists of a surgical opening of the body cavity, taking out the contents, and
dissecting them for examination. Internal examination commences following the
skin incision.

Types of Skin Incision

• Coronal incision (skull)
• I-incision (trunk)
• Y-incision (trunk)
• Modified Y incision (trunk)
• Fourth incision (trunk)
• Fifth incision (trunk and back) (Kapila et al. 2018)
• X-incision (back)

Following the skin incision, the body cavity is reached. In the head after reflection
of the skin, the skull bone is sawed in order to facilitate the examination of the brain.
For this purpose, an electric saw is used. In the absence of an electric saw,
councilman’s saw can also be used. Similarly, in the trunk the ribs are cut at the
costochondral junction to remove the sternum so as to facilitate the examination of
thoracic contents. There are various ways of removal of the thoraco-abdominal
contents at autopsy. Once the organs are removed, they are individually studied
with further dissection. All the organs are washed (except for the lungs which should
not be washed before dissection), weighed, and dissected to facilitate the gross
pathology or changes. The body cavity is then examined for any significant findings
including injuries or pathology. The ribs are examined for any fractures.
36 A. Atreya et al.

Techniques of Organ Retrieval at Autopsy

• Technique of Ghon
• Technique of Letulle
• Technique of Virchow
• Technique of Rokitansky

Once all the organs are dissected and the changes noted, all the organs are put
back into the body. Only those organs or tissues which show gross changes and are
required for further examination (e.g. histopathology) are retrieved. Such retrieval of
organs or tissue is always documented. The retrieved tissue is kept in formalin
solution, sealed, labelled, and sent to the forensic science lab, maintaining the
chain of custody. Once the internal examination is complete, the skin is sutured,
following which the body is washed, cleaned, and wrapped. Gross deformity or
mutilation of the body if present should be cosmetically restored in the best possible
way during the suturing. The body should be handed over to the representative of the
legal authority who requested the autopsy.
There are instances when a weapon or foreign body may be found lodged inside
the body. Sometimes the police to bring a weapon of offence along with the body to
the mortuary for examination. In such cases the forensic pathologist should further
examine such objects and describe them and document with photographic evidence.

3.10 Ancillary (Special) Procedures

The forensic pathologist then takes the help of ancillary methods to determine the
cause of death. These special procedures are conducted either to find out the definite
cause of death or for the identification of the unknown deceased. These procedures
are either conducted in the mortuary itself in the presence of the forensic specialist or
the body fluid sample, tissue sample, or trace evidence is subjected to laboratory
testing. Some examples of ancillary procedures are

1. Serology (blood testing) (Baleriola et al. 2012).

2. Histopathological (microscopic) examination (Knight and Saukko 2016).
3. Cytochemistry (Bohnert et al. 2019).
4. Radiological investigation: In case of foreign bodies and cases of firearm-related
deaths, a radiological examination of the dead body is conducted. In case of
unknown bodies, radiological assessment can be done to assess the fusion of
epiphysis of the long bones.
5. Analytical toxicology: In suspected cases of poisoning or substance abuse, the
quantitative and qualitative toxicological assay is conducted to identify the
poison and the amount present in the blood.
6. Opening of back during autopsy in case of torture.
3 Investigation of the Dead Body 37

7. Opening of the vertebral column and examination of the spinal cord in case of
suspected spinal injury.
8. Dissection of the epiphysis of a long bone to see the secondary ossification
centre in case of fatal autopsy.
9. Microbiology culture.
10. Bite mark analysis.

3.11 Documentation and Furnishing Report

Proper documentation is an integral part of medicolegal investigation. Although

slight variation can be seen in various autopsy reports, however, all the autopsy
reports should include proper external and internal examination. Each and every
autopsy is given a unique identification number which is integral for documentation
and office records. An assistant should be present at the autopsy who will note all the
external and internal findings during the autopsy. The forensic pathologist dictates
the findings during the autopsy procedure where all the details are noted down. Body
charts and diagrams are popularly used for the documentation of injuries.
Following are the integral sections of all autopsy reports

1. Unique identification number (autopsy number)

2. Authority requesting autopsy with letter reference number
3. Representative of the authority who identified and handed over the body for
autopsy
4. Particulars of the deceased
5. Date and time of conduction of the autopsy
6. Date and time of completion of the autopsy
7. External examination findings including description of injuries
8. Internal examination findings
9. Conclusive opinion regarding cause and manner of death
10. Authorized signature and seal of pathologist conducting autopsy with names of
mortuary technicians and assistants

After the completion of the autopsy, the reports are to be typed, printed, and
copies of the signed reports are to be made for official records. The original is then
released to the legal authority requesting the autopsy. In case ancillary procedures
are done and the test results are awaited, the opinion pertaining to the cause of death
is kept pending. Once all the reports arrive the opinion is updated, and the cause of
death is then mentioned. In case of negative autopsy, after receipt of all the reports,
the pathologist should state the opinion as negative autopsy rather than wrongly
stating the cause of death.
The opinion of the autopsy report should include the following information:

• Identification of the deceased if not identified

• Cause of death
38 A. Atreya et al.

• Mechanism of death
• Manner of death (circumstance of death)
• Time since death

3.12 Identification

All the identifying features noted in the external examination would help in the
identification of the deceased. Peculiar features like mole, scar, and tattoo would
help to positively identify the person. Missing person record or complaint from
police can be matched with the features present in the body which would also help in
positive identification. Fingerprints obtained during the autopsy should be studied
and matched with the database. Samples of DNA can also be obtained and analysed
which would help to establish the identity of the person. In countries where there is a
DNA database of the population, identification would not be difficult, however, in
low- and middle-income countries that do not have a database, the DNA should be
individually matched with the first-degree relative of the suspected missing person.

3.13 Cause and Mechanism of Death

No autopsy report is complete if the cause of death is not mentioned in the opinion
section. Any disease or event (injury) which initiated an uninterrupted sequence of
events that ultimately led to the death of the person is known as the cause of death.
Any underlying physical, biochemical, or anatomical derangements that caused
death are known as mechanisms of death.
Example: A 34-year-old male consumed over-the-counter NSAID for his long
ongoing knee pain. He developed a duodenal ulcer which got perforated. He then
developed peritonitis from the perforated duodenal ulcer and died. Here the cause of
death is a duodenal ulcer, whereas the mechanism of death is peritonitis from a
perforated duodenal ulcer.
If multiple causes of death are found in the same person, for example in a case of
complex suicide, then all the causes of death are to be mentioned followed by the
mechanism of death. Only mentioning the mechanism of death without the cause is
not acceptable. For example, cardiac tamponade is the mechanism of death and
cannot be written as a cause of death. There are various aetiologies for cardiac
tamponade which could be trauma, myocardial infarction, or cardiovascular surgery.
If post-myocardial infarction was a cause of tamponade, then the proper opinion to
cause of death should be cardiac tamponade due to myocardial infarction.
If a lesion is found in any organ or tissue (example: caseous necrosis), then the
sample should be sent for histopathological examination. The opinion in such cases
should be made only after the confirmation of the lesion.
3 Investigation of the Dead Body 39

3.14 Time Since Death/Post Mortem Interval (PMI)

The interval between death and the conduction of post-mortem examination is the
time since death and is also referred to post-mortem interval (Usumoto et al. 2019).
Estimation of post-mortem interval is important in homicidal cases to narrow down
the investigation period and which would further aid in narrowing down the
suspects. There are various ways of estimating post-mortem interval.

• Physical method
– Rigor mortis
If the body is warm, and there is no appreciable stiffness, the PMI is said to
be within a few hours.
If the march of rigor is visible, but not complete (arms and legs show
stiffening, but fingers and toes are still malleable), the PMI is said to be
less than 12 h.
If the rigor is completely developed, the PMI is said to be more than 24 h.
– Algor mortis
The rectal temperature of the cadaver is recorded.
PMI can be estimated using the following formula:
ð37 ° CÞ - Rectal temperature of the victim
PMI = Normal body temperature
Rate of fall of temperature per hour
The rate of fall of temperature per hour depends upon the geographical area,
weather conditions, seasonal variations, etc. and is measured by record-
ing the rectal temperature at regular intervals.
– Livor mortis
The dependent areas stained with reddish-blue colour are identified.
If upon pressing that area, there is no whitish discolouration present,
lividity is said to be fixed, and the PMI is said to be more than 6–8 h.
If upon pressing, there is a whitish discolouration present (blanching), the
PMI is said to be less than 8 h.
If the lividity is present in terms of large patches which have not coalesced,
the PMI is said to be less than 6 h.
If only tiny patches over the dependent area portray the presence of post-
mortem lividity, the PMI is said to be within 1–3 h.
– Eye changes
After death, the cornea starts getting hazy and the extent of haziness is
directly proportional to PMI.
The eyes also lose corneal and pupillary reflexes, there is a loss of intraoc-
ular tension, and the eyes become flaccid.
If the eyelids are open after death, the dust gets deposited in the exposed
areas, and there is a formation of the yellow triangular region that
eventually becomes darker with time. This phenomenon is known as
‘Tache noir de la sclerotique’ (Fig. 3.7)
– Gastric emptying time
40 A. Atreya et al.

Fig. 3.7 Tache noir de la

sclerotique

Under ordinary circumstances, it takes about 60–90 min for the stomach to
become empty after ingestion of food. The amount of food in the
stomach and its extent of digestion can comment upon PMI.
• Chemical method
– Post-mortem cytochemistry
Post-mortem cytochemistry deals with the study of the concentration/
amount of different chemicals within the body and their relation to
post-mortem interval.
Body chemicals such as hypoxanthine, ammonia, NADH, and formic acid
increase linearly after death and can thus be used to estimate PMI.
Another biological fluid with great application in the estimation of PMI is
the vitreous humour. After death, there is a steady increase in potassium
levels within the vitreous humour.
• Biological method
– Entomology of the cadaver
As a cadaver starts undergoing putrefactive changes, certain foul-smelling
gases are generated, that attract a hoard of different insects to the
cadaver.
Depending upon which insects are present over the body, as well as what
stage of their life cycle these insects are in, PMI can be estimated.
3 Investigation of the Dead Body 41

Multiple Choice Questions

1. Which of the following is the first external sign of decomposition?

(a) Formation of putrefactive blisters
(b) Bloating
(c) Greenish discolouration of the right iliac fossa
(d) Protrusion of tongue
Answer: (c)
2. What is the gradual drop in the temperature of an individual after death called?
(a) Algor mortis
(b) Livor mortis
(c) Rigor mortis
(d) Tache noir
Answer: (a)
3. Post mortem staining or hypostasis is also known as?
(a) Algor mortis
(b) Livor mortis
(c) Rigor mortis
(d) Tache noir
Answer: (b)
4. A post mortem report in which no cause of death can be provided, even after
complete autopsy and ancillary procedures are done is known as __________
(a) Clinical autopsy
(b) Medical autopsy
(c) Obscure autopsy
(d) Negative autopsy
Answer: (d)
5. Which of the following is considered to be a biological method of estimating PMI
(a) Livor mortis
(b) Rigor mortis
(c) Cytochemistry
(d) Entomology
Answer: (d)

References
Advenier A-S, Guillard N, Alvarez J-C et al (2016) Undetermined manner of death: an autopsy
series. J Forensic Sci 61(suppl 1):S154–S158. https://doi.org/10.1111/1556-4029.12924
Baleriola C, Johal H, Robertson P et al (2012) Infectious disease screening of blood specimens
collected post-mortem provides comparable results to pre-mortem specimens. Cell Tissue Bank
13:251–258. https://doi.org/10.1007/s10561-011-9252-6
Bohnert S, Ondruschka B, Bohnert M et al (2019) Post-mortem cerebrospinal fluid diagnostics:
cytology and immunocytochemistry method suitable for routine use to interpret pathological
processes in the central nervous system. Int J Legal Med 133:1141–1146. https://doi.org/10.
1007/s00414-019-02050-z
42 A. Atreya et al.

Cohle SD, Sampson BA (2001) The negative autopsy: sudden cardiac death or other? Cardiovasc
Pathol 10:219–222. https://doi.org/10.1016/s1054-8807(01)00093-x
Cordner SM (1993) Deciding the cause of death after necropsy. Lancet 341:1458–1460. https://doi.
org/10.1016/0140-6736(93)90892-k
De Matteis A, Del Fante Z, Santoro P (2020) Forensic pathology: past, present and future. Clin Ter
171:e302–e303. https://doi.org/10.7417/CT.2020.2232
Kapila P, Gupta R, Raina SK et al (2018) Development of a new skin incision for conduct of
conventional autopsy. Egypt J Forensic Sci 8:54. https://doi.org/10.1186/s41935-018-0084-4
Knight B (1980) The obscure autopsy. Forensic Sci Int 16:237–240. https://doi.org/10.1016/0379-
0738(80)90208-x
Knight B, Saukko PJ (2016) Knight’s forensic pathology, 4th edn. CRC Press, Taylor & Francis,
Boca Raton
Menezes RG, Monteiro FN (2022) Forensic autopsy. In: StatPearls. StatPearls Publishing, Treasure
Island
Shedge R, Krishan K, Warrier V, Kanchan T (2020) Postmortem changes. In: StatPearls. StatPearls
Publishing, Treasure Island
Usumoto Y, Kudo K, Tsuji A et al (2019) Predictive equation for post-mortem interval using
spectrophotometric values of post-mortem lividity: a pilot study. Forensic Sci Int 297:47–55.
https://doi.org/10.1016/j.forsciint.2019.01.014
Bloodstain Pattern Analysis
4
Aditi Mishra, Ragini Pandey, and Sarthak Misra

Abstract

Bloodstain pattern analysis plays a crucial role in determining the actions that
have caused bloodshed. By combining the principle of math and physics, the
bloodstain pattern could be interpreted. The detailed analysis of bloodstain shows
different forces and activities influence the creation and appearance of these
patterns so that they can be interpreted as part of the crime scene investigation.
In this chapter, detailed information regarding the causes, types, factors, docu-
mentation, etc. has been discussed.

Keywords
Bloodstain evidence · Forensic science · Reconstruction · Passive pattern ·
Transfer pattern · Projected pattern

4.1 Definition of Terms

Bloodstain Deposit of blood on a surface

Bloodstain pattern Distribution of bloodstains in various shapes and sizes resulting from
various factors such as surface, angle, distance, or type of weapon
used
(continued)

A. Mishra
Kristu Jayanti College, Bangalore, India
R. Pandey
Department of Forensic Science, Jain University, Bangalore, India
S. Misra (✉)
Indira Gandhi Institute of Medical Sciences, Patna, India

# The Author(s), under exclusive license to Springer Nature Singapore Pte 43

Ltd. 2024
A. Puri et al. (eds.), Fundamentals of Forensic Biology,
https://doi.org/10.1007/978-981-99-3161-3_4
44 A. Mishra et al.

Bloodstain Deposit of blood on a surface

Bloodstain pattern Distribution of bloodstains in various shapes and sizes resulting from
various factors such as surface, angle, distance, or type of weapon
used
Bloodstain pattern Bloodstain pattern analysis is the technique used in forensic science to
analysis (BPA) recreate the actions that caused the bloodshed
Passive bloodstain Passive bloodstains patterns, such as drops, flows, and pools, are
created by the force of gravity alone
Blood pool A blood pool pattern is generally defined as an accumulation of blood
found at the lowest point of flow patterns
Transfer stain When any bloody object comes into contact with an unstained surface
leaving a pattern known as transfer/contact stains
Projected patterns Projected patterns are blood spatter, which is caused by a force other
than impact
Splash patterns A bloodstain pattern formed by a huge amount of liquid blood falling
onto a surface
Splatter stain A splatter stain is the result of blood being pressed against a liquid
blood source
Expirated bloodstain Expirated bloodstain patterns are generated by the blood that is
evacuated through the mouth or nose as a result of an internal injury
Cast-off spatter Cast-off spatter happens when blood is hurled from a blood-bearing
object such as a hammer or knife
Void pattern A void pattern is the absence of bloodstains in otherwise continuous
staining patterns

4.2 Introduction

Bloodstain pattern analysis (BPA) is a technique used in forensic science to recon-

struct the events that resulted in the bloodshed. In other words, it helps in the
reconstruction of the crime by interpreting the bloodstains present at the scene of a
crime. To form an opinion about the happenings of the crime scene, a forensic expert
examines the size, distribution, shape, and location of the bloodstains. This tech-
nique is mostly used in the reconstruction of homicide cases such as murder or any
other violent crimes where the presence of blood can be seen. Blood pattern analysis
goes beyond mere speculation and instead utilizes evidence, reasoning skills, and
expertise to determine what may have or not happened during a crime.
This technique is employed worldwide by forensic scientists, police officials, and
medicos in an interdisciplinary manner. It is very common for the individual to be
injured in case of any violent crimes and leave blood or bloodstain as evidence. This
might leave some distinctive patterns and help in interpreting important investigative
events that have happened during the commission of the crime. Bloodstain patterns
occur because blood has biological (blood behavior), physical (cohesion, capillary
action, and velocity), and mathematical (geometry, distance, and angle) property
which reacts when acted upon by physical forces (Ablett 1983).
4 Bloodstain Pattern Analysis 45

When liquids in flight are depicted in general, they are frequently depicted as
having a teardrop shape. However, this is very different from reality. When a liquid
falls from an object, it takes the shape of a drop. Once in the air, the drop takes on its
smallest surface area and flies in a spherical shape. The flowing of blood patterns is
affected by many physical forces such as air resistance and gravity. Although this
form of stain is well known, there are other ways in which gravity affects blood like
in a pool of blood. The effect of gravity would let down the sinking of blood cells
and separate the serum above as a clear transparent liquid (Allen 1995). This process
would create serious misunderstandings or doubts among the individual who is
unfamiliar with this concept and may believe that liquid has been introduced to the
blood. However, in actuality, this is a natural blood pool in which the blood was
standing. This is where expert opinion would play a crucial role (Allery et al. 2001).
Another issue is that diverse sources can sometimes result in stains that seem the
same. As a result, to make an appropriate assessment, a full understanding of physics
and bloodstain pattern analysis, as well as differential diagnoses, is required. It is
also worth noting that scenarios can emerge where onlookers are more bloodied than
the perpetrator. This can happen when a weapon is flung overhead in front of a group
of people, for example. Although such occurrences are uncommon, they are a
compelling cause to visit a bloodstain pattern analysis professional. As a result,
the bloodstain pattern aids investigators in addressing questions like:
• What was the source of the blood?
• What happened to cause the wounds?
• In what direction did the victim get hit?
• What was the position of the victim(s) and perpetrator(s)?
• What steps were taken following the bloodshed?
• How many criminals were involved there?
• Does the bloodstain evidence approve or disprove the witness’s testimony?

Forensic serologist identify and study the bloodstain patterns with established
scientific techniques and draw scientific conclusions about how the blood was shed.
The analysis of these patterns gives some detailed information regarding the direc-
tion of travel of the blood, the location of the blood source which was acted upon to
create the pattern, the level of force of injury, any movements during or after the
bloodshed, and other activities. The detailed analysis of bloodstain shows how
different forces and activities influence in creation and appearance of these patterns
so that they can be interpreted as part of the crime scene investigation (Anoruo et al.
2007).
BPA gives information on not just what happened, but also what could have
happened. This could help the investigator in the reconstruction of the crime,
corroborating witness testimony, and including or excluding probable culprits
from the investigation (Baxter 1973). In many of the world’s most notorious criminal
cases, bloodstain evidence has been a deciding factor. As a result, for individuals on
both sides of the courtroom, substantiation of this evidence is much more critical.
46 A. Mishra et al.

4.3 Historical Perspective of BPA

Bloodstain pattern analysis has been frequently used in the investigation of homicide
cases or any other violent crimes. The roots of bloodstain pattern analysis can be
traced back more than 100 years. Some literature on bloodshed characteristics has
been found by Herbert Leon MacDonnell which dated back to the 1500s.
However, the first person to scientifically investigate bloodstain patterns was
Dr. Eduard Piotrowski. In 1895, an article was published that examined bloodstain
patterns resulting from head wounds. Following Piotrowski’s discovery, other
articles were published that shed light on certain elements of bloodstains but did
not lead to a systematic examination. Balthazard and colleagues (1939) published
findings of reconstructing the angle of impact from the impact pattern by measuring
the width and length of small bloodstains.
Another research conducted by Schmidtmann showed the possibilities of blood-
stain patterns in the reconstruction of the crime scene. The beginning of the blood-
stain pattern in the forensics as crucial evidence was marked in the homicide case of
the State of Ohio v. Samuel Sheppard (1955). Dr. Sheppard was charged guilty in the
death of his wife Marilyn Sheppard and later got convicted. Dr. Kirk examined the
bloodstain patterns present on the walls of Marilyn Sheppard’s bedroom and testified
as an expert in the courtroom. Dr. Sheppard was acquitted and this shed some light
on bloodstain pattern analysis for forensic purposes. Herbert Leon Macdonell’s in
1971 published the book “Flight Characteristics of Human Blood and Stain
Patterns.”
Later in 1972, one training program was also conducted on bloodstain patterns by
Macdonell. Many institutes have participated in this training program which gave
more popularity to this technique. With more popularity, several kinds of research
have been conducted and got published in reputed journals. Various professional
forensic associations have been created such as “The International Association of
Bloodstain Pattern Analysts (IABPA).” Several conferences and certification
programs have been conducted with worldwide participants.
One Scientific working group for bloodstain pattern analysis (SWGStain) was
also hosted by the Federal Bureau of Investigation. This group published
recommendations for training bloodstain pattern analysts, recommendations for the
content of a basic bloodstain pattern analysis workshop, guidelines for developing
standard operating procedures, quality assurance guidelines, and a recommended
terminology for bloodstain pattern analysis. Recently, software-based programs
have been also made for bloodstain pattern analysis but they are not used frequently.
They still lack advancement and more work has to be done on software-based
programs for interpreting the bloodstain pattern evidence (Blake and Sensabaugh
1976).
4 Bloodstain Pattern Analysis 47

4.4 Characteristics of Bloodstain

Some several factors and characteristics influence the size and shape of the
bloodstains. Blood is a complex composition of blood cells and plasma. Four
types of blood cells are found in humans such as red blood cells, white blood
cells, platelets, and plasma (Boward and Wilson 2013). These cells of the blood
are suspended in a liquid. Red blood cells are the main component of the solid
portion of blood. RBC does not have the genetic material—deoxyribonucleic acid
(DNA). The other solid portion is the white blood cells, which contain DNA.
Since it contains genetic material, it is very crucial for forensic analysis. Blood
also has clotting factors present in the plasma, which is the liquid portion. The liquid
that remains after the blood has clotted is called serum. Like other liquids, blood has
no shape of its own and hence adjusts according to its surrounding. The physical
characteristics of the blood such as specific weight, viscosity, and surface tension are
very crucial in the interpretation of its morphological characteristics (Boward and
Wilson 2013). Blood also has some biological, serological, and immunological
characteristics but has minor importance in bloodstain pattern analysis (Chapman
et al. 1989). Hence, it will not be discussed in this chapter.
When blood passively strikes off a surface and falls onto a smooth hard horizontal
surface, we have a very even round pattern. As the blood that hit, is put in motion,
those blood droplets form oscillating sphere shapes. If blood droplets are fallen due
to gravitational force alone, then droplets would be intact and not broken. However,
any other external forces to the mass of blood would result in smaller droplets.
Factors other than droplet volume, drop distance, and the blood source surface
properties also affect the size, shape, and pattern of the bloodstains (Chen and Hortin
2000).
Higher effective energy would destroy surface tension and this would result in
smaller droplets. The diameter of the bloodstains is generally dependent upon two
things, one is the distance from which the droplet is falling to the surface and the
other is the volume. Distance and volume are both directly proportional to the
bloodstain. More the distance of the fall, more the diameter of the bloodstain.
However, once it reaches the maximum height, i.e., more than 2.5 m (7 ft.), a very
slight change would be seen in bloodstain diameter (Allery et al. 2001). The larger
the volume of bloodstain, the more likely to be the diameter. The average volume of
blood droplets is known to be 0.05 ml (Allen 1995). Further studies have shown that
the average amount of passively dripping droplets depends on the surface properties
of the object on which the blood drips. The falling of blood droplets from a surface is
due to increasing its volume to a level where the earth’s gravity dominates the
viscosity, thus resulting in poor surface tension, causing blood droplets to fall from
the surface.
The physical properties such as viscosity, specific density, and surface tension of
blood make it difficult to break down into droplets. When an external force is applied
to the static blood pool, some of the blood reacts and is thrown into the air. The
distance a droplet travels in the air depends on the amount of force used to create the
droplet, the size of the blood droplet, and the air resistance. If the exerted force is low
48 A. Mishra et al.

then this would create a lesser number of blood droplets and also their size of them
would be larger. Most droplets are over 3 mm in diameter, but very few are less than
3 mm in diameter. As the level of force decreases, the distance travelled by these
droplets would be short. If the exerted force is high then this would create a greater
number of blood droplets. As the level of force increases, the distance travelled by
these droplets would be increased. The more the force, the less the volume and
diameter of the individual droplets, and many blood droplets are 1 mm in diameter.
Large droplets are still present, but these droplets tend to move farther from the
blood source than smaller droplets having a size of 1–2 mm in diameter.
Small blood droplets lack the physical weight to resist airflow and friction, so
they travel a shorter distance from the blood source and dissipate energy quickly.
Most small droplets travel within 1 m (39 in.) of the blood source. In case of
extremely high force such as gunshot spatter, thousands of blood droplets less than
1 mm in diameter are generated and propelled into the air. The larger the distance
from the blood source, the larger the droplet size, but these droplets are smaller
(2–3 mm) compared to the larger droplets produced by the low-force blood spatters.
Many of the larger droplets produced by these high-force events are the result of
smaller droplets that collide during flight and coalesce into larger volumes of blood
droplets. The shape of the bloodstain could be known by the angle between the
trajectory of the droplet and its surface.
When a drop of blood hits the horizontal plane from a vertical angle, the resulting
blood stains are rounded. Lesser the angle between the blood droplet’s flight path
and the target surface, the more the length and less the width of bloodstains. We
could also say, as the size of the angle decreases, the bloodstains become longer and
narrower. Bloodstain coming from different angles looks different. Suppose a blood
droplet has hit the target surface from a 15-degree angle, then the shape of this
bloodstain would be long and the width would be narrower. The presence of a tail
could be observed on these long narrow stains. When a blood droplet hits the target
surface, the body of the droplet attaches to the surface. A small portion of a drop of
blood breaks at the top and continues in the forward direction and gives the shape of
a tail. In other words, the primary spatter sticks to the surface and the secondary
spatter would appear like a tail (Fig. 4.1).
The tail is an important tool in reconstructing the bloodstain pattern. The tail
points in the direction the droplet was moving when it hit the surface of the target.
After an initial crime scene when photography and documentation have been
completed, the crime scene investigator places a reference scale near the blood
spatter and selects the individual stain for analysis. The investigator draws a line
extending along a path or length axis of each select stain. The area where this line
intersects is called the area of convergence which indicates the approximate height of
the incident that produce bloodshed.
The examiner uses a loop to measure the length and width of each stain and then
calculated the angle at which the droplet impacted the surface. The length and width
of the specific bloodstain could be used to calculate the angle of impact (Fig. 4.2).
The most frequently used formula for this calculation: Angle of impact = arc sin w/l.
Once the investigator knows the area of convergence and impact angle for a group of
4 Bloodstain Pattern Analysis 49

Fig. 4.1 Shape of bloodstain

projected from different
angles

Fig. 4.2 Schematic representation of angle of impact

stains, the string process begins. The investigator attaches one end of the string to
each stain’s location at the point where the blood drop contacts the surface. Then,
using your protractor hold the strings along the angle of impact and secure them to
something stable. Once several strings are emplaced, the area of origin becomes
visible. This complex time-consuming processing creates the 3-dimensional model
that indicates where the victim was located at the time of the event.
The shape of the bloodstain and its width-to-length ratio are also dependent upon
the type of surface on which blood strikes. The reconstruction and interpretation of
the crime scene would be easier if the blood strikes a smooth, hard, nonporous
surface. If the surface has properties that distort the shape of the bloodstain, then
reconstruction and interpretation get difficult. The appearance, size, and shape of the
bloodstains are also dependent upon the type of surfaces such as absorbent or
non-absorbent. In the case of an absorbent surface, the blood gets soaked inside
and thus resulting in altered width-to-length ratios.
These alterations may result in an inaccurate angle of impact determination; this
information could prevent an accurate pattern reconstruction for locating the pattern
blood source. In case of a rough surface, the blood droplet would break apart. This
would lead to an inaccurate angle of impact.
50 A. Mishra et al.

Bloodstains found at the scene of crime have various shapes and pattern that helps
in identifying the nature of the wound from which the blood originated. Every
bloodstain has its unique geometrical properties that are very crucial in
differentiating these bloodstain patterns. To maintain an objective overview, blood-
stain patterns need to be described in a specific and unique way. This allows experts
to understand the mechanism behind blood stain patterns while reading bloodstain
patterns analysis reports. A standardized scientific approach to the interpretation of
bloodstain patterns was defined by the “Working Group on Bloodstain Pattern
Analysis” (SWGSTAIN) (Davies and Wilson 1974), which mainly complies with
the terminology used by the German “Arbeitsgruppe für Blutspuren–
Verteilungsanalyse.” The three broad categories of bloodstain patterns are explained
in Fig. 4.3.

4.4.1 Passive Drop

Passive bloodstains patterns, such as drops, flows, and pools, are created by the force
of gravity alone. Such patterns can be found as a direct result of passive flow patterns
on uneven surfaces (carpets, tar, etc.) with fairly high resistance (Fig. 4.4). This tread
provides information about the process of movement. Drip stains are drops that fall
undisturbed in the air. It physically maintains its spherical shape without breaking
into small droplets.
Such a blood drop may descend from an exposed wound or any object containing
a sufficient amount of blood to permit the formation of a drop. Flow pattern describes
a change in the shape and direction of a bloodstain due to gravity and the angle of the
surface on which it is formed. Flow patterns and pools could provide a piece of
important information regarding the victim’s movements during the attack as well as
post-mortem movement or alteration of the body at the scene of death. These
patterns can be found, for example, on the victim’s body and clothing, and on the
surface on which the victim lies. The type of surface and bloodstain angle are very
crucial in interpreting the static findings. For example, the interruption of a flow
pattern can aid in determining the sequence and duration of time between the flow
and the interruption. If the direction of gravity does not match the flow of the blood
on an object or body, it is conceivable that the object or body was relocated after the
blood had dried.
A blood pool pattern is generally defined as an accumulation of blood found at the
lowest point of flow patterns. Blood that pools on absorbent surfaces may be
absorbed and diffused over the surface, resulting in a pattern that is larger than the
initial pool. This is common in pools and on mattresses and sofas.
When any bloody object comes into contact with an unstained surface they leave
a pattern known as transfer/contact stains. These are the result of compression or
lateral movement. Examples include tool prints, bleeding fingerprints, footprints,
palm prints, and other transfer patterns. Blood transfer patterns can be used to
determine class or individual characteristics. These patterns aid in identifying the
4 Bloodstain Pattern Analysis 51

Bloodstain pattern

Passive drop Transfer/contact

Projected bloodstain pattern

Drip stain arterial spurting

pattern Contact pattern

Flow stain
Cast-off pattern Wipe pattern

Blood clot
Spatter pattern Insect stain

Blood pool
Expiration pattern

Serum stain
Splash pattern

Spine pattern

Void pattern

Perimeter stain

Fig. 4.3 Different types of bloodstain patter

victim’s perpetrators or any other individuals present at the crime scene’s

directionality.
Blood has a strong adhesive force and due to this stain gets transferred from one
surface to another. Due to its transferrable nature, the identification of the origin of
the pattern might be unobtrusive. Contact patterns can give a good idea of the shape
and size of the object in question (such as hard objects, fingerprints, hair, body parts,
or soles). Depending on the condition of the sole (of the shoe), the ground, and the
strength of the steps (slow, careful walking and high speed, intensive running), these
contact patterns can also be seen at considerable distances (30–60 m) from the crime
scene (Fig. 4.5).
52 A. Mishra et al.

Fig. 4.4 Different types of passive bloodstain pattern

Fig. 4.5 Different types of transfer bloodstain pattern

In addition, you can distinguish between primary and secondary wipe patterns.
The primary wipe pattern occurs when a bloody object moves tangentially over the
surface and leaves a trail (called a wipe pattern). A secondary wipe pattern occurs
when a clean, uncontaminated surface or object is tangentially dragged over an
existing bloodstain (called a wipe pattern). Wipe patterns help in determining the
chronological order of various incidents.

4.4.2 Projected Patterns

Projected patterns are blood spatter, which is caused by a force other than impact
(Fig. 4.6). In arterial spray spatter, blood is projected from an arterial blood vessel in
variable volumes when the artery is breached. Blood spurts out of the damaged area
due to the pressure of continuous blood pumping. Arterial blood stain’s size ranges
4 Bloodstain Pattern Analysis 53

Fig. 4.6 Different types of projected bloodstain pattern

from massive gushing or spurting patterns each time the heart pumps to extremely
little spray patterns. These patterns are easily distinguishable as the oxygenated
blood spurting from an artery is bright red color than blood ejected from impact
wounds.
A bloodstain pattern formed by a huge amount of liquid blood falling onto a
surface. These patterns usually have a large central area with elongated peripheral
bloodstains. They usually mean a cohesive impression, slightly separated into
smaller lace patterns.
A splatter stain is the result of blood being pressed against a liquid blood source.
You can distinguish between forward spatter caused by force directional movement
and backward spatter caused by opposite directional movement. The effect in this
context is any type of blunt trauma that is strong enough to break a homogeneous
pattern by overcoming surface tension.
Expirated bloodstain patterns are generated by the blood that is evacuated through
the mouth or nose as a result of an internal injury. As a result of being diluted by
saliva, expirated blood may look lighter in color than impact spatters. The stains may
contain visible air bubbles created by blood combining with air from the respiratory
tracts or lungs if the blood was recently evacuated. There are many reasons for
expirated blood such as injuries in skull, neck, or lung bleeding injury.
Cast-off spatter happens when blood is hurled from a blood-bearing object such
as a hammer or knife. The size of the spatter is proportional to the size of the object’s
point; for example, the spatter formed by a bat will be greater than the spatter created
by a sharp knife. The number of blows can also be calculated using the number of
cast-offs spattered. The size of cast-off patterns is commonly smaller (6–7 mm) than
passive drop patterns.
54 A. Mishra et al.

Gunshot spatter can cause mist-like dispersions (typical of high-velocity spatter),

which are little blood spatters less than 0.1 mm in diameter. It can also create forward
and backwards spatter from an entrance incision and exit wound as well. The
distance between the firearm and the victim determines the amount of back spatter
on a firearm or a shooter. The size of the spatter is governed by a number of
parameters, including the caliber of the weapon, the amount of available blood,
the position, and the number of bullets and impediments such as hair, clothing, and
so on.
A void pattern is the absence of bloodstains in otherwise continuous staining
patterns. The empty space on the surface or object could reveal information about the
size and shape of the missing thing or person. This aids in establishing a crime
scene’s sequence and identifying changes.

4.5 Bloodstain Pattern Based on Velocity

4.5.1 Low-Velocity Impact Blood Spatter (LVIS)

A force or energy corresponding to normal gravitational pull up to a force or energy

of 5 ft./s is called low-velocity (5 ft./s). The stain that results is frequently rather big,
measuring 4 mm or more in diameter (Fig. 4.7). Low-velocity impact spatter has the
following characteristics:
• the majority of spatters are larger than 3 mm in diameter;
• the formation of long, spiny projections is possible;
• the tail of the splatter frequently points toward the source rather than the direction
of travel.

Fig. 4.7 Low-velocity

impact blood spatter
4 Bloodstain Pattern Analysis 55

4.5.2 Medium-Velocity Impact Blood Spatter (MVIS)

Medium velocity is defined as a force of 5–25 ft./s that is applied to a blood supply.
The stains formed will be in the size range of 1–4 mm (Fig. 4.8). Medium velocity
impact spatter has the following characteristics:
• the majority of spatters are 3 mm in diameter or smaller;
• spatter can travel long distances from its source.

4.5.3 High-Velocity Impact Blood Spatter (HVIS)

These types of bloodstains form when the blood source is exposed to a force greater
than 100 ft./s. The resulting stain is typically less than 1 mm in diameter, though both
smaller and larger stains may be visible (Fig. 4.9). These stains are commonly
caused by gunshot wounds, explosions, and mechanical catastrophes. High-velocity
impact spatter has the following characteristics:
• larger drops can reach greater distances than 3–4 ft.;
• atomized spatters only move 3–4 horizontally from their origin;
• gravity pushed them down fast due to their small size;
• entrance wounds were distributed in a cone-shaped pattern from the impact site in
the direction of the original bullet;
• because blood is carried out with the projectile, exit wounds produce more spatter
than entrance wounds.

Fig. 4.8 Medium-velocity

impact blood spatter
56 A. Mishra et al.

Fig. 4.9 High-velocity

impact blood spatter

4.6 Blood Drying Times

The drying time of the bloodstain pattern is affected by many environmental and
physical factors. Blood volume is the most important physical factor that affects the
time it takes for a stain to dry. When exposed to the same environmental conditions,
large amounts of blood dry more slowly than small amounts of blood. Environmen-
tal factors such as temperature, humidity, surface properties, and airflow affect the
rate at which blood samples dry. Warm temperatures promote drying and speed up
the drying of blood. Cold or very cold usually impedes the drying time of blood.
Humidity also affects the drying time of blood.
When the same amount of liquid blood is deposited in environments with
different humidity levels, blood in a high-humidity environment dries more slowly
than blood in a low-humidity environment. Drying occurs when the moisture in the
dirt evaporates into the surrounding air. In a high-humidity environment, the air is
saturated with water, which suppresses evaporation and prolongs the drying time of
blood. The properties of the surface on which the blood is deposited also affect the
drying time of the blood. If the surface protects the blood by limiting the number of
stains that are exposed to the environment, the blood will be less dry and the drying
time will be longer.
Blood deposits on surfaces that maximize the surface area of stains exposed to the
environment reduce drying time. An environment that provides good airflow to the
exposed surface of the blood reduces the time required for the stain to dry. There are
several factors and characteristics that influence the size and shape of the
bloodstains. Blood is a complex composition of blood cells and plasma. Four
types of blood cells are found in humans such as red blood cells, white blood
cells, platelets, and plasma (Boward and Wilson 2013). These cells of the blood
are suspended in a liquid. Red blood cells are the main component of the solid
portion of blood. RBC does not have the genetic material—deoxyribonucleic acid
(DNA). The other solid portion is the white blood cells, which contain DNA. Since it
4 Bloodstain Pattern Analysis 57

contains genetic material, it is very crucial for forensic analysis. Blood also has
clotting factors present in the plasma which is the liquid portion.

4.7 Bloodstain Pattern Documentation

Documentation plays a very important role in reconstructing the bloodstain pattern

evidence analysis. If the crime scene has not been documented properly, it always
led to some subjective conclusions. The advancement in technology has helped a lot
in forensic analysis. Some of those techniques are highly useful documentation and
reconstruction of the bloodstain pattern evidence. The common technique used in the
documentation of bloodstain pattern analysis is physical evaluation. This technique
requires multiple analysts. Some of the forensic experts would engage in examining
the bloodstained evidence while other experts would take scene notes, photographs,
and sketches of the crime scene. The other technique used by forensic experts is the
computer or digital method. This would evaluate data from the bloodstain patterns
and crime scene and determine the blood source locations. Thorough and complete
notes should accompany documentation and reconstruction of bloodstain pattern
evidence.
The crime scene should be documented properly; it should contain all the
required information and observations. Since the documentation of the crime scene
would help further in reconstruction. Some other reports should be carefully pre-
served such as crime scene reports, police reports, medical examiner reports, and
other forensic evaluations that may have been reviewed before the development of
the analyst’s conclusions. Bloodstain evidence should be photographed and video-
graphed properly. This is one of the most important documents that help in the
reconstruction of the crime scene. Photographs taken from the scene of the crime
should be of high quality. Photos should always include a standardized scale and a
fixed object about the bloodstains documented.
The proper lighting should be maintained, and overview shots, as well as detailed
photographs, should be taken, detailed photographs should easily be recognized
within overview shots, an upright position of the camera about the surface being
photographed, and the use of a 50 mm objective lens, if possible. If required,
additional lighting should be provided for photography. Once the bloodstain area
has been identified, the photograph should be taken with proper measurements and
also keeping some reference points. Every step of the reconstruction should be
photographed. Once this process is complete, blood samples should be taken and
sent to the Institute of Criminology for analysis.
Analysis of blood samples can help in the final interpretation of the pattern by
helping the analyst connect the pattern to the individual involved in the blood spatter
event. Drying time of the bloodstain pattern is affected by many environmental and
physical factors. Blood volume is the most important physical factor that affects the
time it takes for a stain to dry. When exposed to the same environmental conditions,
large amounts of blood dry more slowly than small amounts of blood. Environmen-
tal factors such as temperature, humidity, surface properties, and airflow affect the
58 A. Mishra et al.

rate at which blood samples dry. Warm temperatures promote drying and speed up
the drying of blood. Cold or very cold usually impedes the drying time of blood.
Humidity also affects the drying time of blood.

4.8 Research and Development of BPA/Advancing BPA

Techniques

Blood is, as we all know, one of the most typical types of evidence found at a crime
scene. Under laboratory circumstances, an experiment was undertaken to better
understand bloodstain production by using Awlata dye. Awlata (Alta), an Indian
dye used for women’s grooming, was utilized to make fake bloodstains to better
understand how bloodstains form at different heights and how they relate to spines
and satellite stains. It was discovered that as the height of the fake blood drop
increased, so did the distance of satellite stains originating from the false bloodstains.
Satellite stains were directly proportional to the height of the bloodstain, while
spines were inversely proportional, according to the experimental findings.
Although various countries have developed effective blood substitute products,
they still have issues such as high cost, insufficient validation of physical properties
through experimental comparison with human blood, and difficulties in manufacture
and sale due to the separate capabilities of pattern reproduction and luminol reaction.
Sang Yoon Lee et al. (Di Martino et al. 2004) produced a more practical blood
substitute since the components used in its creation are freely available in the market
and do not contain chemicals that are toxic to the human body.
These blood substitutes also have luminol reaction functionality as well as pattern
transfer bloodstain functionality (bloodstain fingerprint, bloodstain fingerprint) dye-
ing capabilities. The viscosity and viscoelasticity were adjusted with “hyaluronate
acid,” “hemoglobin from bovine blood,” and “potassium ferricyanide,” and the
pattern transfer bloodstain dyeing functionality was adjusted with “amino acid
solution” and “bovine serum albumin.” To make the NFBS, the selected components
were blended in the required composition ratios. Another study conducted by Ravi
Varma attempted to use artificial intelligence algorithms to help analysts analyze
bloodstain patterns. BPA currently uses a manual analysis process, thus having
forensic analysts who can reliably produce dependable results is critical. Human
mistake, on the other hand, is unavoidable, and analyst error can lead to erroneous
findings, jeopardizing casework. The angle of impact from simulated crime scene
samples was estimated using artificial intelligence. As a result, it was discovered that
the artificial intelligence-assisted approach was correct for 78.64% of the data
examined (Engelbertz et al. 2010). Jadhav et al. (Herman et al. 2018) conducted
one study to show that computational intelligence methodologies might be effec-
tively combined with image processing techniques to help forensic investigators
improve their performance in studying bloodstains, both in terms of time and
accuracy of the analysis. Preliminary research using fuzzy clustering was conducted
to corroborate these findings and encourage the computational intelligence
4 Bloodstain Pattern Analysis 59

community to take on this new issue of developing a formal definition of forensic

intelligence.

Multiple Choice Questions

1. A bloodstain pattern is created by the force of gravity acting alone?

(a) Blood clot pattern
(b) Medium velocity spatter
(c) Drip pattern
(d) Passive drop
Answer: (d)
2. What bloodstain pattern occurs when an object moves through an existing stain,
or object tangentially dragged over an existing bloodstain?
(a) Wipe pattern
(b) Spatter pattern
(c) Drip pattern
(d) Splash pattern
Answer: (a)
3. What type of blood spatter is typically created from a gunshot?
(a) Cast-off
(b) Low velocity
(c) High velocity
(d) Drip
Answer: (c)
4. What would be the shape of a blood droplet at an angle of impact of about 90°?
(a) Circular
(b) Spherical
(c) Oval
(d) Tail
Answer: (a)
5. Which weapon would create cast-off patterns consisting of small droplets in a
linear pattern?
(a) Knife
(b) Baseball bat
(c) Wooden plank
(d) None of the above
Answer: (b)

References
Ablett P (1983) The identification of the precise conditions for seminal acid phosphatase (SAP) and
vaginal acid phosphatase (VAP) separation by isoelectric focusing patterns. J Forensic Sci Soc
23:254–256
60 A. Mishra et al.

Allen SM (1995) An enzyme linked immunosorbent assay (ELISA) for detection of seminal fluid
using a monoclonal antibody to prostatic acid phosphatase. J Immunoassay 16(3):297–308
Allery JP, Telmon N, Mieusset R, Blanc A, Rougé D (2001) Cytological detection of spermatozoa:
comparison of three staining methods. J Forensic Sci 46(2):349–351
Anoruo B, van Oorschot R, Mitchell J, Howells D (2007) Isolating cells from non-sperm cellular
mixtures using the PALM microlaser microdissection system. Forensic Sci Int 173(2–3):93–96
Baxter SJ (1973) Immunological identification of human semen. Med Sci Law 13(3):155–165
Blake ET, Sensabaugh GF (1976) Genetic markers in human semen: a review. J Forensic Sci 21(4):
785–796
Boward ES, Wilson SL (2013) A comparison of ABAcard(®) p30 and RSID™-Semen test kits for
forensic semen identification. J Forensic Leg Med 20(8):1126–1130
Chapman RL, Brown NM, Keating SM (1989) The isolation of spermatozoa from sexual assault
swabs using proteinase K. Journal Forensic Sci Soc 29(3):207–212
Chen JT, Hortin GL (2000) Interferences with semen detection by an immunoassay for a seminal
vesicle-specific antigen. J Forensic Sci 45(1):234–235
Davies A, Wilson E (1974) The persistence of seminal constituents in the human vagina. Forensic
Sci 3(1):45–55
Di Martino D, Giuffrè G, Staiti N, Simone A, Le Donne M, Saravo L (2004) Single sperm cell
isolation by laser microdissection. Forensic Sci Int 146(suppl):S151–S153
Engelbertz F, Korda JB, Engelmann U, Rothschild M, Banaschak S (2010) Longevity of
spermatozoa in the post-ejaculatory urine of fertile men. Forensic Sci Int 194(1–3):15–19
Herman Y, Feine I, Gafny R (2018) Acid phosphatase test on Phadebas® sheets - an optimized
method for presumptive saliva and semen detection. Forensic Sci Int 288:218–222
Identification of Blood
5
Shivam Chourasiya, Varsha Rani Patel, Himani Sharma,
Moumita Sinha, and Tilak Ram Chandrakar

Abstract

One of the most important types of biological evidence that can be obtained for
forensic investigation is blood. Because of the probability of a mixture of body
fluids or other types of fluids can be present which resemble blood on items
therefore conclusive human blood analysis is required in many cases, thus this
chapter covers the composition, presumptive, and confirmatory assays for blood
identification found at the crime scene. In order for justice to prevail, forensic
investigators and scientists must be able to obtain accurate and complete results of
the evidence at hand, as well as ensure that the integrity of the evidence has not
been compromised.

Keywords

Blood · Presumptive assays · Confirmatory assays

5.1 Composition of Blood

Blood is a tissue that consists of a cellular component and a non-cellular liquid

component (Fig. 5.1). Blood serves several functions, including transporting differ-
ent materials throughout the body. In addition to carrying oxygen and nutrients to all

S. Chourasiya (✉) · V. R. Patel · H. Sharma · T. R. Chandrakar

Faculty of Science, Department of Forensic Science, Medi-Caps University, Indore, Madhya
Pradesh, India
e-mail: [email protected]; [email protected];
[email protected]; [email protected]
M. Sinha
Department of Forensic Science, Kalinga University, Raipur, Chhattisgarh, India

# The Author(s), under exclusive license to Springer Nature Singapore Pte 61

Ltd. 2024
A. Puri et al. (eds.), Fundamentals of Forensic Biology,
https://doi.org/10.1007/978-981-99-3161-3_5
62 S. Chourasiya et al.

Fig. 5.1 Composition of blood

parts of the body, blood also distributes heat produced by the body’s actively
respirating tissues (such as the liver and the muscles) and removes waste products
from the system (carbon dioxide and urea) (Psionica 2005).

5.1.1 Red Blood Cells

Erythrocytes are another name for these cells. In humans, they have a life span of
about 3–4 months (Li 2015).
Previously, red blood cells (RBCs) were thought to be only oxygen and nutrient
transporters to tissues. In addition to transporting oxygen and nutrients around the
body, recent experiments have shown that RBCs play an important role in regulating
systemic nitric oxide metabolism, redox regulation, blood rheology, and viscosity.
Erythrocytes are made up of hemoglobin, which are proteins that transport oxygen.
A heme molecule is made up of a protoporphyrin IX organic component and a
ferrous (Fe2+) iron ion (Fig. 5.2). A heme molecule is also known as
ferroprotoporphyrin. Heme groups are also found in the blood of various animals
as well as other proteins such as myoglobin in muscles and neuroglobin in the brain,
which serves as the foundation for identifying blood found at a crime scene (Kuhn
et al. 2017).
5 Identification of Blood 63

WBCs
(Leukocytes)

Granulocytes Agranulocytes

Neutrophils Eosinophils Basophils Lymphocytes Monocytes

Fig. 5.2 Composition of WBC

5.1.2 White Blood Cells

White blood cells, also known as leucocytes, can be further categorized into two
major groups: granulocytes, and agranulocytes. Granulocytes are classified as
neutrophils, eosinophils, and basophils. Agranulocytes are further classified as
lymphocytes and monocytes (Fig. 5.2). In the fight against disease and illness,
white blood cells play a key role and because of their nuclei, they are the most
common carriers of nuclear DNA in the circulatory system.

5.1.3 Platelets

Blood platelets, also known as thrombocytes, are tiny, colorless cell fragments that
clump together to form clots and slow or stop bleeding. Platelets are produced in the
bone marrow, which is a sponge-like tissue found within our bones. Red blood cells,
white blood cells, and platelets all originate from stem cells in the bone marrow
(Kuhn et al. 2017) (Fig. 5.3).

5.1.3.1 What Is Serum

The serum is plasma devoid of clotting factors, most notably fibrinogen. As a result,
the serum does not clot when left alone. Typically, to obtain serum, all clotting
agents in plasma are removed via progressive centrifugation or a blood sample is
obtained and allowed to clot before the supernatant is extracted. The serum contains
all of the other electrolytes, non-clotting proteins, drugs, and toxins. Human serum is
typically used for diagnostic purposes. Other animal sera are utilized as anti-venom,
antitoxins, and vaccines (Fig. 5.4).
64 S. Chourasiya et al.

Fig. 5.3 In the presence of an

anticoagulant, blood can be
separated into two phases.
Plasma, the liquid portion of
blood, accounts for
approximately 55% of blood
volume. Erythrocytes,
leucocytes, and platelets
account for 45% of total blood
volume (# Li 2015)

Fig. 5.4 Photograph of

centrifuged blood (# Li
2015)
5 Identification of Blood 65

5.2 Presumptive Assays for Identification

5.2.1 Principle of Presumptive Assays

The purpose of presumptive blood tests is to detect traces of blood. These tests are
predicated on the fundamental principle of the oxidation–reduction reaction
catalyzed by the heme portion of hemoglobin. Consequently, colorless substrates
catalyzed by heme undergo an oxidation reaction, resulting in chemiluminescence,
fluorescence, or a color change. These tests are very sensitive and can find blood in
samples that have been diluted up to 105–106 times. The presence of blood may be
indicated by a positive reaction. Additionally, the majority of these tests do not
impede forensic DNA analysis.

5.2.2 Oxidation: Reduction Reaction

In an oxidation–reduction reaction, the state of oxidation of a molecule changes. In

particular, the oxidation of a molecule indicates that it has lost electrons, whereas the
reduction of a molecule indicates that it has gained electrons.
Oxidants: Oxidants are substances that are chemically capable of being reduced,
and as a result can acquire electrons from other molecules.
Reductants: Chemicals that are capable of being oxidized and can therefore
donate their electrons to other molecules are referred to as reductants.
Biochemical reactions often lose hydrogen during oxidation. Figure 5.6 depicts
an oxidation–reduction reaction for blood identification. In presumptive assays,
heme serves as the catalyst and hydrogen peroxide serves as the oxidant. A colorless
substrate is oxidized in the presence of heme, producing a product with color,
chemiluminescence, or fluorescence.

5.2.3 Structure of Heme

Four pyrroles, small pentagon-shaped molecules with four carbons and one nitrogen,
make a heme. Tetrapyrrole is formed by combining four pyrroles. A porphyrin is a
tetrapyrrole with side chain substitutions that allow it to hold a metal ion. Heme is
thus a porphyrin-containing iron. Heme has many forms [(a) Protoporphyrin IX].
(b) Heme (ferroprotoporphyrin). Hemochromagen (c), R = pyridine (pyridine
ferroprotoporphyrin). (d) Hematin hydroxide, R = OH (ferriprotoporphyrin hydrox-
ide); hematin chloride, R = Cl (ferriprotoporphyrin chloride)], which correspond to
the numerous functions that it must perform in an organism (Li 2015) (Fig. 5.5).
66 S. Chourasiya et al.

(c) (d)
Fig. 5.5 Structure of the heme molecule (# Li 2015)

5.2.4 Types of Presumptive Assays for Blood

Presumptive assays are of three types: colorimetric assays, chemiluminescence, and

fluorescence assays.

5.2.5 Colorimetric Assays

There are numerous methods for detecting heme in blood via color reactions.
Phenolphthalein, leucomalachite green, and benzidine derivatives are the most
commonly used agents. The color reactions produced by these assays can be seen
with the naked eye right away.
5 Identification of Blood 67

Fig. 5.6 Chemical reaction of the phenolphthalein assay (# Li 2015)

5.2.5.1 Phenolphthalein Assay

Phenolphthalein, an indicator, and dye, is used in titrations of mineral and organic
acids, as well as most alkalis. The phenolphthalein assay for blood identification is
also known as the Kastle–Meyer test. Kastle published a study in 1901 that presented
the results of a reaction in which phenolphthalein, a colorless compound, is
catalyzed by heme with hydrogen peroxide as the oxidant (Fig. 5.6). Under alkaline
conditions, the oxidized derivative is phenolphthalein, which appears pink.

5.2.5.2 Reagent Preparation

Stock Solution
Phenolphthalein: 2.0 g
Potassium hydroxide: 20.0 g
Distilled water: 100 ml
Zinc dust: 20.0 g

Mix, add a few boiling chips, and boil under reflux for 2–3 h or until the solution has
lost its pink color. Cool and decant into a bottle containing some zinc to keep in the
reduced form.

Working Solution
Solution # 1: Ethanol 10 ml
Solution # 2: Phenolphthalein stock 2 ml
Distilled water 10 ml
Ethanol 2 ml
Solution # 3: 3% Hydrogen peroxide 10 ml

Procedure
1. A small cutting, swabbing, or extract of the suspected bloodstain is placed on a
filter paper or spot test paper.
2. Two or three drops of ethanol are placed on the stain.
3. Two drops of working phenolphthalein solution are added to the stain.
68 S. Chourasiya et al.

Fig. 5.7 Photograph of phenolphthalein assay results. Positive (left), negative (center), and control
(right)

Fig. 5.8 Chemical reaction of the leucomalachite green assay (# Li 2015)

4. After waiting to insure that no color develops at this stage, two or three drops of
3% hydrogen peroxide are added.
5. An intense pink color is a positive test for peroxidase activity, indicative of
hemoglobin. This is not a confirmatory test for blood (Fig. 5.7).

5.2.5.3 Leucomalachite Green Assay

The green color of malachite is a triphenylmethane dye. The colorless leuco base
form of malachite green can be oxidized by heme catalysis to produce a green color.
Hydrogen peroxide is used as the oxidant and the reaction is carried out under an
acidic environment (Cox 1991) (Fig. 5.8).

5.2.5.4 Reagent Preparation

Stock Solution
Leucomalachite green: 0.25 g
Glacial acetic acid: 100 ml
5 Identification of Blood 69

Distilled water: 150 ml

Zinc dust: 5 g

Mix, add a few boiling chips, and boil under reflux for 2–3 h or until the solution has
lost all its color. Cool and decant into a bottle containing some zinc to keep it in
reduced form.
Hydrogen peroxide 3%.

1. Measure out 10 ml of 30% hydrogen peroxide.

2. Add 90 ml of deionized water.
3. May be stored at room temperature or refrigerated—expiration date 1 year.

5.2.5.5 Procedure
1. Swab the suspected blood stain with a clean filter paper or a swab, which may be
moistened, if necessary, with deionized water, ethanol, or saline.
2. Apply 1–2 drops of the LMG reagent.
3. Note any blue-green color change. A blue-green color change at this step
indicates a chemical oxidant and the test should be considered inconclusive. If
there is no color change, proceed to the next step.
4. Add 1–2 drops of 3% hydrogen peroxide.
5. Note any immediate blue-green color change.
6. An immediate blue-green color change indicates a positive result. No color
change indicates a negative result. A negative result indicates that either no
blood is present or is below the limit of detection of the test (Fig. 5.9).

5.2.5.6 Benzidine and Its Derivatives

In the past, benzidine was used as a step in the process of making dyes (Fig. 5.10). It
was later used as a blood-presumptive assay after it was discovered that heme can
catalyze the oxidation of benzidine, resulting in a blue to dark blue color (carried out

Fig. 5.9 Photograph of the

leucomalachite green assay
results. Negative (left) and
positive (right) reactions (#
Li 2015)
70 S. Chourasiya et al.

Fig. 5.10 Chemical

structures of benzidine and
derivatives: (a) benzidine, (b)
orthotolidine, and (c)
tetramethylbenzidine (# Li
2015)

Fig. 5.11 Chemical reaction of the ortho toluidine assay (# Li 2015)

in an acid solution). The reaction must be read instantly because the blue color could
change to brown over time. Since it was found to cause cancer, forensic testing no
longer uses benzidine. Orthotolidine is made from dimethylated benzidine. Under
acidic conditions, its oxidation reaction can be catalyzed by heme, resulting in a blue
color reaction (Fig. 5.11). Based on studies with animals, ortho toluidine is also
thought to be a possible carcinogen. Because of this, it has been replaced with
5 Identification of Blood 71

tetramethylbenzidine (TMB). TMB is a benzidine tetramethyl derivative. Under

acidic conditions, the oxidation of TMB can be catalyzed by heme to produce a
green to blue-green color. TMB is still being used. Miles Laboratories’ Hemastix®
assay kit is a TMB-based assay that employs a TMB-containing strip device. A
moistened sample is applied to a Hemastix® strip for testing. The presence of blood
is indicated by the appearance of a green or blue-green color (Garner et al. 1976).

5.2.5.7 Reagent Preparation

Acetate Buffer
Sodium acetate: 5.0 g
Glacial acetic acid: 43.0 ml
Deionized water: 50.0 ml

Working Solution
TMB: 0.4 g
Acetate buffer: 20.0 ml

Mix, filter, and store in a brown-colored bottle in the refrigerator.

Procedure
1. Place a cutting or swabbing of the stain on a filter paper or spot test paper.
2. A drop of TMB solution is placed on the stain, followed by a drop of 3%
hydrogen peroxide.
3. An immediate blue-green color is a positive test for peroxidase activity, indicative
of hemoglobin. This is not a confirmatory test for blood (Fig. 5.12).

5.2.5.8 Chemiluminescence and Fluorescence Assays

Chemiluminescence assay: The emission of light occurs as a byproduct of a
chemical reaction in the chemiluminescence assay. When there is blood present,
luminol produces chemiluminescence.
Fluorescence assays: For a fluorescence assay, an oxidized product like fluores-
cein needs to be exposed to a certain wavelength of an excitation light source. The

Fig. 5.12 Photograph of the

benzidine assay results.
Changes in color throughout
various dilutions of blood can
be seen
72 S. Chourasiya et al.

fluorescence is then emitted at longer wavelengths than the light source that
caused it.

Advantages of Chemiluminescence and Fluorescence Assays

Chemiluminescent and fluorescent reagents have the advantage of being sprayed
over large areas where latent bloodstains may be found. A positive reaction shows
that there was blood and shows how bloody marks, like footprints and fingerprints,
are made. These techniques are so sensitive that even trace amounts of blood can be
located. They can be used to find signs of blood at crime scenes even after they have
been cleaned.

Disadvantages of Chemiluminescence and Fluorescence Assays

It is necessary to take precautions with chemiluminescent and fluorescent reagents if
stains are very small or have been washed. It may be challenging to isolate sufficient
DNA for forensic DNA analysis if reagents are sprayed onto a sample because it is
further diluting the sample. The use of a reagent is restricted to situations with a low
or non-existent light source (Li 2015).

Luminol Test
Luminol is most commonly used as a chemiluminescent reagent. In the presence of
an oxidant, the oxidation reaction of luminol catalyzed by heme produces light
(Figs. 5.13–5.14). The light emitted by a positive reaction can only be seen in the
dark, limiting luminol’s applications. A luminol-enhanced pattern should be
photographed as soon as possible before it fades away (Creamer et al. 2003).

Reagent Preparation
1. Solution 1: Add 2 ml of 3% H2O2 to approximately 50 ml of distilled water.
2. Solution 2: Mix 0.05 g luminol into 10 ml of 5% NaOH.
3. Mix Solution 1 and Solution 2 and bring the final volume up to 100 ml with
distilled water.
4. Pour the reagent into the spray bottle.

Luminol 3 - Aminophthalate

Fig. 5.13 Chemical reaction of luminol (# Li 2015)

5 Identification of Blood 73

Fig. 5.14 Photograph of the luminol test: a blue chemiluminescence indicates the presence of
blood

Fig. 5.15 Photograph of the

fluorescence assay (# Li
2015)

Procedure
1. Spray the luminol reagent on the suspected area where blood stains can be
present.
2. Appearance of blue light indicates (Fig. 5.14) the presence of blood in the
suspected area.

Fluorescein Test
Another reagent used to detect the presence of bloodstains at a crime scene is
fluorescein (Fig. 5.15). Fluorescein exhibits fluorescent properties when oxidized
and catalyzed by heme. Fluorescein-sprayed stains are typically exposed to light in
the 425–485 nm range using an alternate light source device. When oxidized
fluorescein is present, it emits an intense yellowish-green fluorescent light,
indicating the presence of a bloodstain. Fluorescein-sprayed stains emit more light
than luminol-sprayed stains (Cheeseman and Tomboc 2001).
74 S. Chourasiya et al.

5.3 Confirmatory Assays for Identification

5.3.1 Microcrystal Assays

In microcrystal assays, chemicals are used to treat bloodstains, resulting in the

formation of crystals of heme molecules. Crystals formed as a result of this process
have distinct morphologies that are characteristic of heme. These morphologies can
be examined under a microscope and can be compared to a known standard. The
presence of blood is strongly indicated by a positive microcrystal assay. However,
confirmatory assays are typically less sensitive than presumptive assays. In addition,
there is no way to tell the difference between human and animal blood using these
methods.

5.3.1.1 Hemochromagen Crystal Assay

Hemochromagens are a type of heme derivative in which the heme’s ferrous iron
forms two bonds, one with nitrogenous bases and one with other heme molecules
(Fig. 5.16). In the year 1864, the process of producing hemochromagen crystals was
first documented. Since then, reports have surfaced of a number of different
modifications. Since its publication in 1912, the Takayama crystal assay has been
the method of choice for many forensic laboratories. In alkaline conditions, a
bloodstain is treated with pyridine and glucose, which is a reducing sugar that can
reduce ferric ions. This procedure results in the formation of crystals of pyridine
ferroprotoporphyrin (Fig. 5.16).

5.3.1.2 Hematin Crystal Assay

The Hematin Crystal Analysis: The Teichmann crystal assay is another name for
this particular analysis. Teichmann published a method for the formation of crystals
from blood specimens in the year 1853. Hematin chloride, also known as

Fig. 5.16 Microcrystal

assays using the Takayama
method (# Li 2015)
5 Identification of Blood 75

Fig. 5.17 Microcrystal

assays using the Teichmann
method (# Li 2015)

ferriprotoporphyrin chloride, is a brown crystal with a prismatic appearance that is

produced from blood samples after they have been subjected to treatment with
glacial acetic acid and salts (Fig. 5.17). Hematin is a heme derivative and its iron
is in the ferric (Fe+3) state (Fig. 5.17). The sensitivity and specificity of this hematin
assay are not significantly different from those of hemochromagen assays. For older
blood samples, the hematin assay is recommended because it has a higher reliability
rate than the hemochromagen assay.

5.4 Conclusion

In traditional crimes, blood is often found at the crime scene. The testimony of
forensic scientists is crucial in bringing about fairness in the courtroom, and this is
accomplished through the examination of blood samples found at the crime scene. In
a wide variety of criminal cases, blood is often detected using presumptive and
confirmatory assays. Confirmatory assays involve the use of chemicals to treat
bloodstains, which ultimately results in the formation of crystals composed of
heme molecules. The heme crystals that are formed as a result of this process have
distinct morphologies that are typical of the substance. Presumptive assays are based
on the principle of an oxidation–reduction reaction, in which colorless substrates that
are catalyzed by heme undergo an oxidation reaction, which results in chemilumi-
nescence, fluorescence, or a change in color.

References
Cheeseman R, Tomboc R (2001) Fluorescein technique performance study on bloody foot trails. J
Forensic Identif 51(1):12
Cox M (1991) A study of the sensitivity and specificity of four presumptive tests for blood. J
Forensic Sci 36(5):1503–1511
76 S. Chourasiya et al.

Creamer JI, Quickende TI (2003) A comprehensive experimental study of industrial, domestic and
environmental interferences with the forensic luminol test for blood. Wiley Analytical Sci 18(4).
https://doi.org/10.1002/bio.723
Garner DD et al (1976) An evaluation of tetramethylbenzidine as a presumptive test for blood. J
Forensic Sci 21(4):816–821
Kuhn V, Diederich L et al (2017) Red blood cell function and dysfunction: redox regulation, nitric
oxide metabolism, anemia. In: Antioxidants & redox signaling, vol 26, issue 13. Mary Ann
Liebert, Inc. https://doi.org/10.1089/ars.2016.6954
Li R (2015) Forensic biology. CRC Press Taylor & Francis Group
Serology Concept and Techniques
6
Arjun Rao Isukapatla, Mehar Chadha, and Moumita Sinha

Abstract

Forensic serology is the study of bodily fluids in the context of forensic

investigations. Antigens and antibodies are important components of forensic
serology because they can be used to identify the presence of bodily fluids,
determine the source of the fluids, and link a suspect to a crime scene. An antigen
is a molecule that can elicit an immune response in an organism. In the context of
forensic serology, antigens found in bodily fluids can be used to identify the type
of fluid present, such as blood, semen, saliva, or urine. The use of antigen–
antibody interactions in forensic science is a valuable tool for identifying and
analyzing bodily fluids and other substances found at crime scenes, which can
help to establish the identity of suspects and provide important evidence in
criminal investigations. In forensic serology, techniques such as enzyme-linked
immunosorbent assays (ELISAs) and immunofluorescence assays (IFAs) are
commonly used to detect the presence of antigens and antibodies in bodily fluids.
These techniques can be used to identify the type of bodily fluid present,
determine the blood group of an individual, and link a suspect to a crime scene
based on the presence of bodily fluids.

A. R. Isukapatla
Faculty of Forensic Science, Department of Life Sciences, Christ University, Bangalore, Karnataka,
India
e-mail: [email protected]
M. Chadha
Department of Life Sciences, Christ University, Bangalore, Karnataka, India
e-mail: [email protected]
M. Sinha (✉)
Department of Forensic Science, Kalinga University, Raipur, Chhattisgarh, India
e-mail: [email protected]

# The Author(s), under exclusive license to Springer Nature Singapore Pte 77

Ltd. 2024
A. Puri et al. (eds.), Fundamentals of Forensic Biology,
https://doi.org/10.1007/978-981-99-3161-3_6
78 A. R. Isukapatla et al.

Keywords

Forensic serology · Antigens · ELISA · Immunoassay · Agglutination

6.1 Forensic Serology

Forensic serology is a branch of forensic science that deals with the identification
and analysis of body fluids, such as blood, semen, saliva, and sweat, found at a crime
scene. Serology involves the use of immunological techniques to detect and analyze
antigens and antibodies present in bodily fluids. The analysis of bodily fluids can
provide valuable information for criminal investigations. For example, the presence
of blood can help determine the cause and manner of death, while the presence of
semen or saliva can help identify potential suspects. Forensic serologists use a
variety of techniques to analyze bodily fluids, including blood typing, DNA analysis,
and enzyme immunoassays. They may also use microscopic examination to identify
characteristics of the fluid or use chemical tests to identify the presence of certain
compounds. Overall, forensic serology plays an important role in helping
investigators piece together the events surrounding a crime and can provide critical
evidence in criminal cases. Antigens and antibodies are important components of
forensic serology, as they help to identify and analyze bodily fluids found at a crime
scene. Antigens are substances that trigger an immune response in the body, while
antibodies are proteins produced by the immune system in response to an antigen. In
forensic serology, antigens and antibodies can be used to identify and analyze bodily
fluids such as blood, semen, saliva, and sweat. For example, the ABO blood group
system is based on the presence of specific antigens on the surface of red blood cells,
which can be identified using specific antibodies. This information can be used to
match blood samples found at a crime scene with the blood type of a suspect or
victim. Similarly, antibodies can be used to detect the presence of specific antigens in
bodily fluids.
The presence of the prostate-specific antigen (PSA) in semen can be detected
using antibodies specific to PSA. This information can be used to identify the
presence of semen at a crime scene and can be used to match the semen sample to
a potential suspect. Blood antigens are proteins found on the surface of red blood
cells and are used to determine an individual’s blood type. The most commonly used
blood group systems in forensic serology are the ABO system and the Rh system.
Saliva antigens can also be used in forensic science to identify and analyze bodily
fluids found at a crime scene (Old et al. 2009). Saliva contains a variety of proteins
and enzymes, including alpha-amylase, which is an enzyme that breaks down
starches. The detection of alpha-amylase is commonly used to identify the presence
of saliva in a sample. This can be done using a variety of techniques, including
colorimetric assays, immunological tests, and DNA analysis. Sweat antigens can
also be used in forensic serology to help identify and analyze bodily fluids found at a
crime scene (Schittek et al. 2001). Sweat contains a variety of proteins and
electrolytes, including eccrine sweat gland-specific proteins such as dermcidin and
6 Serology Concept and Techniques 79

sweat gland-specific antigen (SGS). The detection of sweat antigens can help
identify the presence of sweat on a sample. This can be done using immunological
tests, such as enzyme immunoassays, which can detect the presence of specific
antigens in a sample.

6.2 Immunogen and Antigens

Immunogens and antigens are related concepts in immunology, but they are not
exactly the same. An antigen is any substance that is recognized by the immune
system as foreign or non-self and that can elicit an immune response. Antigens can
be naturally occurring, such as the surface proteins of a virus or bacteria, or they can
be synthetic or recombinant, such as those used in vaccines. On the other hand, an
immunogen is a type of antigen that is capable of inducing an immune response in an
organism by triggering the production of antibodies or immune cells specific to that
antigen. In other words, not all antigens are immunogens, but all immunogens are
antigens. Immunogens are usually larger, more complex molecules than other
antigens, and they often require additional processing and presentation by antigen-
presenting cells (APCs) to stimulate an immune response. Antigens are any
substances that can be recognized by the immune system, while immunogens are a
specific subset of antigens that can induce an immune response by themselves.

6.2.1 Use of Immunogen and Antigen in Forensic Serology

Immunogens and antigens are used in forensic serology to identify and analyze
biological fluids found at crime scenes or in other types of forensic investigations.
When a fluid sample is collected, it is typically tested to determine whether it
contains antigens or antibodies that are specific to a particular body fluid, such as
blood, semen, or saliva. One common method used in forensic serology is the
enzyme-linked immunosorbent assay (ELISA), which relies on the specific binding
of antibodies to antigens (Konstantinou 2017). For example, an ELISA test may be
used to detect the presence of blood by looking for the antigens present in red blood
cells. Another technique commonly used in forensic serology is the ABO blood
typing system, which is based on the presence of specific antigens on the surface of
red blood cells. By analyzing the antigens present in a blood sample, forensic
scientists can determine the individual’s blood type, which can provide valuable
information for investigations. In addition to blood typing and ELISA, immunogens
and antigens can also be used in DNA analysis to identify specific individuals from
biological samples. This technique relies on the detection of unique DNA sequences,
which can be amplified using polymerase chain reaction (PCR) and compared to
DNA samples from known individuals (Table 6.1).
80 A. R. Isukapatla et al.

Table 6.1 Classification of some common types of immunogens

Sl.
No. Types of Immunogens Characteristics
1 Proteins and peptides Most common types of immunogens include many viral and
bacterial surface proteins, as well as proteins found in
allergens
2 Polysaccharides Complex carbohydrates are found in bacterial and fungal
cell walls, and they are often used in vaccines
3 Lipids Some lipids can act as immunogens, such as glycolipids
found on the surface of some bacteria
4 Nucleic acids DNA and RNA can act as immunogens, especially when
they are exposed to the immune system due to infection or
cell death
5 Haptens Small molecules that can elicit an immune response only
when they are bound to a larger carrier protein, such as
penicillin
6 Synthetic and Immunogens that are artificially created in the laboratory,
recombinant immunogens such as recombinant proteins used in some vaccines
7 Autoantigens Self-antigens that are normally tolerated by the immune
system, but can become immunogens in autoimmune
diseases

6.3 Antibodies

Antibodies, also known as immunoglobulins, are proteins produced by the immune

system in response to the presence of foreign substances in the body, such as
bacteria, viruses, or other pathogens. Antibodies recognize and bind to specific
targets, called antigens, on the surface of these foreign substances, thereby marking
them for destruction by other cells of the immune system. Antibodies are composed
of two heavy chains and two light chains, which are held together by disulfide bonds
(Hamers-Casterman et al. 1993). Each antibody has a unique amino acid sequence in
its variable regions, which determines its specificity for a particular antigen. The
production of antibodies is a key component of the adaptive immune response,
which is the body’s defense mechanism against infection and disease. Vaccines
work by stimulating the immune system to produce specific antibodies against a
particular pathogen, without causing illness. There are five classes of antibodies,
each with different biological properties and functions, including IgA, IgD, IgE,
IgG, and IgM.

6.3.1 Types of Antibodies

There are five main types of antibodies, also known as immunoglobulins (Ig):
6 Serology Concept and Techniques 81

IgG: This is the most common antibody found in the blood and tissues. It provides
long-term protection against bacteria, viruses, and toxins. IgG can cross the
placenta from mother to fetus and provide passive immunity to the newborn.
IgM: This is the first antibody produced by the body in response to an infection. It is
present in the blood and lymphatic system and is effective in clearing pathogens
from the body.
IgA: This antibody is found in bodily secretions such as saliva, tears, breast milk,
and mucus membranes. It plays a critical role in defending against infections in
the respiratory and digestive systems.
IgE: This antibody is associated with allergies and plays a role in defending against
parasitic infections. It triggers the release of histamine, which causes the
symptoms of an allergic reaction.
IgD: This antibody is found in low levels in the blood and on the surface of B cells,
where it helps to trigger the production of other antibodies. Its exact function is
not well understood.

6.3.2 Production and Mechanism of Antibody

Antibodies or immunoglobulins (Ig) are Y-shaped proteins produced by B cells of

the immune system in response to the presence of foreign substances called antigens.
The production of antibodies is a complex process that involves several steps which
are further explained in Fig. 6.1.
The mechanism of antibody production involves a process called somatic
hypermutation (Neuberger and Milstein 1995), which introduces random mutations
into the genes encoding the antibody receptors on B cells. These mutations can result
in the production of antibodies with higher affinity for the antigen, which increases
the effectiveness of the immune response. A small subset of B cells undergoes a
process called class switching (Stavnezer et al. 2008), which changes the type of
antibody produced. This allows the immune system to produce different types of
antibodies, each with unique properties, to target different types of antigens.

6.3.3 Preparation of Antibodies

The preparation of antibodies typically involves immunization of an animal with the

antigen of interest, followed by the collection of serum containing the antibodies
produced by the animal’s immune system. The general steps involved the prepara-
tion of antibodies specific to nature and types of uses.

Choosing appropriate animal: Typically, animals such as rabbits, mice, and goats are
used for antibody production. The choice of animal depends on factors such as the
desired antibody class and the size of the animal.
Process of immunization: The animal is immunized with the antigen of interest,
either alone or conjugated to a carrier protein to enhance the immune response.
82 A. R. Isukapatla et al.

Antigen Proteins or other

B-cells recognize antigens
recognition foreign
substances

B-cells become
Activation and Upon antigen recognition activated and
proliferation undergo division

Produce and
Differentiation Some B-cells differentiate into plasma secrete large
cells amounts of
antibodies

Antibody Plasma cells synthesize and assemble Secreted into the

production antibodies bloodstream

Destruction by
Antibody Antibodies bind specifically to the other immune
function antigen cells

Fig. 6.1 Production process of antibodies

The antigen is usually injected multiple times over several weeks to boost the
immune response.
Serum collection: Blood is then collected from the desired animal and allowed to
clot, and the serum is separated from the clot by centrifugation. The serum
contains the antibodies produced by the animal’s immune system in response to
the antigen.
Antibody purification: The antibodies can be purified from the serum using various
methods, such as affinity chromatography, protein A or G chromatography, or
precipitation with ammonium sulfate.
Antibody characterization: The purified antibodies can be characterized by methods
such as enzyme-linked immunosorbent assay (ELISA) or Western blotting to
confirm their specificity and affinity for the antigen.
Antibody storage: The purified antibodies can be stored in a suitable buffer at -20 °
C or -80 °C for long-term storage.

Antibodies are highly sensitive and specific detection tools that can recognize and
bind to specific antigens with high affinity. The sensitivity of an antibody refers to its
ability to detect low levels of the target antigen (Silverstein 1995), often expressed as
the lowest concentration of antigen that can be reliably detected by the assay. The
sensitivity of an antibody depends on several factors, including the specificity and
affinity of the antibody for the target antigen, the quality of the antigen preparation,
6 Serology Concept and Techniques 83

and the detection method used in the assay. Generally, the higher the affinity and
specificity of the antibody, the more sensitive the assay will be. Many modern
antibody-based assays, such as ELISA, fluorescence-based assays, and immunohis-
tochemistry, can detect antigens in the low picogram to femtogram range (Ito et al.
2021). Some newer technologies, such as single-molecule imaging, can detect even
lower concentrations of antigens. The sensitivity of an antibody-based assay is not
the only factor that determines its accuracy and reliability. Other factors, such as
assay specificity, reproducibility, and robustness, should also be considered when
evaluating the performance of an antibody-based assay.

6.4 Antigen–Antibody Binding

Antigen–antibody reaction, also known as antigen–antibody interaction, is a specific

chemical reaction that takes place during an immune response between antigens and
antibodies produced by B cells of white blood cells. Antigens and antibodies are
combined during agglutination (Reverberi and Reverberi 2007). The body employs
this fundamental biological mechanism to protect itself from numerous outside
invaders, such as viruses and their poisonous compounds. When antibodies attach
to antigens in a precise and powerful manner, an antigen–antibody complex is
created in the blood. Following that, the immune complex is sent to cellular systems
where it can be neutralized or inactivated (Tang et al. 2021).

6.4.1 Antigen

Antigen is a material capable of triggering the immune system’s activation of

lymphocytes, the body’s white blood cells that fight infections. Foreign antigens
(also known as heteroantigens) and autoantigens are the two primary classifications
of antigens (or self-antigens). The source of foreign antigens is external to the body.
Examples include components of or compounds created by viruses, microorganisms
(such as bacteria and protozoa), substances in snake venom, specific proteins in
meals, and serum and red blood cell components from other people (Mohamed Abd
El-Aziz et al. 2019). On the other hand, autoantigens come from within the body.
Natural biological processes allow the body to distinguish between self and nonself,
but in people with autoimmune illnesses, these processes trigger an immune reaction
that results in the production of autoantibodies. An immunogen is an antigen that
stimulates the production of antibodies by lymphocytes or the direct attack of the
antigen by the immune system.
Antigenic determinants are parts of antigens that fit and bind to receptor
molecules on the surface of lymphocytes that have a complementary structure.
Initiating an immune response against the antigen, such as antibody formation,
cytotoxic cell activation, or both, is stimulated by the lymphocytes’ receptors
binding to the antigens’ surface molecules (Chaplin 2010). The type and quantity
84 A. R. Isukapatla et al.

of antigen present, the method of entry into the body, and the unique properties of the
host all affect how much antibody is produced in response to stimulation.

6.4.2 Antibody

An antibody is a protein-based element of the immune system that travels through

the blood, detects, and destroys foreign entities like bacteria and viruses. Antibodies,
also known as immunoglobulins, are Y-shaped proteins produced by the immune
system in response to antigens. They have two main regions: the variable region and
the constant region. The variable region is responsible for binding to the specific
antigen that triggered its production, while the constant region is responsible for
activating other components of the immune system to destroy the antigen.
Antibodies can be classified into different types based on their structure and func-
tion. Antibodies remain in circulation in the blood after exposure to an antigen,
acting as defense against additional exposures to that antigen.

6.4.3 Chemical Bonds Responsible for the Antigen–Antibody

Reaction

Similar to how proteins connect to their cellular receptors or enzymes bind to their
substrates, the interaction between the Ab-binding site and the epitope only includes
noncovalent bonding. High ionic strength or extremely low pH can inhibit or
dissociate the binding, which is reversible. Ag-Ab binding involves the following
intermolecular forces:

Electrostatic bonds: They are formed when two protein side chains with opposing
charges, such as an ionized amino group (NH4+) on a lysine in the Ab and an
ionized carboxyl group (COO-) on an aspartate residue in the Ag, attract one
another.
Hydrogen bonding: Hydrophilic groups, such as OH and C=O, NH and C=O, and
NH and OH groups, can form relatively weak hydrogen bonds when the Ag and
Ab are in close proximity.
Hydrophobic interactions: Hydrophobic groups, such as the side chains of valine,
leucine, and phenylalanine, have a tendency to connect owing to Van der Waals
bonding and aggregate in an aqueous environment, keeping water molecules out
of their surroundings. As a result, their separation grows smaller, intensifying the
attraction energies at play. Up to 50% of the Ag-Ab bond’s overall strength is
thought to come from interactions of this kind.
Bonds of Van der Waals: The interactions between the “electron clouds” that
surround the molecules of Ag and Ab are what drive these forces. The contact
has been compared to that which would occur between two molecules with
alternating dipoles, alternating such that at any one time, oppositely orientated
dipoles will be present in close-proximal regions of the Ag and Ab molecules.
6 Serology Concept and Techniques 85

6.4.4 Strength of Ag-Ab Interaction

6.4.4.1 Affinity
The degree of contact between an epitope and the antigen-binding site of an antibody
is measured by affinity. The same fundamental thermodynamic rules that apply to all
reversible biomolecular interactions characterize it:

K A = ½Ab - Ag] ÷ ½Ab]½Ag]

Affinity constant = KA
[Ab] is the amount of open binding sites on the antibody in molar form.
[Ag] is the amount of vacant binding sites on the antigen in molar form.
Molar concentration of the antibody–antigen combination is (Ab-Ag)

To put it another way, KA defines the quantity of antibody–antigen complex at the

time equilibrium is established. Each antibody’s rate of diffusion affects how long it
takes for this to happen. High-affinity antibodies, on the other hand, bind more
antigens in less time than low-affinity antibodies. As a result, KA for antibodies can
range significantly between below 105 mol-1 and over 1012 mol-1, depending on a
variety of variables such as pH, temperature, and buffer composition. Ab’s affinity
for an epitope is determined by the sum of all non-covalent contacts between that
epitope and its specific Ag-binding site.

Low-affinity Ab: Weakly binds Ag and easily dissociates.

Strong affinity Ab: Tightly binds Ag and maintains the bond for a longer time.

6.4.4.2 Avidity
Antibodies and antigens are multivalent, which means they have several binding
sites. Avidity is a measurement of an antibody’s overall ability to bind to each
binding site. The functional affinity is another name for avidity. Three elements
determine avidity.

• The affinity for binding: the degree to which a particular binding site has a strong
connection.
• The valency: The total number of binding sites involved.
• The structure of the involved antigen and antibody is the structural arrangement.
All antibodies are multivalent. IgMs are decavalent, while IgGs are bivalent.
• A more stable antibody–antigen complex might result from an antibody and
antigen structure that works well together.
• Avidity is the strength of the many interactions between multivalent Ab and
Ag. The ability of an antibody to bind is better measured by avidity than by
affinity. Low affinity can be made up for by high avidity.
86 A. R. Isukapatla et al.

6.4.4.3 Cross Reactivity

If two Ags have the same epitope or have chemically similar features, they may
cross-react when an antibody is induced by one Ag.

6.4.5 Stages of Antigen–Antibody Interaction

The interactions between antigen and antibody undergo three phases.

1. The creation of the Ag-Ab complex is a need for the first phase of the reaction.
2. Agglutination, precipitation, and other observable phenomena are the outcome of
the second stage.
3. The third stage includes neutralizing or destroying the Ag.

6.4.6 Types of Ag-Ab Interaction

6.4.6.1 Agglutination
When a certain Ag and its Ab combine in the presence of electrolytes at the right
temperature and pH, the particles cluster or agglutinate. Agglutinins are the
aggregates of cellular Ag produced by the serum’s Ab. The aggregated particle
antigens are known as agglutinogens.

1. Agglutination of slides: This is a quick and practical method of determining

whether agglutinating antibodies are present.
2. Tube agglutination: This method is frequently used to calculate the Ab concen-
tration. The Ab-containing serum is serially diluted with saline in tiny test tubes,
and then a consistent volume of the Ag solution is added. A control tube that does
not have any antiserum is kept. As soon as there is visible agglutination, the tubes
are incubated. The titer is the test tube with the highest level of agglutination.
3. The passive agglutination test is analogous to the hemagglutination test, but the
reaction’s physical features are distinct. An Ag-coated carrier particle helps to
convert a precipitation process into an agglutination reaction, increasing the
sensitivity of the reaction. As carrier particles, RBC, latex particles, or bentonite
might be employed. Tanned RBC (RBC coated with polystyrene) may occasion-
ally be utilized.

6.4.6.2 Precipitation
When a soluble Ag and its Ab interact in the presence of an electrolyte (NaCl) at a
particular pH and temperature, an insoluble precipitate of the Ag-Ab complex is
created. The molecule that causes precipitation is known as precipitin, and the
reaction is known as a precipitation reaction. Precipitation reactions can happen in
both the gel and liquid media.
6 Serology Concept and Techniques 87

Liquid precipitation: To carry out an antigen–antibody interaction, increasing

amounts of antigen are added to tubes containing a fixed amount of antibody. The
combination response of the antigen and antibody causes precipitation.
Gel precipitation: These techniques use Petri plates or plates with agar gel or a
similar gel. Both Ag and Ab rapidly diffuse throughout the gel system. Depending
on the diffusion rate and concentration of the reactants, a zone of equivalence will
develop at a particular place and be observable as precipitation. With intricate
preparations of Ag or Ab, several bands form. They can be classified as either single
diffusion or double diffusion techniques.

6.4.6.3 Complement Fixation

One technique to show the presence of antibodies in patient serum is complement
fixation. The traditional technique for proving the presence of an antibody in patient
serum is complement fixation. Two elements make up the complement fixation test.
A combination of sheep red blood cells, a complement-fixing antibody such as
immunoglobulin G made against the sheep red blood cells, and an external supply
of complement—typically guinea pig serum—makes up the initial component of an
indicator system. The anti-sheep antibody attaches to the surface of red blood cells
when these components are combined under ideal circumstances. After this antigen–
antibody combination is produced, a complement attaches to it, causing the red
blood cells to lyse.
In addition to complementing, the second component consists of a recognized
antigen and patient serum added to a suspension of sheep red blood cells. The
complement fixation method’s two components are put to the test one after the
other. Prior to adding a complement to the mixture, the patient serum is added to the
known antigen. The ensuing antigen–antibody complexes will bind every compo-
nent if the serum has antibodies to the antigen. Afterwards, the antibody is
introduced together with sheep red blood cells. Complement is accessible to bind
to the sheep cell indicator system and anti-sheep antibody if it has not already been
bound by a known antigen. A negative complement fixation test and the absence of
antibodies in the patient’s serum are both indicated by the lysis of the indicator sheep
red blood cells. The absence of red blood cell lysis will be an indicator of a favorable
outcome if the patient’s serum does contain a complement-fixing antibody.

6.4.6.4 Hemagglutination
A serological assay called hemagglutination is used to pinpoint a potential virus and
find related antibodies. Red blood cells are used as a source of antigens in the
experiment. Red blood cells clump together as a result of a process called hemag-
glutination when some enveloped viruses, such as the influenza virus, are present.
Hemagglutinin, a glycoprotein on the viral surface, interacts with red blood cells to
cause them to group together and create a lattice. The hemagglutination inhibition
assay (HIA) is used to assess the amount of antiviral antibodies that have been
produced. In HIA, the absence of hemagglutination is used to determine whether
antibodies are present in a particular sample.
88 A. R. Isukapatla et al.

6.4.6.5 Neutralization
By blocking or neutralizing any biological effects an antigen or infectious agent
might have, a neutralizing antibody protects a cell from harm. Many viral infections
can be avoided with the help of an antibody response, which may also aid in the
healing of an infection. When a virus infects a vertebrate, antibodies are made
against several epitopes of various virus proteins (Neurath 2008) via a process
known as neutralization, a fraction of these antibodies can prevent viral infection.
Virus–antibody complex development typically occurs in this situation.

6.5 Primary Binding Assays

Primary binding assays are experimental techniques used to measure the interaction
between two or more molecules, such as a ligand and a receptor, and determine the
strength and specificity of the binding. These assays are used to determine the
affinity, stoichiometry, and kinetics of the interaction, as well as to identify potential
drug candidates or evaluate the efficacy of a drug (Findlay 2008). Examples of
primary binding assays include radioligand binding assays, fluorescence-based
assays, and surface plasmon resonance assays. These assays are widely used in
drug discovery and development, as well as in basic research to understand the
mechanisms of biological processes. Some of the routinely used primary binding
tests/assays in the laboratories are:

6.5.1 Radio Immunoassay

Radioimmunoassay (RIA) is a laboratory technique used to measure the concentra-

tion of a specific antigen (a substance that stimulates the production of an antibody)
or antibody (a protein produced by the immune system in response to an antigen) in a
given sample. It involves the use of a radioactive isotope, typically iodine-125, as a
tracer to label the antigen or antibody being measured. In RIA, a known amount of
the antigen or antibody to be measured is mixed with a fixed amount of a
corresponding antibody or antigen that has been labeled with a radioactive isotope
(Lowenstein et al. 2006). The mixture is then allowed to incubate, during which time
the labeled and unlabeled molecules compete for binding to the corresponding
antibody or antigen. After the incubation period, the mixture is separated, typically
using a solid-phase adsorbent, such as a bead or a plate, which binds the antibody or
antigen. The amount of radioactive isotope bound to the solid-phase adsorbent is
then measured using a scintillation counter or other radiation detector. The amount
of radioactivity detected is proportional to the amount of labeled antigen or antibody
in the sample. By comparing the amount of radioactivity in the sample to that of a
known standard, the concentration of the antigen or antibody in the sample can be
determined. RIA is a sensitive and precise technique that has been widely used in
clinical and research laboratories to measure a variety of antigens and antibodies,
including hormones, drugs, and infectious agents.
6 Serology Concept and Techniques 89

There are several methods of radioimmunoassay (RIA) used in laboratory

practices, but the basic principle involves the use of a labeled antigen or antibody
and a corresponding unlabeled antigen or antibody. The labeled antigen or antibody
is usually a radioactive isotope, such as iodine-125 or tritium, while the unlabeled
antigen or antibody is the one being measured in the sample. Some common
methods of RIA include:

Competitive RIA: In this method, a fixed amount of labeled antigen or antibody is

mixed with a known amount of unlabeled antigen or antibody and a fixed amount
of corresponding antibody or antigen. The mixture is allowed to incubate, and the
proportion of labeled antigen or antibody that remains bound to the antibody is
inversely proportional to the concentration of unlabeled antigen or antibody in the
sample.
Sandwich RIA: This method involves the use of two antibodies that bind to
different parts of the same antigen. The antigen is sandwiched between the two
antibodies, one of which is labeled with a radioactive isotope. The amount of
radioactivity detected is proportional to the amount of antigen in the sample.
Direct RIA: In this method, the antigen or antibody is directly labeled with a
radioactive isotope, and the amount of radioactivity detected is proportional to
the amount of antigen or antibody in the sample.
Indirect RIA: This method involves the use of a secondary antibody that is labeled
with a radioactive isotope and binds to the primary antibody–antigen complex.
The amount of radioactivity detected is proportional to the amount of the primary
antibody–antigen complex in the sample. The choice of the RIA method depends
on the specific antigen or antibody being measured and the sensitivity and
specificity required for the particular type of assay.

6.5.2 Immunofluorescence Assay

Immunofluorescence assay (IFA) is a highly sensitive and specific technique for

detecting and visualizing antigens or antibodies in a variety of samples. It is
commonly used in medical diagnosis, research, and quality control testing. The
principle of immunofluorescence assay (IFA) is based on the use of fluorescent-
labeled antibodies to detect and visualize specific antigens or antibodies in a sample
(Im et al. 2019). The assay utilizes the specific binding of antibodies to their target
antigens. In an IFA, the sample is first fixed onto a glass slide or a membrane and
then blocked to minimize non-specific binding. A primary antibody specific to the
antigen of interest is added to the sample and allowed to bind to the target antigen. A
fluorescent-labeled secondary antibody is then added, which binds to the primary
antibody, allowing for visualization of the antigen or antibody of interest. The
sample is then washed to remove any unbound antibodies, and examined under a
fluorescence microscope. When the fluorescent-labeled secondary antibody binds to
the primary antibody that is bound to the antigen, it produces light of a specific color,
which can be detected and visualized using a fluorescence microscope. The presence
90 A. R. Isukapatla et al.

or absence of fluorescence at specific locations in the sample can be interpreted to

determine the presence or absence of the antigen or antibody of interest.
Immunofluorescence assay (IFA) is a highly sensitive and specific technique for
detecting and visualizing antigens or antibodies in a variety of samples. This
technique is a highly sensitive technique that can detect even small amounts of
antigens or antibodies in a sample (Abraham et al. 1994). This makes it useful for
detecting low-level infections or for monitoring immune responses. IFA is a highly
specific technique that can differentiate between closely related antigens or
antibodies. This is important in distinguishing between different strains of viruses
or bacteria. The IFA technique can also be used to quantify the amount of antigen or
antibody present in a sample. This is useful for monitoring changes in the immune
response over time and can be used to detect a wide range of antigens or antibodies in
various types of samples, including cells, tissues, and body fluids. IFA can be
performed in two easy ways.

Direct immunofluorescence assay (DFA): This is a type of immunofluorescence

assay (IFA) used to detect the presence of a specific antigen in a sample. It
involves the use of a fluorescent-labeled primary antibody that binds directly to
the antigen of interest, allowing visualization of the location of the antigen under
a fluorescence microscope.
Indirect immunofluorescence assay (IFA): This is a type of immunofluorescence
assay used to detect the presence of a specific antibody in a sample. It involves the
use of a fluorescent-labeled secondary antibody that binds to the primary antibody
that was already bound to the antigen of interest, allowing visualization of the
location of the antibody under a fluorescence microscope.

6.5.3 Immunoprecipitation (IP)

This technique is used to isolate and purify a specific protein or complex of proteins
from a complex mixture of biological samples, such as cell lysates or body fluids. It
involves the use of an antibody that specifically recognizes and binds to the target
protein, followed by the precipitation of the antibody–protein complex using a
suitable matrix, such as protein A/G beads or magnetic beads. The basic steps
involved in immunoprecipitation are as follows:

1. Sample preparation: The sample is first lysed to release the proteins of interest.
The lysate is then clarified by centrifugation to remove cellular debris and other
insoluble materials.
2. Antibody incubation: The clarified lysate is incubated with a specific antibody
that recognizes and binds to the target protein.
3. Immunoprecipitation: The antibody–protein complex is then precipitated by
adding a suitable matrix, such as protein A/G beads or magnetic beads, which
specifically bind to the antibody. The matrix is then washed to remove any
non-specifically bound proteins.
6 Serology Concept and Techniques 91

4. Elution: The protein of interest is then eluted from the matrix using a suitable
buffer or reagent, and can be further analyzed by methods such as Western
blotting or mass spectrometry.

Immunoprecipitation is a powerful technique that allows specific isolation and

purification of target proteins from complex biological samples. It is widely used in a
range of applications, such as protein–protein interaction studies, identification of
post-translational modifications, and analysis of protein complexes.

6.5.4 Enzyme-Linked Immunosorbent Assay (ELISA)

ELISA is a widely used laboratory technique used to detect and quantify the
presence of specific proteins or antibodies in a biological sample, such as blood or
urine. ELISA involves the use of a capture antibody that specifically recognizes and
binds to the target protein or antibody of interest, followed by detection with a
secondary enzyme-linked antibody that produces a colorimetric or fluorescent sig-
nal. ELISA is a powerful and widely used technique with several advantages
(Engval 2010), including its high sensitivity and specificity, ease of use, and ability
to detect a wide range of proteins and antibodies in a variety of biological samples. It
is used in a variety of applications, such as clinical diagnosis, vaccine development,
and drug discovery. The basic steps involved in an ELISA are as follows:

1. Coating: The wells of a microtiter plate are coated with a capture antibody that
specifically recognizes and binds to the target protein or antibody of interest.
2. Blocking: The wells are then blocked to prevent non-specific binding of other
proteins or antibodies.
3. Sample incubation: The biological sample, such as blood or urine, is added to the
wells and allowed to incubate with the capture antibody.
4. Detection antibody incubation: A secondary antibody, which is linked to an
enzyme such as horseradish peroxidase, is added to the wells and allowed to
bind to the target protein or antibody of interest.
5. Substrate incubation: A substrate that is specific for the enzyme is added to the
wells, causing a color change that indicates the presence and amount of the target
protein or antibody.

In ELISA, the enzymes used are typically linked to the secondary antibody used
for detection. The most commonly used enzyme for this purpose is horseradish
peroxidase (HRP), which can be conjugated to the secondary antibody via a chemi-
cal coupling reaction. Other enzymes that can be used in ELISA include alkaline
phosphatase, beta-galactosidase, and glucose oxidase. The enzyme-linked secondary
antibody is added to the ELISA plate after the primary antibody has bound to the
antigen or protein of interest. The substrate specific to the enzyme is then added,
causing a color change or fluorescence that is proportional to the amount of antigen
92 A. R. Isukapatla et al.

or protein present in the sample. The detection system is often optimized to ensure
high sensitivity and low background signal.
In ELISA, the colorimetric substrates used to visualize the enzyme-linked detec-
tion antibody are typically chromogenic substrates that produce a visible color
change upon reaction with the enzyme. The most commonly used colorimetric
substrates for ELISA include:

1. TMB (3, 3′, 5, 5′-tetramethylbenzidine): TMB is a widely used substrate that

produces a blue color when oxidized by horseradish peroxidase (HRP). The
reaction can be stopped with the addition of an acid, which changes the color to
yellow. TMB is often used in sandwich ELISAs for the detection of proteins.
2. ABTS (2, 2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)): ABTS is a
soluble chromogenic substrate that produces a green color when oxidized by
HRP. The reaction can be stopped with the addition of an acid, which changes the
color to yellow. ABTS is often used in competitive ELISAs for the detection of
small molecules.
3. PNPP ( p-nitrophenyl phosphate): PNPP is a colorless substrate that produces a
yellow color when cleaved by alkaline phosphatase (AP). PNPP is often used in
phosphatase-based ELISAs for the detection of proteins.
4. BCIP/NBT (5-bromo-4-chloro-3-indolyl phosphate/nitroblue tetrazolium):
BCIP/NBT is a substrate that produces a blue/purple color when cleaved by
alkaline phosphatase (AP). BCIP/NBT is often used in ELISAs for the detection
of nucleic acids or protein–protein interactions.

The choice of the substrate depends on the enzyme used and the desired colori-
metric signal. Colorimetric ELISA substrates are widely used due to their simplicity,
affordability, and compatibility with standard laboratory equipment.
There are several types of ELISA, including direct, indirect, sandwich, and
competitive ELISAs, each with its own unique applications.

6.5.4.1 Direct ELISA

Direct ELISA is a type of ELISA that is used to detect the presence of a specific
antigen in a sample. In a direct ELISA, the antigen is immobilized on a solid support,
such as a microtiter plate, and a labeled primary antibody specific to the antigen is
used for detection (Shah and Maghsoudlou 2016). The principle of direct ELISA
involves the following steps:

1. Coat the solid support: The first step in a direct ELISA is to coat the solid support
with the antigen of interest. This can be done by adding a known amount of the
antigen to the wells of a microtiter plate and allowing it to bind to the surface of
the plate.
2. Block non-specific binding: After the antigen is coated on the solid support, the
plate is treated with a blocking solution to prevent non-specific binding of the
primary antibody.
6 Serology Concept and Techniques 93

3. Add the primary antibody: A labeled primary antibody specific to the antigen is
added to the coated plate and allowed to bind to the immobilized antigen.
4. Wash the plate: The plate is washed to remove any unbound primary antibody.
5. Detect the signal: The signal is detected by adding the appropriate substrate for
the enzyme linked to the primary antibody, and measuring the resulting colori-
metric or fluorescent signal.

The intensity of the signal is proportional to the amount of antigen present in the
sample. Direct ELISAs are commonly used for the detection of viral or bacterial
antigens, as well as other proteins or small molecules. The main advantage of a direct
ELISA is that it is a simple and straightforward assay, with fewer steps and potential
sources of error compared to other ELISA formats. However, it may have lower
sensitivity than other types of ELISAs.

6.5.4.2 Indirect ELISA

Indirect ELISA is a type of ELISA that is used to detect the presence of antibodies
against a specific antigen in a sample. In an indirect ELISA, the antigen of interest is
immobilized on a solid support, such as a microtiter plate, and a primary antibody
specific to the antigen is used to capture the antigen (Kohl and Ascoli 2017). A
labeled secondary antibody, specific to the primary antibody, is then used for
detection. The intensity of the signal is proportional to the amount of antibodies
against the antigen present in the sample. Indirect ELISAs are commonly used for
the detection of antibodies in serum or other biological fluids, as well as for the
quantification of antigens that do not have suitable antibodies available for direct
detection. The main advantage of an indirect ELISA is that it is more sensitive than a
direct ELISA, due to the amplification of the signal by the secondary antibody.
However, it requires an additional step and can be more time consuming than a direct
ELISA.

6.5.4.3 Sandwich ELISA

Sandwich ELISA (enzyme-linked immunosorbent assay) is a type of ELISA that is
used to detect the presence of a specific antigen in a sample. In a sandwich ELISA,
two specific antibodies are used to sandwich the antigen of interest, which is
captured in between them (Kohl and Ascoli 2017). The intensity of the signal is
proportional to the amount of antigen present in the sample. Sandwich ELISAs are
commonly used for the detection and quantification of antigens in biological fluids,
such as serum or plasma. The main advantage of a sandwich ELISA is its specificity
and sensitivity, as it uses two antibodies to capture and detect the antigen, resulting
in a highly specific and sensitive assay.
94 A. R. Isukapatla et al.

6.6 Secondary Binding Assay

Secondary binding assays, also known as precipitation assays, are a type of immu-
noassay used to detect and quantify the presence of specific antigens in a sample.
These assays rely on the principle of antigen–antibody binding, which is the basis of
the immune response. In a precipitin-based secondary binding assay, a sample
containing the antigen of interest is mixed with an antibody specific to that antigen.
If the antigen is present in the sample, it will bind to the antibody to form an antigen–
antibody complex. The complex then reacts with a secondary antibody, which
recognizes and binds to the antigen–antibody complex.
The secondary antibody is usually labeled with a detectable marker, such as an
enzyme or a fluorescent dye, which enables the detection and quantification of the
complex. The antigen–antibody complex formed in the first step can also cause the
precipitation of the complex out of solution, hence the name precipitation assay. The
amount of precipitation can be used as an indirect measure of the amount of antigen
in the sample. Precipitin-based secondary binding assays are commonly used in
medical and veterinary diagnostics, food safety testing, and forensic investigations.
Examples of these assays include the radial immunodiffusion assay, the Ouchterlony
double diffusion assay, and the immunoelectrophoresis assay. These assays are
highly sensitive and specific, making them a valuable tool in a wide range of
applications.

6.6.1 Precipitin-Based Assays

6.6.1.1 Immunodiffusion
Immunodiffusion is a type of immunological technique used to detect and quantify
the presence of specific antigens or antibodies in a sample. It involves the diffusion
of an antigen and an antibody toward each other in a semi-solid medium, such as
agar, and the formation of a visible precipitate at the point where the antigen and
antibody react. There are two main types of immune diffusion techniques used in
forensic samples analysis.

6.6.1.2 Radial Immunodiffusion (RID)

This is a quantitative technique used to determine the concentration of a specific
antigen in a sample. In this technique, a known amount of antibody is incorporated
into an agar gel and a well is cut into the gel. The sample containing the antigen is
then added to the well, and the antigen diffuses out from the well and reacts with the
antibody in the gel. As the antigen diffuses outwards, a circular ring of precipitation
forms, and the diameter of the ring is proportional to the concentration of the antigen
in the sample.

6.6.1.3 Double Immunodiffusion

This technique, also known as the Ouchterlony method, is a qualitative technique
used to detect the presence of a specific antigen or antibody in a sample. In this
6 Serology Concept and Techniques 95

technique, two wells are cut into an agar gel, and a sample containing the antigen is
added to one well, while a sample containing the antibody is added to the other well.
The antigen and antibody diffuse outwards from their respective wells and react
when they meet in the gel, resulting in the formation of a visible precipitin line
between the two wells. The position and shape of the precipitin line can be used to
determine the specificity of the reaction and the presence of the antigen or antibody
in the sample. Immunodiffusion is a versatile and widely used technique in medical
and biological research, clinical diagnostics, and quality control testing in industries
such as food and pharmaceuticals. It is relatively simple to perform, requires
minimal equipment, and can be adapted for high-throughput screening of large
numbers of samples.

6.6.2 Immunoelectrophoresis (IEP)

IEP is a type of immunological technique used to separate and identify proteins

based on their size, charge, and antigenic properties. It combines electrophoresis, a
technique that separates molecules based on their charge, with immunological
detection using antibodies. In a typical IEP assay, a mixture of proteins is separated
by electrophoresis on a gel and then transferred to a membrane. Antibodies specific
to a particular protein of interest are then added to the membrane, and any proteins
that bind to the antibody are detected using a detection system, such as an enzyme-
linked immunosorbent assay (ELISA). Immunoelectrophoresis can be used to iden-
tify and quantify specific proteins in a sample, and can be used in clinical
diagnostics, research, and quality control testing. It is a relatively simple and cost-
effective technique, but requires some specialized equipment and expertise. Immu-
noelectrophoresis is a powerful technique for separating and detecting specific
proteins based on their antigenic properties (Shinomiya et al. 1978). When combined
with secondary binding assays such as ELISA, it can be used to detect and quantify
very small amounts of proteins in a sample. IEP can be performed using various
techniques, including single and double radial immunodiffusion, rocket immuno-
electrophoresis, crossed immunoelectrophoresis, and electroimmunodiffusion.
These techniques differ in the way the proteins are separated and the way the
antibodies are applied.

6.6.2.1 Rocket Immunoelectrophoresis

This is a variation of immunoelectrophoresis, a technique used to separate and
identify proteins based on their size, charge, and antigenic properties. In rocket
immunoelectrophoresis, the antigen and antibody are separated by electrophoresis in
a gel, and the resulting precipitin line takes on the shape of a rocket. To perform
rocket immunoelectrophoresis, a sample containing the antigen of interest is mixed
with a specific antibody, and the mixture is loaded into a well cut into an agarose gel
(Walker 1996). An electric field is then applied to the gel, causing the antigen and
antibody to migrate toward the anode. As they migrate, the antigen and antibody
form a complex, which precipitates out of the solution to form a visible line. The
96 A. R. Isukapatla et al.

precipitin line takes on the shape of a rocket due to the way the antigen and antibody
are distributed in the gel. The antigen is located in the center of the rocket, while the
antibody is distributed around the periphery of the rocket. The height of the rocket is
proportional to the concentration of the antigen in the sample. The rocket can be
visualized by staining the gel with a suitable dye, and the height of the rocket can be
measured to determine the concentration of the antigen in the sample. Rocket
immunoelectrophoresis is a relatively simple and inexpensive technique, and can
be used to detect and quantify specific antigens in a wide range of biological
samples. It has been used in clinical diagnostics, research, and quality control
testing, and is particularly useful for detecting small changes in antigen concentra-
tion over time.

6.6.2.2 Crossed Immunoelectrophoresis

Crossed immunoelectrophoresis is another variation of immunoelectrophoresis, a
technique used to separate and identify proteins based on their size, charge, and
antigenic properties. In crossed immunoelectrophoresis, two-dimensional separation
of the antigen and antibody is achieved by performing electrophoresis in two
different directions. To perform crossed immunoelectrophoresis, a sample
containing the antigen of interest is loaded onto a gel and allowed to electrophorese
in one direction (Tuller and Saunders 2012). Once the antigen has been separated
from other proteins in the sample, an antibody specific to the antigen is added to the
top of the gel. Electrophoresis is then performed perpendicular to the initial direction
of separation, causing the antigen–antibody complex to migrate toward the cathode.
As the antigen–antibody complex migrates across the gel, it forms a visible line of
precipitation, which can be visualized by staining the gel with a suitable dye. The
position and intensity of the line are used to identify and quantify the antigen in the
sample. Crossed immunoelectrophoresis is a highly sensitive technique that can
detect small amounts of antigens in a sample. It is also relatively simple and
inexpensive, making it a popular technique in clinical diagnostics, research, and
quality control testing. However, it requires specialized equipment and expertise to
perform and can be time consuming.

6.6.2.3 Electro Immunodiffusion

Electroimmunodiffusion is a technique used to identify and quantify specific
proteins in a sample based on their antigenic properties. It is a variation of immuno-
diffusion, a technique that involves the diffusion of antigens and antibodies through
a semisolid medium such as agarose gel. In electroimmunodiffusion, a sample
containing the protein of interest is loaded onto a well cut into an agarose gel, and
an antibody specific to the protein is added to the gel. An electric field is then applied
to the gel, causing the antigen and antibody to diffuse through the gel and form a
precipitin line (Sweet and Elvins 1976). The precipitin line forms at the point where
the antigen and antibody are in equivalence, and its shape and size are used to
identify and quantify the antigen in the sample. The line can be visualized by
staining the gel with a suitable dye, and its position and intensity can be measured
to determine the concentration of the antigen in the sample. Electroimmunodiffusion
6 Serology Concept and Techniques 97

is a relatively simple and cost-effective technique that can be used to detect and
quantify specific proteins in a wide range of biological samples. It is particularly
useful for detecting and characterizing antigens with low molecular weights, and has
been used in clinical diagnostics, research, and quality control testing. However, it
requires some specialized equipment and expertise to perform and can be time
consuming.

6.6.3 Agglutination-Based Assays

Agglutination-based assays are a type of immunoassay that detects the presence or

absence of a specific antigen in a sample by causing agglutination or clumping of
particles. These assays are based on the principle of antigen–antibody interactions,
where specific antibodies bind to their corresponding antigens and cause agglutina-
tion. Agglutination assays can be performed in a variety of formats, such as slide
agglutination, tube agglutination, and microplate agglutination. In slide and tube
agglutination assays, a sample containing the antigen is mixed with a specific
antibody and the mixture is allowed to settle. If the antigen is present in the sample,
it will bind to the antibody and cause clumping or agglutination of the particles. In
microplate agglutination assays, a sample is added to a microplate containing wells
coated with a specific antibody. The antigen in the sample binds to the antibody and
causes agglutination of the particles, which can be visualized by turbidity or color
change.
Agglutination assays are commonly used in clinical and diagnostic settings to
detect and quantify a wide range of analytes, including infectious agents, hormones,
and blood group antigens. They are also used in food safety and environmental
testing to detect the presence of contaminants or toxins. The advantages of aggluti-
nation assays include their simplicity, speed, and low cost. They can be performed
using minimal equipment and do not require complex instrumentation or specialized
expertise. However, their sensitivity and specificity can be affected by factors such
as the concentration and purity of the sample, the quality of the antibody, and the
presence of interfering substances in the sample. There are several types of
agglutination-based assays, each with different formats and applications. Some of
the most common agglutination-based assay types are as follows:

6.6.3.1 Direct Agglutination Assay

A direct agglutination assay is a type of agglutination-based assay that involves the
direct binding of an antibody to the target antigen. The antibody used in this assay is
specific to the target antigen, and when the antigen is present in the sample, it binds
to the antibody, leading to visible agglutination or clumping of the particles. In a
direct agglutination assay, the sample is mixed with a specific antibody, and the
mixture is allowed to settle. If the antigen of interest is present in the sample, it will
bind to the antibody, causing visible agglutination or clumping of the particles. The
degree of agglutination is typically proportional to the concentration of the antigen in
the sample.
98 A. R. Isukapatla et al.

6.6.3.2 Indirect Agglutination Assay

An indirect agglutination assay is a type of agglutination-based assay that involves
the use of a secondary particle coated with the antigen or antibody of interest. The
primary antibody or antigen is then added to the mixture, causing agglutination or
clumping of the secondary particles. In an indirect agglutination assay, the secondary
particle, such as latex beads or erythrocytes, is coated with the antigen or antibody of
interest. The sample containing the complementary antibody or antigen is added to
the mixture, causing agglutination of the secondary particles. The degree of aggluti-
nation is proportional to the concentration of the target antigen or antibody in the
sample.

6.6.3.3 Hemagglutination Assay

Hemagglutination assay is a type of agglutination-based assay that uses red blood
cells (RBCs) as the secondary particle. Hemagglutination is the clumping of RBCs
caused by the binding of antibodies to specific antigens on the surface of the cells. In
a hemagglutination assay, RBCs are mixed with a known antigen or antibody. If the
complementary antibody or antigen is present in the sample, it will bind to the RBCs,
causing visible agglutination or clumping of the cells. The degree of agglutination is
typically proportional to the concentration of the antigen or antibody in the sample.

6.6.3.4 Particle Agglutination Assay

Particle agglutination assay is a type of agglutination-based assay that uses particles
such as latex beads, gold nanoparticles, or magnetic beads as the secondary particle.
The particles are coated with a specific antigen or antibody and mixed with the
sample containing the complementary antibody or antigen. If the target analyte is
present in the sample, it will bind to the coated particles, causing visible agglutina-
tion or clumping. The particle agglutination assay is simple, rapid, and highly
sensitive, making it a useful tool in clinical and diagnostic settings. It does not
require specialized equipment or expertise, and can be performed using a small
amount of sample.

6.7 Conclusion

Forensic serology plays a crucial role in criminal investigations by providing

valuable information about the bodily fluids found at the crime scene. The
conclusions drawn from forensic serology can help identify suspects, confirm or
refute alibis, and provide crucial evidence for the prosecution in court.
Immunoassays are analytical methods that use antibodies to detect the presence of
specific molecules in bodily fluids. In forensic science, immunoassays have been
widely used for the detection of drugs, poisons, and other substances in biological
samples. ELISA is a type of immunoassay that is widely used in forensic science for
the detection and quantification of drugs, hormones, and other biomolecules in
biological samples.
6 Serology Concept and Techniques 99

References
Abraham P, Babu PG, John TJ (1994) Comparison of the indirect immunofluorescence assay with
western blot for the detection of HIV antibody. Indian J Med Res 99:143–148
Chaplin DD (2010) Overview of the immune response. J Allergy Clin Immunol 125(2):S3–S23
Engvall E (2010) The ELISA, enzyme-linked immunosorbent assay. Clin Chem 56(2):319–320
Findlay JWA (2008) Specificity and accuracy data for ligand-binding assays for macromolecules
should be interpreted with caution. AAPS J 3:433–434. https://doi.org/10.1208/s12248-008-
9047-2
Hamers-Casterman CTSG, Atarhouch T, Muyldermans SA, Robinson G, Hammers C, Songa EB,
Hammers R (1993) Naturally occurring antibodies devoid of light chains. Nature 363(6428):
446–448
Im K, Mareninov S, Diaz MFP, Yong WH (2019) An introduction to performing immunofluores-
cence staining. Biobanking 1897:299–311
Ito E, Iha K, Yoshimura T, Nakaishi K, Watabe S (2021) Early diagnosis with ultrasensitive ELISA.
Adv Clin Chem 101:121–133
Kohl TO, Ascoli CA. Immunometric double-antibody sandwich enzyme-linked immunosorbent
assay. Cold Spring Harb Protoc. 2017 2017(6):pdb.prot093724
Konstantinou GN (2017) Food allergens. Methods molecular biology. In: Lin J, Alcocer M (eds)
Enzyme-linked immunosorbent assay (ELISA), vol 1592. Humana Press, New York, NY
Lowenstein JM, Reuther JD, Hood DG, Scheuenstuhl G, Gerlach SC, Ubelaker DH (2006)
Identification of animal species by protein radioimmunoassay of bone fragments and blood-
stained stone tools. Forensic Sci Int 159(2–3):182–188
Mohamed Abd El-Aziz T, Soares AG, Stockand JD (2019) Snake venoms in drug discovery:
valuable therapeutic tools for life saving. Toxins 11(10):564
Neuberger MS, Milstein C (1995) Somatic hypermutation. Curr Opin Immunol 7(2):248–254
Neurath AR (2008) Immune response to viruses: antibody-mediated immunity. Encyclopedia Virol
56–70. https://doi.org/10.1016/B978-012374410-4.00591-4. Epub 2008 Jul 30. PMCID:
PMC7149652
Old JB, Schweers BA, Boonlayangoor PW, Reich KA (2009) Developmental validation of
RSID™-saliva: a lateral flow immunochromatographic strip test for the forensic detection of
saliva. J Forensic Sci 54(4):866–873
Reverberi R, Reverberi L (2007) Factors affecting the antigen-antibody reaction. Blood Transfus
5(4):227
Schittek B, Hipfel R, Sauer B, Bauer J, Kalbacher H, Stevanovic S, Garbe C (2001) Dermcidin: a
novel human antibiotic peptide secreted by sweat glands. Nat Immunol 2(12):1133–1137
Shah K, Maghsoudlou P (2016 Jul) Enzyme-linked immunosorbent assay (ELISA): the basics. Br J
Hosp Med (Lond) 77(7):C98–C101
Shinomiya T, Muller M, Muller PH, Lesage R (1978) Immunoelectrophoresis used for identifica-
tion of blood stains in forensic medicine. Forensic Sci Int 12(2):157–163
Silverstein AM (1995) The historical origins of modern immunology. In: Immunology. Academic
Press, London, pp 5–20
Stavnezer J, Guikema JE, Schrader CE (2008) Mechanism and regulation of class switch recombi-
nation. Annu Rev Immunol 26:261–292
Sweet GH, Elvins JW (1976) Studies by crossed electroimmunodiffusion on the individuality and
sexual orgin of bloodstains. J Forensic Sci 21(3):498–509
Tang AF, Enyindah-Asonye G, Hioe CE (2021) Immune complex vaccine strategies to combat
HIV-1 and other infectious diseases. Vaccine 2021(9):112
Tuller H, Saunders R (2012) The use of crossover immunoelectrophoresis to detect human blood
protein in soil from an ambush scene in Kosovo. J Forensic Sci 57(4):873–879
Walker JM (1996) The protein protocols handbook. Springer protocols handbooks. In: Walker JM
(ed) Rocket Immunoelectrophoresis. Humana Press. https://doi.org/10.1007/978-1-60327-259-
9_137
Identification of Semen
7
Anuj Bharadwaj and Tanya Chauhan

Abstract

Semen is very important evidence in sexual assault cases. It is produced in post-

pubescent males and is ejaculated in response to sexual stimulation. Clothes,
beddings, and the victim’s body are common places where semen stains can be
found in sexual assault cases. Its detection on evidence can help in confirming the
involvement of a male perpetrator in the crime. It can also help in establishing
penile penetration in sexual assault cases. Semen is a rich source of DNA as
spermatozoa are the source of genetic information from one generation to another
generation. Therefore, if DNA is successfully isolated, it can help in the individ-
ual identification of the perpetrator.

Keywords

Spermatozoa · Alkaline phosphatase · Presumptive · Confirmative test

Semen is very important evidence in sexual assault cases. It is produced in post-

pubescent males and is ejaculated in response to sexual stimulation. Clothes,
beddings, and the victim’s body are common places where semen stains can be
found in sexual assault cases. Its detection on evidence can help in confirming the
involvement of a male perpetrator in the crime. It can also help in establishing penile
penetration in sexual assault cases. Semen is a rich source of DNA as spermatozoa
are the source of genetic information from one generation to another generation.

A. Bharadwaj (✉)
CFSL Chandigarh, Chandigarh, India
T. Chauhan
Department of Forensic Science, National Forensic Science University Delhi Campus
(LNJN NICFS), New Delhi, Delhi, India

# The Author(s), under exclusive license to Springer Nature Singapore Pte 101
Ltd. 2024
A. Puri et al. (eds.), Fundamentals of Forensic Biology,
https://doi.org/10.1007/978-981-99-3161-3_7
102 A. Bharadwaj and T. Chauhan

Therefore, if DNA is successfully isolated, it can help in the individual identification

of the perpetrator.
Therefore, it is very important to identify the semen stain. Various presumptive
and confirmatory tests are performed to identify the semen stain based on different
components of semen. First, the stain is located and identified visually by naked eyes
or using an alternate light source. If not visible, the stain is subjected to a presump-
tive test like the prostatic acid phosphatase test. If the result for the presumptive test
is positive, then the stain is subjected to confirmatory tests. The presence of
spermatozoa in the questioned stain will confirm the stain to be semen stain. Other
methods like immunochromatographic methods and ELISA are helpful if the perpe-
trator has low or no sperm present in his semen. RNA-based methods have also been
developed to detect semen.

7.1 Composition

Semen is a thick viscous liquid. A healthy human male can release 2–6 mL of semen
per ejaculation. It is heavier than water, and its density ranges between 1.027 and
1.037. It is weakly alkaline. Semen is composed of sperm cells, amino acids, sugars,
lipids, enzymes, proteins, and flavonoids. Semen can be divided into sperm cells and
seminal fluid. Seminal fluid is a mixture of glandular secretion. It helps in providing
nourishment to sperm cells. The contributors to seminal fluids are as follows:

• Seminal vesicle fluid—It is 60% of seminal fluid. Semenogelin is present in it,

which plays role in the coagulation of semen. It also consists of flavin which
causes fluorescence under UV in semen.
• Prostatic fluid—It is 30% of seminal fluid. It consists of prostatic acid phospha-
tase and prostate-specific antigen. These two are very useful for semen identifica-
tion in a forensic lab.
• Epididymis and Bulbourethral or Cowper’s gland each contribute 5% to the
seminal fluid (Fig. 7.1).

The normal sperm cell count in a healthy human male is 107–108 spermatozoa per
mL of semen. But there could be a reduction in the number of sperm cells produced.
Multiple factors affect the sperm cell count. Some of them are as follows:

• Certain medical conditions like azoospermia (no spermatozoa) and oligospermia

(abnormally low sperm count). It must be noted that seminal fluid is still secreted
in these individuals.
• Genetic disorder.
• Alcohol and drug abuse.
7 Identification of Semen 103

Vas deferens

Urinary
Seminal
bladder
Prostate vesicle

Ejaculatory
Urethra
duct

Cowper
Penis glands
Epididymis

Rete testis + seminiferous tubules

testis

Fig. 7.1 Human male reproductive tract

• Prolonged exposure to certain chemicals.

• Surgical procedure—vasectomy.1

7.1.1 Acid Phosphatase (AP)

These are a group of phosphatases that are active at an acidic pH. Acid phosphatases
are ubiquitous enzymes; they are also present in mammalian liver and cauliflower
stem juice. Semen has a higher concentration of acid phosphatase than other body
parts and plant tissues. Acid phosphatase released by the prostate gland has a major
contribution to acid phosphatase activity in semen. At the time of puberty, a large-
scale synthesis of acid phosphatase is done by epithelial cells of the prostate gland.
After the age of 40, the acid phosphatase level starts decreasing. The level of acid
phosphatase in semen is unaffected by the vasectomy procedure. Also, there is no
correlation between acid phosphatase level and the number of spermatozoa in the
semen. There is no variation between the level of prostatic acid phosphatase in a
male with normal sperm count and a clinically infertile male. The half-life of acid
phosphatase is 6 months at 37 °C, but in wet conditions, the half-life will decrease. If
a semen stain is dried and stored at -20 °C, AP can be detected for 1 year. It is also
used in the screening of prostatic carcinoma as a high level of prostatic acid
phosphatase is detected in the serum of a person suffering from prostatic carcinoma.

7.1.2 Prostate-Specific Antigen (PSA)

Prostate-specific antigen is the major protein present in seminal fluid, approximately

0.5–2.0 mg/mL. It is produced by androgen stimulated epithelial cells of the prostate

1
In vasectomy, bilateral segment of vas deference is removed which prevent spermatozoa from
reaching distal parts of male reproductive tract.
104 A. Bharadwaj and T. Chauhan

gland and secreted into semen. It is also found in paraurethral, perianal, apocrine
sweat, and mammary glands. Therefore, a small quantity of PSA is also detected in
urine, faecal material, sweat, and milk. It is also present in the bloodstream in a lower
concentration. An elevated level of PSA in plasma indicates prostate cancer.
The molecular weight of PSA is 30 kDa; therefore, it is also known as P30. At
room temperature, the half-life of PSA is 3 years which is greatly reduced if the stain
is in wet condition. The PSA is responsible for hydrolysing Semenogelin.2

7.1.3 Seminal Vesicle-Specific Antigen (SVSA)

There are two types of SVSAs: Semenogelin I (SG I) and Semenogelin II (SG II). It
forms a coagulum which is hydrolysed in minutes by PSA. Both SG I and SG II are
present in the following tissue of the male reproductive system:

• Seminal vesicles
• Ductus deference
• Prostate gland
• Epididymis

These are also present in the following tissues of the following organs:

• Skeletal muscles
• Colon
• Trachea
• Kidney

Their presence in sera of lung indicates lung cancer in the individual. In seminal
fluid, concentration of SVSA is higher than PSA. Also, unlike PSA, it is not present
in urine, milk, and sweat. Therefore, it is a better indicator of the presence of semen
than PSA.

7.2 Spermatozoa

Spermatozoa (spermatozoon sin.) are male reproductive cells. They are flagellated
structures approximately 55 μm in length. They are produced in seminiferous tubules
of testes of post-pubescent males. The process is known as spermatogenesis. The
approximate length of spermatozoa is 50 μm. In spermatogenesis, spermatogonia
differentiate into spermatids and these spermatids differentiate into spermatozoa.
These spermatozoa get transferred to the epididymis and undergo maturation.

2
Semenogelin is responsible for gel formation in semen.
7 Identification of Semen 105

Acrosome Axial filament

Plasma membrane
Nucleus Mitochondria
Centriole
Flagellum

Head Mid-piece Tail End

piece

Fig. 7.2 Spermatozoon

During ejaculation, they travel through ductus deference or vas deference, ejacula-
tory duct, and ultimately prostatic urethra.
A spermatozoon has three morphologically distinct structures:

• Head—It is an ovoid which is 4.5 μm in length, 2.5 μm in width, and 1.5 μm in

thickness. It contains a haploid nucleus at its centre and is capped with acrosome.
Acrosome contains enzymes required for fertilization.
• Middle piece—It contains mitochondria, these mitochondria generate the energy
required for moving the tail of a sperm cell.
• Tail—It is 90% of the total length of a spermatozoon. It provides motility to the
spermatozoon. The tail loses its motility within 3–6 h of ejaculation and easily fall
off (Fig. 7.2).

Certain cell organelles like endoplasmic reticulum, Golgi apparatus, lysosome,

and peroxisome are absent in a mature spermatozoon. In an ejaculate, approximately
60% of spermatozoa are morphologically normal but morphological abnormalities
are also very common. It must be noted that the human sperm cell is morphologically
distinct from the animal sperm cell. Therefore, it is possible to identify species of
semen through microscopical examination (Fig. 7.3).

7.3 Presumptive Assay for Identification

7.3.1 Visual Identification

It is easy to identify semen stains on a piece of fabric if there is a high volume of

semen, and the fabric is unwashed because the stain exhibits a stiff and crusty
appearance. Depending upon the colour and thickness of substrate, the semen stain
appears translucent or opaque spots with a yellowish tint to the naked eyes. The dried
semen stain can also be visualised under an alternating light source (ALS) at
450–495 nm with orange filtered goggles. Semen stains fluoresce more intensely
than other body fluids. The fluorescence is due to flavins present in human semen.
The intensity of fluorescence can be affected by the substrate. Sometimes, the semen
106 A. Bharadwaj and T. Chauhan

Fig. 7.3 Spermatozoa of different organisms

stain does not fluoresce because of certain dyes present in the fabric. If suspected
stain fluoresces under UV, then it is subjected to an AP test (Figs. 7.4 and 7.5).
7 Identification of Semen 107

Fig. 7.4 Semen stain on light

colour fabric

Fig. 7.5 Semen stain on dark

colour fabric

7.3.2 AP Detection Through Colorimetric Assay

Acid phosphatase can hydrolyse a variety of esters. It catalyses the removal of a

phosphate group from the substrate. The enzyme shows optimal activity at pH 7. In
presence of stabilized diazonium salt, an insoluble coloured precipitate is formed at
the site of the AP activity. To reduce the interference from non-prostatic acid
phosphatase isoenzymes, prostatic acid phosphatase specific substrates like alpha
naphthyl phosphate or thymolphthalein monophosphate are used. These substrates
are readily hydrolysed by prostatic acid phosphatase and slowly hydrolysed by other
acid phosphatase isoenzymes.
108 A. Bharadwaj and T. Chauhan

Phosphate monoester þ Acid Phosphatase → Phosphate group þ Alcohol

If alpha naphthyl phosphate is used as the substrate, then the following reaction
takes place:

α naphthyl phosphate þ Prostatic Acid Phosphatase → Phosphate group

þ α naphtol

This alpha naphthol reacts with brentamine fast blue B (stabilized diazonium salt)
and forms a purple colour azo dye:

α naphtol þ Brentamine Fast Blue B → Azo dyeðPurple colourÞ

In a forensic lab, the test is performed in the following way:

As acid phosphatse is soluble in aqueous

media, moist filter paper/cotton swab is
rubbed over suspected stain

Add alpha naphthyl phosphate and

Brentamine Fast Blue B

Intense purple color within 2 minutes

indicates semen may be present

Result in discussion: If there is no purple colouration within 2 min, it indicates a

negative result. While performing the test, one must note the intensity and time taken
to develop the colour. Other body fluids like vaginal secretion, perspiration, faeces,
or urine may give a positive reaction after a minute or so. The combination of these
fluids can be found in the crotch area of undergarments.

7.3.3 AP Detection Through Fluorometric Assay

This method is more sensitive than the colourimetric method. It is also used for
mapping the dimensions and orientation of semen stain. The substrate used in this
method is 4-methylumbelliferonne phosphate (MUP).
7 Identification of Semen 109

4‐methylumbelliferone phosphate þ Acid Phosphatase → 4‐methylumbelliferone

þ Phosphate group

The 4-methylumbelliferone fluoresce under long-wave UV radiation. This test is

performed in the following way:

Press moist filter paper on the suspected

area

Lift the paper and examine it in a dark

room under long wave UV radiation to
detect and mark background fluorescence

Spray MUP on the paper in fume hood

and again observe under long wave UV
radiation

Immediate AP reaction indicates semen

may be present

7.4 Confirmatory Assay for Identification

7.4.1 Microscopic Examination

Finding spermatozoa in the suspected stain under the microscope is a confirmation

that the questioned stain is of semen. For microscopic examination, first, the stain is
extracted out of the fabric on the glass slide and suitable staining methods is used to
differentiate spermatozoa from the background.
There are two ways to prepare the semen extract. One method is to damp the
stained area with sterile water and rub or roll it over a microscopic slide. Another
method is to cut the stained area, dip it in sterile water, gently vortex it and transfer
the liquid on a microscopic slide, evaporate the liquid at room temperature, or fix the
slide at low heat.
110 A. Bharadwaj and T. Chauhan

Fig. 7.6 Christmas tree

staining of spermatozoa

Christmas tree staining is the most popular staining method for staining
spermatozoa in forensic labs. In this method, nuclear fast red (NFR) and
picroindigocarmine (PIC) are used. After staining, the slide is observed under the
microscope, if spermatozoa are present, acrosomal cap and nucleus will appear pink-
red, the tail and midpiece will appear blue-green, and epithelial cells will appear
blue-green with red nuclei (Fig. 7.6).
SPERM HY-LITER Fluorescent Staining Kit is another method used to
fluorescently detect spermatozoa.
Laser Capture Microdissection (LCM) is an advanced technique used to isolate
spermatozoa from epithelial cells of the victim on a glass slide. In this technique, a
thin layer of thermosensitive polymer is used. This layer is present on the tip of
LCM. After spermatozoa are identified under the microscope, the LCM tip is placed
over the area and the polymer layer is melted by an infrared laser. The sealed
spermatozoa are lifted off the slide and placed in separate tubes for DNA analysis.

7.4.2 Identification Through PSA

7.4.2.1 Immunochromatographic Assay

Commercial kits like PSA-Check-1 (VED-LAB), Seratec PSA Semiquant (Seratec
Diagnostica), and One-step ABAcard PSA (Abacus Diagnostic) are used for
immunochromatographic identification of PSA. These kits use anti-human PSA
antibodies. In the ABAcard method, there are three zones named sample well, test
zone, and control zone present on a nitrocellulose membrane. In the sample well,
labelled monoclonal anti-human PSA antibodies are present. In the test zone,
immobilized polyclonal anti-human PSA antibodies are present. And in the control
zone, antiglobulin is present.
A drop of the semen stain extract is loaded in the sample well, the antigen of
semen positive sample binds to antibody present in the sample well and make an
antigen-antibody complex. This complex diffuses through the membrane and
7 Identification of Semen 111

Fig. 7.7 ABA card for

P30 test

reaches the test zone. In the test zone, this complex binds to monoclonal anti-human
PSA antibody and make another complex of antibody-antigen-antibody. The
ABAcard uses pink dye for a positive result. Therefore, a pink line is formed at
the test zone for the positive sample. When unbound labelled monoclonal antihuman
PSA antibodies reach the control region, they bind to antiglobulin. Here also, a pink
line is formed (Fig. 7.7).
If a sample contains PSA, then a pink line will be formed at the test zone as well
as at the control zone within a minute. A pink line only at the control zone indicates a
negative result. Artefacts may appear if a high quantity of seminal fluid is tested.

7.4.2.2 ELISA
Enzyme-Linked Immunosorbent Assay (ELISA) technique is used to detect PSA
with the help of anti-PSA antibodies. Here, sandwich ELISA is the most commonly
used. Multiple samples can be tested at the same time using a 96-well titre plate.
Wells of this plate are coated with polystyrene, and anti-PSA antibodies are
immobilised in these wells. When a sample containing PSA is added to the well, it
forms a complex with immobilised anti-PSA antibody. In the next step, secondary
anti-PSA-antibody is added to the mix which results in an antibody-antigen-antibody
sandwich. In the final step, labelled antiglobulin which is specific to secondary anti-
PSA antibody is added. Detection can be made through either fluorometric or
colorimetric techniques based on the label used with antiglobulin (Fig. 7.8).
The amount of PSA can also be quantified in this method by comparing a
standard with a known concentration. This method is very specific and sensitive
but quite time-consuming.
112 A. Bharadwaj and T. Chauhan

Fig. 7.8 Antibody-Antigen-Antibody Sandwich ELISA technique for P30

7.4.3 Identification Through SVSA

7.4.3.1 Immunochromatographic Assay

Commercial kits like RSID Semen Test (Independent Forensics) and Nanotrap Sg
are available for SVSA detection. The RSID semen test is commonly used. The
method is similar to ABAcard. But in the RSID method, the sample well contains
monoclonal anti-SG antibodies, the test zone also contains immobilized monoclonal
anti-Sg antibodies but for a different epitope of SVSA, and the control zone contains
antiglobulin. A positive sample of semen will result in a pink line at the test zone and
the control zone in 10 min.
The advantages of using this method are that it is highly sensitive, no species
cross-reactivity has been observed, not responsive to other body fluids, and the result
is not affected by condom lubricants or spermicides. But similar to the ABAcard
method for PSA, a high dose hook effect occurs at a concentration above 3 μL.

7.4.3.2 ELISA
Similar to ELISA for PSA, the sandwich ELISA technique can also be used for the
detection of SVSA. Anti-Sg antibodies are used. In ELISA for SVSA, anti-Sg
antibodies are immobilised on polystyrene coated tubes. A semen positive sample
when added to the tube, the SVSA in semen forms a complex with immobilised anti-
Sg antibody. In the next step, secondary anti-Sg-antibody which is specific for an
epitope different from the primary anti-Sg antibody is added to the mix which results
in an antibody-antigen-antibody sandwich. Finally, a labelled antiglobulin which is
specific to the secondary anti-Sg antibody is added. Based on the label used on
antiglobulin colorimetric or fluorometric signals are generated which are detected
using a spectrophotometer. The intensity of the signal detected by the spectropho-
tometer is proportional to the quantity of the antigen. The antigen can also be
quantified by comparing the standard with known concentration (Fig. 7.9).
7 Identification of Semen 113

Fig. 7.9 Antibody-Antigen-

Antibody Sandwich ELISA
technique for SVSA

Table 7.1 Genes used for RNA-based semen detection

Gene Description
Protamine 1 (PRM1) DNA binding protein involved in condensation of spermatozoa
chromatin
Protamine 2 (PRM2) DNA binding protein involved in condensation of spermatozoa
chromatin
Semenogelin Seminal vesicle specific antigen
1 (SEMG1)

7.4.4 RNA-Based Detection

It is a new method of semen detection. In RNA-based method, expression of specific

mRNA is detected using the RT-PCR technique. These mRNAs are exclusive to
spermatozoa and cells of the male reproductive tract. The RNA-based method is
highly specific and can be automated. But the only limitation is that RNA is easily
degraded by endogenous ribonucleases. Following is the list of tissue specific genes
which are utilised for RNA-based detection of semen (Table 7.1):

Further Reading
Ablett P (1983) The identification of the precise conditions for seminal acid phosphatase (SAP) and
vaginal acid phosphatase (VAP) separation by isoelectric focusing patterns. J Forensic Sci Soc
23:254–256
Allen SM (1995) An enzyme linked immunosorbent assay (ELISA) for detection of seminal fluid
using a monoclonal antibody to prostatic acid phosphatase. J Immunoassay 16(3):297–308
114 A. Bharadwaj and T. Chauhan

Allery JP, Telmon N, Mieusset R, Blanc A, Rougé D (2001) Cytological detection of spermatozoa:
comparison of three staining methods. J Forensic Sci 46(2):349–351
Anoruo B, van Oorschot R, Mitchell J, Howells D (2007) Isolating cells from non-sperm cellular
mixtures using the PALM microlaser micro dissection system. Forensic Sci Int 173(2–3):93–96
Baxter SJ (1973) Immunological identification of human semen. Med Sci Law 13(3):155–165
Blake ET, Sensabaugh GF (1976) Genetic markers in human semen: a review. J Forensic Sci 21(4):
785–796
Boward ES, Wilson SL (2013) A comparison of ABAcard(®) p30 and RSID™-Semen test kits for
forensic semen identification. J Forensic Leg Med 20(8):1126–1130
Chapman RL, Brown NM, Keating SM (1989) The isolation of spermatozoa from sexual assault
swabs using proteinase K. J Forensic Sci Soc 29(3):207–212
Chen JT, Hortin GL (2000) Interferences with semen detection by an immunoassay for a seminal
vesicle-specific antigen. J Forensic Sci 45(1):234–235
Davies A, Wilson E (1974) The persistence of seminal constituents in the human vagina. Forensic
Sci 3(1):45–55
Di Martino D, Giuffrè G, Staiti N, Simone A, Le Donne M, Saravo L (2004) Single sperm cell
isolation by laser microdissection. Forensic Sci Int 146(suppl):S151–S153
Engelbertz F, Korda JB, Engelmann U, Rothschild M, Banaschak S (2010) Longevity of
spermatozoa in the post-ejaculatory urine of fertile men. Forensic Sci Int 194(1–3):15–19
Herman Y, Feine I, Gafny R (2018) Acid phosphatase test on Phadebas® sheets - an optimized
method for presumptive saliva and semen detection. Forensic Sci Int 288:218–222
Hueske EE (1977) Techniques for extraction of spermatozoa from stained clothing: a critical
review. J Forensic Sci 22(3):596–598
James SH, Nordby JJ, Bell S (2014) Forensic science an introduction to scientific and investigative
techniques. CRC Press, Boca Raton
Lewis J, Baird A et al (2013) Improved detection of semen by use of direct acid phosphatase testing.
Sci Justice 53:385–394
Li R (n.d.) Forensic biology. CRC Press, Boca Raton
Nolan A, Speers SJ, Murakami J, Chapman B (2018) A pilot study: the effects of repeat washing
and fabric type on the detection of seminal fluid and spermatozoa. Forensic Sci Int 289:51–56
O’Leary KR, Glynn CL (2018) Investigating the isolation and amplification of microRNAs for
forensic body fluid identification. MicroRNA (Shariqah, United Arab Emirates) 7(3):187–194
Parikh D (2014) Parikh’s textbook of medical jurisprudence forensic medicine and toxicology.
CBS, New Delhi
Park JL, Park SM, Kim JH, Lee HC, Lee SH, Woo KM, Kim SY (2013) Forensic body fluid
identification by analysis of multiple RNA markers using nanostring technology. Genomics
Inform 11(4):277–281
Rao NG (2010) Textbook of forensic medicine & toxicology. JAYPEE, New Delhi
Saferstein R (2018) Criminalistics an introduction to forensic science. Pearson, London
Sakurada K, Ikegaya H, Fukushima H, Akutsu T, Watanabe K, Yoshino M (2009) Evaluation of
mRNA-based approach for identification of saliva and semen. Leg Med (Tokyo) 11(3):125–128
Sakurada K, Watanabe K, Akutsu T (2020) Current methods for body fluid identification related to
sexual crime: focusing on saliva, semen, and vaginal fluid. Diagnostics (Basel, Switzerland)
10(9):693
Sehgal V (2018) Forensic science in criminal investigation & court evidence. Selective & Scientific
Books, New Delhi
Sharma B (2016) Forensic science in criminal investigation. Universal Law Publishing, New Delhi
Singh I (2011) Textbook of human histology. JAYPEE, New Delhi
Suttipasit P (2019) Forensic spermatozoa detection. Am J Forensic Med Pathol 40(4):304–311
Tian H, Lv M, Li Z, Peng D, Tan Y, Wang H, Li Q, Li F, Liang W (2018) Semen-specific miRNAs:
Suitable for the distinction of infertile semen in the body fluid identification? Forensic Sci Int
Genet 33:161–167
7 Identification of Semen 115

Tian H, Huang S, Bai P, Xiao X, Peng D, Zhao H, Liu Y, Feng Q, Liao M, Li F, Liang W (2021)
The effect of infertile semen on the mRNA-based body fluid identification. Electrophoresis
42(16):1614–1622
Virkler K, Lednev IK (2009) Analysis of body fluids for forensic purposes: from laboratory testing
to non-destructive rapid confirmatory identification at a crime scene. Forensic Sci Int 188(1–3):
1–17
Wang Z, Zhang SH, Di Z, Zhao SM, Li CT (2013) Messenger RNA profiling for forensic body fluid
identification: research and applications. Fa Yi Xue Za Zhi 29(5):368–374
Westring CG, Wiuf M, Nielsen SJ, Fogleman JC, Old JB, Lenz C, Reich KA, Morling N (2014)
SPERM HY-LITER™ for the identification of spermatozoa from sexual assault evidence.
Forensic Sci Int Genet 12:161–167
Introduction to Saliva and Its Forensic
Analysis 8
Aditya Kumar Kar, Radha Patel, and Ankit Debnath

Abstract

Saliva is a complex biological, extracellular fluid secreted by acinar cells of the

major and minor salivary glands. Saliva has been an important piece of forensic
evidence in cases of molestation, and drug/alcohol intake, for DNA profiling
without the suspect knowing because of its ease of availability and non-invasive
collection method. The analysis of saliva is also quite cost-effective, adding to the
reason for saliva being a very preferred medium of choice in forensic/criminal
investigation among all bodily fluids.
Tests for identification include preliminary and confirmatory tests. A prelimi-
nary test can provide possibilities of the presence of saliva at the crime scene
while a confirmatory test can identify a specific genetic material.
Analysis of saliva can shed light on a person’s physiological and psychologi-
cal conditions, providing information about eating habits, behaviors,
abnormalities, and even sex and age.

Keywords
Extracellular · Salivary glands · Amylases · Phadebad reagent

Aditya Kumar Kar, Radha Patel and Ankit Debnath contributed equally with all other contributors.

A. K. Kar (✉) · R. Patel · A. Debnath

Department of Forensic Science, Adamas University, Barasat, Kolkata, India

# The Author(s), under exclusive license to Springer Nature Singapore Pte 117
Ltd. 2024
A. Puri et al. (eds.), Fundamentals of Forensic Biology,
https://doi.org/10.1007/978-981-99-3161-3_8
118 A. K. Kar et al.

8.1 Introduction

Forensic investigators have confirmed the fact numerous times that saliva has helped
solve high-profile cases (Kassin et al. 2013). The case of Geovanni Borjas reported
on 31 May 2017 was one such example, where police arrested Geovanni, for the
murder of 22-year-old Bree’ Anza Guzman and 17-year-old Michelle Lozano. The
detectives used DNA extracted from the saliva which matched with a DNA sample
in the statewide database that was identified to belong to a close relative of the
suspect they were looking for, who turned out to be Geovanni’s father. Later,
personal identification helped strengthen the alibi.
A crime scene can contain salivary evidence in the form of spit thrown on the
sides, saliva on discarded chewing gum, and bite marks on the victim. It can also be
obtained from used cutlery, glass bottles, masks, or any objects that show marks of
being bitten (Fig. 8.1).
Saliva has been an important piece of evidence in cases of molestation, and drug/
alcohol intake, for DNA profiling without the suspect knowing because of its ease of
availability and non-invasive collection method. The analysis of saliva is also quite
cost-effective, adding to the reason for saliva being a very preferred medium of
choice in forensic/criminal investigation amongst all bodily fluids.
Advancements in biotechnology have improved the isolation of human DNA
from dried saliva stains obtained from lip prints and bite marks at a crime scene. But
in case there is a lack of DNA samples for comparative identification, it can still be
used for biological profiling. It can include the age, gender, and personal
characteristics of an individual for reconstructive identification. This utilizes the
study of the human microbiome, microbial DNA of microorganisms present in
salivary secretion, combined with salivary biomarkers to shed light on the lifestyle,
medical condition, and personal habits aiding in forensic investigation (Kapoor and
Chowdhry 2018) (Fig. 8.2).

8.1.1 What Is saliva?

Saliva is a complex biological, extracellular fluid secreted by acinar cells of the

major and minor salivary glands. Seventy percent of saliva is produced by the
submandibular salivary gland, 25% from parotids, and 5% from sublingual salivary
glands. It is an indicator of various plasma constituents (Proctor and Carpenter 2007)
(Fig. 8.3).

8.1.2 Function

1. Lubrication
2. Breakdowns starch into simpler sugars
3. Creates food bolus
8 Introduction to Saliva and Its Forensic Analysis 119

DRUG LEVEL
MONITERING

BONE TURNOVER/
PHYSIOLOGICAL
CRADIOVASCULAL
RESEARCH
MARKERS

SALIVARY

DIAGNOSTICS

FORENSIC EVIDENCE GENETIC DISORDERS

AUTOIMMUNE/RENAL
DISEASES
DISEASES OF
ADRENAL CORTEX.

Fig. 8.1 Graphical representation of use of saliva in various disciplines

4. Important in sense of taste

5. Maintains pH of the mouth

8.2 Activity of Amylases

Amylases are enzymes that cleave polysaccharides such as starches, which are
composed of D-glucose units connected by α1–4 linkages.
Two types of amylases characterized are as follows:

1. Β-amylases found in plants and bacterial sources

2. Human α-amylases
120 A. K. Kar et al.

SALIVA

To find unknown
RECONSTRUCTIVE COMPARATIVE when the identity of
suspect/ narrow
IDENTIFICATION IDENTIFICATION suspect is known
down search list

SALIVARY
SIGNATURES PERSONAL
IDENTIFICATION

PERSONAL
AGE GENDER HEALTH STATUS HUMAN DNA
CHARACTERISTIC
PROFILING/
FINGERPRINTING

AMOUNT OF
Studying the
SALIVARY METHYLATION TESTOSTERONE
microbial DNA in
MICROBIOME LEVEL PRESENT SALIVARY COMPOSITIONAL
saliva
BIOMARKER CHANGE

TIME OF
COLLECTION DRUG/ALCOHOL
MALIGNANCIES INTAKE

GEOLOCATION

ORAL & SYSTEMIC POISONING

DISEASES

PERSONAL
IDENTITY

Fig. 8.2 Flowchart represent forensic significance of saliva. (Adopted and modified from Kapoor
and Chowdhry 2018)

Human α-amylases have two major isoenzymes, i.e., multiple forms that differ in
their amino acid sequences.

1. Human salivary α-amylase (HSA), encoded by the Amy1 locus, is synthesized at

the salivary glands and secreted into the oral cavity.
2. Human pancreatic α-amylase (HPA), encoded by the Amy2 locus, is synthesized
by the pancreas and secreted into the duodenum (Li et al. 2015).

The identification of saliva is largely based on detecting the presence of amylases

in a sample. As we know, starch reacts with iodine to give black-blue color but in the
presence of amylase, starch molecules break down into maltose which does not show
a reaction with iodine (Figs. 8.4 and 8.5).

8.3 Identification of Saliva

The identification of saliva is largely based on detecting the presence of amylase in

the sample, for that two types of assay techniques can be utilized. The first can detect
the enzymatic activity of any type of amylase, unable to distinguish between HSA;
the second being highly specific to HSA. This technique along with RNA-based
assay is more confirmatory.
8 Introduction to Saliva and Its Forensic Analysis 121

Water

Haptocorrin Electrolytes

Anti-
Bacterial Mucus
Compounds
SALIVA
COMPOSITION

Epidermal
Opiorphin
Cells

Epidermal
Enzymes Growth
Factors

Fig. 8.3 Representative diagram for different components of saliva

Fig. 8.4 Reaction shows formation of starch-iodine complex

8.3.1 Preliminary Examination

8.3.1.1 Visual Examination

The use of alternate light sources facilitates the search and visualization of saliva
stains. However, 470 nm excitation wavelength can be used with orange goggles to
allow fluorescence, which is usually less intense than seminal stains.
122 A. K. Kar et al.

Fig. 8.5 Reaction shows action of amylase on starch

8.3.1.2 Starch-Iodine Assay

This assay is based on the activity of amylase enzyme present in saliva on starch.

8.3.1.3 Radial Diffusion Assay

Principle
Starch reacts with iodine to form a dark blue complex. In the presence of amylase,
starch breaks down into monosaccharides or disaccharides, which does not give any
coloration when iodine is added.

Procedure
1. An agar gel containing starch is prepared. A sample well is created by punching a
hole in it.
2. Extract of the questioned sample is placed into the well. If amylase is present, it
diffuses into the gel and hydrolyzes the starch present in it.
3. The gel is then stained using an iodine solution.
4. A clear area in the gel indicates amylase activity, and the size of the clear area is
proportional to the amount of amylase present in the sample.

Note: This assay is not specific to HSA and can produce false-positive results
(Li et al. 2015).

8.3.1.4 Colorimetric Assay

The principle of this assay is based on the dye-labeled amylase substrates such as
dye-conjugated amylose or amylopectin. These substrates are not soluble in water. In
presence of amylase, the dye-containing moieties are cleaved and are soluble in
water to produce a color. Most such assays are not HSA specific, although their
specificity can be tested by using inhibitors that preferentially inhibit HAS.

Phadebas Test
If it is suspected that the stain to be tested is a weak saliva stain, or if testing the
supernatant from an extracted stain or swab, the Phadebas reagent used as a tube test
is more sensitive than Phadebas paper. When testing swab(s) for the presence of
saliva, they may need to be extracted according to a separate protocol. The
8 Introduction to Saliva and Its Forensic Analysis 123

supernatant from the extraction procedure can then be tested using the Phadebas tube
test protocol below:

1. Prepare suitable positive (saliva) and negative (distilled water) control samples, in
tubes (for example Eppendorf tubes).
2. Extraction of samples:
(a) Stain: Cut out a small portion of the stain (approx. 3 × 3 mm) and transfer it to
a sterile tube. Add 0.5–1 ml of sterile distilled water and leave to soak for
1 min. Agitate vigorously using a mechanical shaker for 30 s.
(b) Swab: Follow internal protocol for extracting swabs.
3. Pipette 0.5–1 ml of supernatant from the stain or swab extraction to another tube.
4. Add 1 (one) Phadebas tablet to each test and control tube.
5. Top up the sample and control tubes to 1 ml with sterile distilled water and agitate
using a mechanical shaker.
6. Incubate the tubes at 37 °C for 30 min. Remove and agitate each tube.
7. Centrifuge the tubes at 10,000 × g for 1 min.
8. A positive amylase reaction will produce a blue-colored supernatant solution, the
depth of color depending upon the amylase concentration. A negative reaction
will result in a clear supernatant (Whitehead and Kipps 1975).

8.3.2 Confirmatory Test

8.3.2.1 Immunochromatographic Assay

Immunochromatographic assay is a rapid and simple test which is used to detect
presence and absence of analyte in a sample.

RSID-Saliva Test (Rapid Stain Identification of Saliva)

Principle
Commercially produced immune-chromatographic kits include the RSID-saliva kit.

1. Sample containing amylase is loaded in a sample well.

2. Antigen binds to a labeled anti-HSA Ab to form a labeled Ab-HSA complex.
3. At the test zone, the labeled complex binds to an immobilized antihuman HSA Ab
to form a labeled Ab-HSA-Ab sandwich.
4. At the controlled zone, the labeled anti-HAS Ab binds to an immobilized
antiglobulin and is captured at the controlled zone.

Procedure
Forensic samples obtained on cotton swabs should be extracted in 300–400 μL of
RSID™-Universal Buffer: shake for 10 s, longer incubation times are optional.
Alternatively, a portion of a swab may be used, and sufficient RSID™-Universal
Buffer should be added to easily cover the sample. Stains on fabric or paper should
be sampled by taking a punch or cutting (≈20 mm2) of the item. The punch or
124 A. K. Kar et al.

Fig. 8.6 Representative

diagram of various results
obtained by immuno-
chromatographic test through
RSID Kit

cutting should be extracted in 100 μL of RSID™-Universal Buffer for 10 s or longer

(Fig. 8.6).
Assays should be performed at room temperature. It is recommended that a
positive and negative control be included with every assay.

1. Remove the cassette from the foil pouch. Discard silica gel desiccant.
2. Combine extract aliquot (max of 20 μL) with RSID™-Universal Buffer to bring
the test sample to a total volume of 100 μL.
3. Add sample in RSID™-Universal Buffer to sample window. Start timing.
4. At 10 min, score and record results as shown in the scoring results diagram shown
in Fig. 8.6 (Casey and Price 2010).

Enzyme-Linked Immunosorbent Assay (ELISA)

This method can be used for the detection and quantification of a sample using anti-
HAS antibodies, utilizes reporting enzymes to produce colorimetric or fluorometric
signals. The intensity of the signals can be detected spectrophotometrically and is
proportional to the amount of bound antigen. The number of HAS can be quantified
by comparing it to a standard known concentration. This method is specific and
highly sensitive in detecting HAS; it is very time-consuming.
8 Introduction to Saliva and Its Forensic Analysis 125

8.4 Examination of Saliva for Various Biological and Chemical

Key Points

8.4.1 RNA-Based Assay

This technique is recently developed for the identification of saliva. It is based on the
expression of certain genes in certain cells/tissue. Thus, the technique uses the
detection of mRNA present in certain cells of the oral cavity for the identification
of saliva. These assays utilize the reverse transcription PCR method to detect gene
expression. RNA-based assays present higher specificity and are amenable automa-
tion. However, one limitation is that RNA is unstable because of degradation by
endogenous ribonucleases.

8.4.2 Detection of Psychotropic Drugs

Detection of psychotropic drugs and ethanol levels in saliva has been a major boost
in traffic safety for its easy roadside procedure. Overall sensitivity and specificity are
91–98%. Drugs that can be detected include amphetamine, cocaine, opiates, and
cannabinoids. THC is only detected in saliva as a result of long-duration smoking.
SCN (thiocyanate) concentration is analyzed by HPLC to distinguish non-smokers
from smokers (Youso et al. 2012). Saliva is not ideal evidence for post-mortem
identification of ethanol due to contamination and decomposition by
microorganisms.

8.4.3 ABO Grouping Using Saliva

Bite marks and spits being a potential source of salivary transfer can contain around
80% of ABO blood group antigens. Ninety percent of ABO DNA profiles can be
obtained from epithelial cells, in saliva by DNA profiling. However, the degradation
of genetic material over time is a huge hindrance.

8.4.4 Gender Determination Through Saliva

The presence of Barr-bodies in epithelial cells in saliva samples can be a significant

parameter in the identification of sexual dimorphism. Barr-bodies are extra
inactivated X-chromosomes found exclusively in females. It can be identified as a
small, dark-stained body near a nuclear envelope.
126 A. K. Kar et al.

8.4.5 Microbiome Study of Saliva for Personal Identification

Oral microflora, commonly mutans Streptococci, Actinomyces, and Veillonella, are

also transferred through bite marks. Streptococcus mutans is the golden standard in
forensic identification as S-mutans strain are unique to every individual acquired
during birth and persists through life. Hence, the subtyping of mutans streptococci
species has definite implications in forensic microbiology (Leake 2014).

8.5 Conclusion

Saliva has become a key piece of evidence in forensic science, becoming more
popular for its cost-effectiveness, less time-consuming, and noninvasive methods.
Salivary analysis has provided aid in both postmortem and antemortem analysis.
Saliva can shed light on both the physiological and psychological conditions of a
person, providing information about eating habits, behaviors, abnormalities, and
even sex and age.
Tests for identification include preliminary and confirmatory tests. A preliminary
test can provide possibilities of the presence of saliva at the crime scene while a
confirmatory test can identify a specific genetic material. The presence of human
salivary amylase or HSA in the saliva is utilized for many of the popular confirma-
tory tests. Screening tests are used to determine the possible presence of hormones,
genetic material, and controlled samples.
It is a fairly new field of research and needs to be explored further for it to be
optimal for both adjunct and confirmatory sources of personal identification.

References
Casey DG, Price J (2010) The sensitivity and specificity of the RSID™-saliva kit for the detection
of human salivary amylase in the Forensic Science Laboratory, Dublin, Ireland. Forensic Sci Int
194(1–3):67–71
Kapoor P, Chowdhry A (2018) Salivary signature in forensic profiling: a scoping review. J Forensic
Dent Sci 10(3):123
Kassin SM, Dror IE, Kukucka J (2013) The forensic confirmation bias: Problems, perspectives, and
proposed solutions. J Appl Res Mem Cogn 2(1):42–52
Leake S (2014) Human identification through analysis of the salivary microbiome: proof of
principle. Université de Lausanne, Faculté de droit et des sciences criminelles
Li R. (2021) ‘15.2.1.2.1 starch iodine assay’, in Forensic biology. 2nd edn. Boca Raton: CRC Press,
Taylor & Francis Group
Proctor GB, Carpenter GH (2007) Regulation of salivary gland function by autonomic nerves.
Auton Neurosci 133(1):3–18
Whitehead P, Kipps AE (1975) A test paper for detecting saliva stains. J Forensic Sci Soc 15:39–42
Youso SL, Rockwood GA, Logue BA (2012) The analysis of protein-bound thiocyanate in plasma
of smokers and non-smokers as a marker of cyanide exposure. J Anal Toxicol 36(4):265–269
Identification of Vaginal Secretions
and Menstrual Blood 9
Arjun Rao Isukapatla, Mehar Chadha, Nisha Kaushik,
and Sunanda Dhenge

Abstract

Vaginal stains and menstrual stains are two types of bodily fluid stains that can be
important in forensic science investigations. Vaginal stains refer to bodily fluids
left on clothing, bedding, or other surfaces as a result of sexual activity, while
menstrual stains refer to bloodstains left on surfaces during menstruation.
Identifying these stains is significant in forensic science because they can provide
critical evidence in sexual assault investigations. The presence of these stains can
also help identify a suspect by linking their DNA to the stain. Methods for
identifying vaginal and menstrual stains may include visual inspection, alternate
light sources, chemical or DNA analysis. The identification of vaginal and
menstrual stains is a critical part of forensic investigation in sexual assault
cases, and can provide important evidence to support the prosecution of
perpetrators and help ensure justice for victims.

Keywords
Vaginal stains · Menstrual stains · mRNA profiling · RT-PCR · D-Dimer · LDH
Assay

A. R. Isukapatla (✉) · M. Chadha

Department of Life Sciences, Christ University, Bengaluru, Karnataka, India
e-mail: [email protected]
N. Kaushik · S. Dhenge
Forensic Science Education Society, Raipur, Chhattisgarh, India

# The Author(s), under exclusive license to Springer Nature Singapore Pte 127
Ltd. 2024
A. Puri et al. (eds.), Fundamentals of Forensic Biology,
https://doi.org/10.1007/978-981-99-3161-3_9
128 A. R. Isukapatla et al.

9.1 Introduction

The identification of vaginal stains is an important aspect of a sexual assault

investigation. These stains can provide valuable evidence in determining whether
sexual contact occurred, as well as in identifying the perpetrator. The process of
identifying vaginal stains typically involves collecting samples from the victim’s
clothing, bedding, or body using a rape kit. The samples are then sent to a forensic
laboratory, where they are analyzed for the presence of semen, sperm, or other
biological materials. In cases where the stains are visible to the naked eye, they may
be examined under a microscope to determine their composition and origin. The
vaginal microbiota is a complex ecosystem consisting of a diverse array of
microorganisms, including bacteria, viruses, fungi, and protozoa (Smith and Ravel
2017; Gajer et al. 2012). In vaginal stains, various types of bacteria may be present,
depending on the individual’s vaginal microbiome and any potential infections or
imbalances such as bacterial vaginosis (BV), sexually transmitted infections (STIs),
and vulvovaginal candidiasis (VVC) (Chee et al. 2020). Menstrual blood stains can
be used to establish a link between a suspect and a victim, as the presence of
menstrual blood on the suspect’s clothing or other belongings may indicate contact
with the victim during or after menstruation. In criminal investigations, menstrual
blood stains can be used as evidence in cases involving sexual assault or other crimes
where bodily fluids may be involved (Holtkötter et al. 2018). Forensic scientists can
differentiate between menstrual blood and other types of blood based on the pres-
ence of certain proteins or enzymes.

9.2 Identification of Vaginal Acid Phosphatase

Vaginal acid phosphatase (VAP) examination is a forensic test used to detect the
presence of acid phosphatase enzyme in vaginal secretions. Acid phosphatase is an
enzyme found in high levels in semen, and therefore, its presence in vaginal
secretions can indicate recent sexual activity. The VAP examination is a simple
and inexpensive test that can provide valuable information in cases of sexual assault
or rape (Schumann et al. 1976). The test involves swabbing the vaginal area to
collect a sample of secretions, which is then analyzed for the presence of acid
phosphatase. If the enzyme is present in high levels, it can indicate recent sexual
activity, although it cannot determine whether the sexual activity was consensual or
non-consensual. The reliability of the VAP test can be affected by several factors,
such as the time elapsed since sexual activity, the use of certain medications, and the
presence of certain medical conditions (Schiff 1978). Consequently, the results of
the VAP test should always be interpreted in conjunction with other forensic
evidence and clinical findings. VAP examination can be a useful tool in forensic
investigations involving sexual assault or rape, but it should be used in conjunction
with other tests and evidence to ensure accurate and reliable results.
9 Identification of Vaginal Secretions and Menstrual Blood 129

9.2.1 Brentamine Fast Blue Test

Acid phosphatase is an enzyme found in high levels in seminal fluid, and therefore,
its presence in vaginal stains can indicate recent sexual activity. Acid phosphatase
activity in vaginal stains can be detected using a variety of forensic tests, including
the Brentamine fast blue test and the acid phosphatase stain test (Byard and Payne-
James 2015). The acid phosphatase stain test involves the use of a solution
containing a substrate that reacts with acid phosphatase to produce a color change.
A sample of the vaginal stain is collected and mixed with the solution, and the
mixture is then observed under a microscope. If acid phosphatase is present in the
stain, it will react with the substrate in the solution, producing a brown color. Acid
phosphatase activity in vaginal stains can be affected by several factors, such as the
time elapsed since sexual activity, the use of certain medications, and the presence of
certain medical conditions. Therefore, the results of acid phosphatase tests should
always be interpreted in conjunction with other forensic evidence and clinical
findings. The detection of acid phosphatase activity in vaginal stains can be a useful
tool in forensic investigations involving sexual assault or rape, but it should be used
in combination with other tests and evidence to ensure accurate and reliable results.

9.2.2 p-Nitrophenyl Phosphate Technique

The p-nitrophenyl phosphate technique is a biochemical staining method that can be

used to detect alkaline phosphatase activity in vaginal secretions (Bowen and Ryder
1976). Alkaline phosphatase is an enzyme that is produced by a variety of cells,
including those in the vaginal epithelium, and can be used as a marker for the
presence of vaginal fluid. To perform the staining, a sample of vaginal secretions
is collected using a swab or other collection device. The swab is then placed into a
solution containing Sigma p-nitrophenyl phosphate, which is a substrate that is
converted to a yellow product by alkaline phosphatase. The sample is incubated
for a short period of time, typically a few minutes, and then, the color of the solution
is observed. A yellow color indicates the presence of alkaline phosphatase activity,
and therefore the presence of vaginal secretions. The Sigma p-nitrophenyl phosphate
technique is a relatively simple and inexpensive method for detecting vaginal
secretions, and it can be useful in forensic investigations or medical examinations.
It is also important to note that the technique only indicates the presence of vaginal
fluid, and cannot be used to determine the timing or circumstances of its deposition.

9.2.3 Sodium Thymolphthalein

The sodium thymolphthalein technique is another biochemical staining method that

can be used to detect the presence of vaginal secretions in forensic investigations or
medical examinations (Seiden and Duncan 1983; Elkins 2012). This method also
relies on the detection of alkaline phosphatase activity in the vaginal fluid. To
130 A. R. Isukapatla et al.

perform the staining, a sample of vaginal secretions is collected using a swab or other
collection device. The swab is then placed into a solution containing sodium
thymolphthalein, which is a pH indicator that changes color in response to changes
in pH. The sample is incubated for a short period of time, typically a few minutes,
and then the color of the solution is observed. A blue color indicates the presence of
alkaline phosphatase activity and therefore the presence of vaginal secretions. The
sodium thymolphthalein technique is also a relatively simple and inexpensive
method for detecting vaginal secretions, and it can be used in conjunction with
other staining methods for the confirmation of results. Similar to the Sigma
p-nitrophenyl phosphate technique, the sodium thymolphthalein technique indicates
the presence of vaginal fluid and cannot be used to determine the timing or
circumstances of its deposition.

9.3 Identification of Vaginal Bacteria

In forensic science, identifying the presence of bacteria in vaginal fluid can provide
important information about a sexual assault or other crime. Bacteria in vaginal fluid
can be detected using various techniques, including culture-based methods and
molecular biology techniques (Xia et al. 2016). Culture-based methods involve
growing bacteria in a laboratory setting on special media that promote the growth
of specific bacterial species. This method is useful for identifying the type of bacteria
present in a vaginal fluid sample and determining if an infection is present. However,
this method can take several days or even weeks to obtain results, which may not be
suitable for forensic investigations. Molecular biology techniques, such as polymer-
ase chain reaction (PCR) and next-generation sequencing (NGS), can be used to
rapidly detect and identify the presence of specific bacterial species in vaginal fluid.
These techniques can be used to detect bacteria associated with sexually transmitted
infections (STIs), such as Chlamydia trachomatis, Neisseria gonorrhoeae, and
Trichomonas vaginalis. They can also be used to detect bacterial species associated
with bacterial vaginosis, such as Gardnerella vaginalis, Atopobium vaginae, and
Prevotella species (Castro et al. 2021). The identification of specific bacterial species
in the vaginal fluid can provide important information about a sexual assault, as it
may indicate the presence of an STI or other health concern. It may also help to
identify potential sources of the bacteria, such as a suspect or other individuals
involved in the investigation.

9.3.1 Types of Bacteria Present in Vaginal Stains

The most common bacteria found in vaginal stains are typically lactobacilli, which
are beneficial bacteria that help to maintain a healthy vaginal environment by
producing lactic acid and other substances that help to regulate the pH and prevent
the growth of harmful microorganisms. Other bacteria may also be present in vaginal
9 Identification of Vaginal Secretions and Menstrual Blood 131

stain, which includes Gardnerella vaginalis, Escherichia coli (E. coli), Streptococ-
cus agalactiae, and Staphylococcus aureus (Lindahl et al. 2005; Money 2005).

9.3.1.1 Gardnerella vaginalis

It is a type of bacteria that is commonly found in the vaginal microbiota of women.
While it is not typically associated with criminal investigations or forensic science, it
may be of interest in cases involving sexual assault or other types of sexual violence
(Srinivasan and Fredricks 2008). If Gardnerella vaginalis is identified in a forensic
sample, such as a swab taken from the vaginal area of a sexual assault victim, it may
provide valuable information about the perpetrator. For example, if the DNA of the
bacteria is collected and analyzed, it may be possible to determine whether the
bacterium matches the DNA of a suspect or suspects. However, it is important to
note that the presence of Gardnerella vaginalis in a forensic sample does not
necessarily indicate sexual assault or other criminal activity. This bacteria is a
normal part of the vaginal microbiota and can be present in the absence of any
criminal activity. Therefore, while Gardnerella vaginalis identification may be a
useful tool in forensic investigations, it should always be interpreted in the context
of the specific case and other available evidence.

9.3.1.2 Escherichia coli (E. coli)

Escherichia coli (E. coli) is a type of bacteria that is commonly found in the
gastrointestinal tract and is not normally associated with the vaginal microbiota.
Therefore, the identification of E. coli in vaginal stains could potentially be a cause
for concern, as it may indicate contamination from fecal matter or improper sample
handling (Castro et al. 2019). If E. coli is detected in vaginal stains, it is important to
consider the possibility of contamination during sample collection or handling. It
may also be useful to confirm the presence of E. coli with additional testing, such as
genetic analysis, to rule out any false positives. However, it is important to note that
the presence of E. coli in vaginal stains does not necessarily indicate sexual assault or
other criminal activity. In fact, the majority of E. coli strains are not pathogenic and
do not cause illness. Therefore, while the identification of E. coli in vaginal stains
may be a cause for further investigation, it should always be interpreted in the
context of the specific case and other available evidence. Additional testing and
analysis may be needed to determine the significance of E. coli in the sample and
whether it is relevant to the investigation.

9.3.1.3 Streptococcus agalactiae

Streptococcus agalactiae (group B streptococcus or GBS) is a type of bacteria that is
commonly found in the vaginal and rectal microbiota of healthy women. GBS
identification in vaginal stains may be of interest in forensic investigations, particu-
larly in cases involving infant deaths or cases of sexual assault. In cases involving
infant deaths, GBS can be a potential cause of infection and may be identified in
samples collected from the infant or mother. In cases of sexual assault, GBS may be
identified in samples collected from the victim, as it can be transmitted during sexual
contact. The presence of GBS in vaginal stains may be used as evidence of sexual
132 A. R. Isukapatla et al.

contact, although it is important to note that the presence of GBS alone does not
necessarily indicate non-consensual sexual activity (Smith et al. 2018). To identify
GBS in vaginal stains, standard microbiological techniques such as culturing and
biochemical testing can be used. More advanced techniques such as genetic testing
may also be used for confirmation or to obtain more detailed information about the
strain of GBS. Overall, the identification of GBS in vaginal stains can be a useful
tool in forensic investigations, particularly in cases involving infant deaths or sexual
assault. However, as with any forensic evidence, it should always be interpreted in
the context of the specific case and other available evidence.

9.3.1.4 Staphylococcus aureus

Staphylococcus aureus (S. aureus) is a type of bacteria that is commonly found on
the skin and in the nose of healthy individuals, and can sometimes cause infections.
While it is not typically associated with the vaginal microbiota, it may be present in
vaginal stains in certain cases. S. aureus identification in vaginal stains may be of
interest in forensic investigations, particularly in cases involving sexual assault or
other types of sexual violence. In cases involving sexual assault, S. aureus may be
identified in samples collected from the victim, as it can be transmitted during sexual
contact. The presence of S. aureus in vaginal stains may be used as evidence of
sexual contact, although it is important to note that the presence of S. aureus alone
does not necessarily indicate non-consensual sexual activity (Ellem et al. 2017). To
identify S. aureus in vaginal stains, standard microbiological techniques such as
culturing and biochemical testing can be used. More advanced techniques such as
genetic testing may also be used for confirmation or to obtain more detailed
information about the strain of S. aureus (Deng et al. 2019). Overall, the identifica-
tion of S. aureus in vaginal stains can be a useful tool in forensic investigations,
particularly in cases involving sexual assault or other types of sexual violence.
However, as with any forensic evidence, it should always be interpreted in the
context of the specific case and other available evidence. The presence of this
bacteria in vaginal stains can provide important information for forensic
investigations, as it may help to identify potential sources of infection or other health
concerns.

9.3.2 Composition of Different Level Proteins Present in Vaginal

Stains

Proteins are an important component of vaginal stains, as they can provide valuable
information about the source and timing of the stain. In sexual assault investigations,
proteins found in vaginal swabs or stains can be used to identify the presence of
semen or other bodily fluids, and to help determine the timing of the assault. Proteins
can also provide information about the health status of the individual. Elevated levels
of certain proteins may indicate the presence of an infection or inflammation in the
genital area (Dobay et al. 2019). In addition, the specific types of proteins found in
vaginal stains can provide clues about the individual who deposited the stain.
9 Identification of Vaginal Secretions and Menstrual Blood 133

Proteins found in semen can be used to identify the individual’s genetic profile,
which can be useful in identifying a suspect in cases of sexual assault. The analysis
of proteins in vaginal stains is an important tool in sexual assault investigations and
can provide valuable information for forensic analysis. The composition of proteins
in vaginal stains can vary depending on a number of factors, such as the individual’s
menstrual cycle, sexual activity, and vaginal infections or conditions (Raffi et al.
1977). However, some of the proteins that have been found in vaginal stains include
lactoferrin, serum albumin, cervical mucus glycoproteins, immunoglobulins, and
prostate-specific antigen (PSA) (Amabebe and Anumba 2018).

9.3.2.1 Lactoferrin
Lactoferrin is a protein that is found in various bodily fluids, including breast milk,
tears, and vaginal fluid. In the context of sexual assault investigations, the detection
of lactoferrin in vaginal stains can be used as a biomarker for the presence of vaginal
fluid (Jarosik and Land 2000). Lactoferrin is produced in the female genital tract, and
its presence in vaginal fluid can be used to determine whether a stain is of vaginal
origin. This information can be helpful in distinguishing between vaginal fluid stains
and other bodily fluids, such as blood or saliva. However, it is important to note that
the presence of lactoferrin in vaginal stains does not necessarily indicate sexual
activity or sexual assault. Other factors, such as menstrual bleeding or vaginal
infections, can also result in the presence of lactoferrin in vaginal fluid. Additionally,
the absence of lactoferrin does not necessarily rule out the possibility of sexual
activity or sexual assault, as not all vaginal fluid samples will contain detectable
levels of lactoferrin (Rönnqvist et al. 2006).

9.3.2.2 Serum Albumin

Serum albumin is a protein found in blood plasma, and it can be present in vaginal
stains due to contamination from menstrual blood or other sources. Its presence in a
vaginal stain can be used to suggest that the stain may contain blood, but it does not
necessarily indicate the presence of sexual activity or sexual assault (Joshi et al.
1990). In cases where the presence of semen is being investigated, the detection of
serum albumin in a vaginal stain may suggest the presence of male blood, and
therefore, semen. The presence of serum albumin alone is not sufficient evidence to
conclude that sexual activity has occurred or that a sexual assault has taken place
(Sakurada et al. 2020). It must be evaluated in conjunction with other evidence such
as DNA analysis, physical examination, and witness statements. It is also worth
noting that serum albumin can be present in vaginal fluid from non-sexual sources,
such as vaginal infections or medical procedures. Therefore, the presence of serum
albumin alone does not prove the presence of semen or sexual activity, and its
detection should always be considered in conjunction with other factors in the
investigation.

9.3.2.3 Cervical Mucus Glycoproteins

Cervical mucus glycoproteins are a major component of cervical mucus, which is
produced by the cervix and lines the vaginal canal. The properties of cervical mucus
134 A. R. Isukapatla et al.

change throughout the menstrual cycle in response to hormonal changes, and these
changes can be used to track fertility (Moncla et al. 2016). Vaginal stains may
contain cervical mucus glycoproteins, which can be detected through laboratory
testing. This testing is commonly used in sexual assault investigations to identify the
presence of semen or other bodily fluids, and to help determine the timing of the
assault. Cervical mucus can be present in the vaginal canal for several days after
intercourse, and may also be present due to natural vaginal secretions (Adnane et al.
2018; Zegels et al. 2010). Therefore, additional testing and evidence must be
considered in order to determine whether sexual activity occurred and, if so, when
it occurred.

9.3.2.4 Immunoglobulins
Immunoglobulins may be present in vaginal stains, particularly if there has been
recent sexual activity or if there is an infection or inflammation in the genital area
(Paterson et al. 2006). In sexual assault investigations, testing for the presence of
immunoglobulins in vaginal swabs or stains can help to confirm recent sexual
activity or the presence of an infection. It is also to be noted that the presence of
immunoglobulins in vaginal stains does not necessarily indicate sexual assault or
any other criminal activity (Cauci et al. 1998; Breedveld et al. 2022).
Immunoglobulins may also be present due to natural vaginal secretions or as a result
of non-sexual contact with bodily fluids, such as during medical procedures or
contact sports (Hein et al. 2005). Additional testing and evidence must be considered
in order to determine the source and timing of immunoglobulins in vaginal stains,
and to determine whether any criminal activity has occurred.

9.3.2.5 Prostate-Specific Antigen (PSA)

Prostate-specific antigen (PSA) is a protein that is produced by the prostate gland in
males. It is commonly used as a marker for prostate cancer, but it can also be found
in semen and in smaller amounts in other bodily fluids. PSA should not normally be
present in vaginal stains from females, as females do not have a prostate gland
(Kulczycki et al. 2017). In cases of sexual assault, the presence of PSA in vaginal
swabs or stains from females may indicate that semen from a male with a prostate
gland was deposited in the vagina during the assault. The presence of PSA in vaginal
stains is not definitive evidence of sexual assault, as there may be other explanations
for its presence (Hochmeister et al. 1999; Kamenev et al. 1989). Some medical
procedures can result in the accidental transfer of PSA-containing fluids to the
vaginal area. Additional testing and evidence must be considered in order to
determine the source and timing of PSA in vaginal stains, and to determine whether
any criminal activity has occurred.
9 Identification of Vaginal Secretions and Menstrual Blood 135

9.3.3 Genetic Markers Identification

9.3.3.1 mRNA Profiling

mRNA profiling has a wide range of applications in forensic science. It can be used
for various purposes, including identifying the tissue origin of biological fluids
found at crime scenes (Juusola and Ballantyne 2005), assessing the postmortem
interval (PMI), and detecting the presence of body fluids that are difficult to
visualize. One of the primary uses of mRNA profiling in forensic science is the
identification of the tissue origin of biological fluids. mRNA profiling can be used to
identify the presence of specific genes or gene expression patterns in a given sample,
including body fluids (Jakubowska et al. 2013). Body fluids such as blood, urine,
saliva, and semen can be identified using mRNA profiling by analyzing the expres-
sion of specific genes that are unique to each type of fluid. Specific genes such as
hemoglobin or immunoglobulin genes are expressed in blood, while prostate-
specific antigen (PSA) gene is expressed in semen. By analyzing the expression of
these genes using mRNA profiling techniques such as reverse transcription-
polymerase chain reaction (RT-PCR), it is possible to identify the type of body
fluid present in a sample (Haas et al. 2009). mRNA profiling for body fluids
identification can be useful in various forensic applications, such as identifying the
source of a bodily fluid found at a crime scene or determining the presence of a
disease or infection based on the expression of certain genes in a body fluid sample.
mRNA markers can be used for the identification of vaginal stains, as different
cells in the body have unique gene expression patterns. It is of importance that
mRNA markers alone may not be sufficient for accurate identification of vaginal
stains as there may be variations in gene expression patterns between individuals.
Additionally, environmental factors and the age of the sample may also affect the
accuracy of mRNA marker identification. Some potential mRNA markers that have
been suggested for the identification of vaginal stains include mucin 1 (MUC1),
human beta-defensin 1 (HBD1), and lactoferrin (LTF). These markers are typically
expressed in vaginal epithelial cells and secretions and can be detected through
techniques such as reverse transcription polymerase chain reaction (RT-PCR) or
microarray analysis. The use of mRNA markers should be complemented by other
traditional methods of stain identification such as microscopy and DNA analysis to
improve the accuracy of results. It is possible to distinguish biological material using
certain mRNA markers since every tissue and bodily fluid has a unique and
individual mRNA profile. Usage of the PCR methodology improves the test’s
sensitivity when compared to traditional confirmatory procedures. The steps
involved in the RNA analysis are RNA isolation, quantification, reverse transcrip-
tion, amplification of specific transcripts, and amplicon identification.

9.3.3.2 mRNA Markers Used in Vaginal Stain Identification

There are different types of mRNA markers that can be used to identify vaginal
stains. These markers can be used to detect the presence of vaginal epithelial cells,
which are shed from the lining of the vagina and can be present in vaginal secretions.
One commonly used mRNA marker is the human beta-defensin 1 (hBD1) gene
136 A. R. Isukapatla et al.

(Valore et al. 1998). This gene is expressed in the vaginal epithelium and is not
present in other tissues, making it a specific marker for vaginal cells. The hBD1 gene
is a human beta-defensin gene that produces a protein with antimicrobial properties.
It is expressed in a variety of human tissues, including the skin, oral cavity, and
reproductive tract, including the vagina. The identification of hBD1 gene in vaginal
stains can be used as a marker for vaginal epithelial cells. This marker alone may not
be sufficient for positive identification of vaginal stains as other factors, such as the
presence of spermatozoa or other cellular material, must also be taken into consider-
ation (Hanson and Ballantyne 2013). To identify hBD1 gene in vaginal stains, DNA
extraction and analysis techniques such as PCR (polymerase chain reaction) and
DNA sequencing can be used. PCR amplifies the DNA sequence of interest, while
DNA sequencing confirms the presence of the hBD1 gene in the sample. Another
mRNA marker that can be used is the mucin 4 (MUC4) gene. This gene is also
expressed in the vaginal epithelium and can be used to identify vaginal cells in stains
(Hadžić et al. 2011). The MUC4 gene is a human gene that encodes for the mucin
4 protein, which is a glycoprotein expressed in various tissues, including the vagina
(Cossu et al. 2009). The MUC4 gene is a potential marker for vaginal epithelial cells,
and its identification in vaginal stains can be used in forensic investigations for
identifying the presence of vaginal secretions.
Other potential mRNA markers for vaginal stain identification include the human
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene, the human lactate
dehydrogenase C (LDHC) gene, and the human lactoferrin (LTF) gene. However,
the use of these markers may not be as specific as hBD1 and MUC4. The GAPDH
gene is a human gene that encodes for the glyceraldehyde-3-phosphate dehydroge-
nase protein, which is involved in the glycolysis pathway and is expressed in many
tissues, including the vagina. The GAPDH gene is a potential marker for vaginal
epithelial cells, and its identification in vaginal stains can be used in forensic
investigations for identifying the presence of vaginal secretions. The LDHC gene
is a human gene that encodes for the lactate dehydrogenase C protein, which is
involved in the conversion of pyruvate to lactate in various tissues, including the
reproductive tract, including the vagina. The LDHC gene has been proposed as a
potential marker for the identification of vaginal epithelial cells in forensic
investigations. The LTF gene is a human gene that encodes for lactotransferrin,
which is an iron-binding glycoprotein found in various bodily fluids, including
vaginal secretions (Salzmann et al. 2021). The LTF gene has been proposed as a
potential marker for the identification of vaginal epithelial cells in forensic
investigations.

9.3.3.3 RT-PCR
RT-PCR (reverse transcription-polymerase chain reaction) is a molecular technique
used to amplify RNA sequences into complementary DNA (cDNA) and subse-
quently amplify the cDNA sequences using PCR. It is a powerful tool for detecting
and quantifying specific RNA molecules, including those expressed by genes in
vaginal epithelial cells. RT-PCR can be used in forensic investigations for the
identification of vaginal stains. To use RT-PCR for the identification of vaginal
9 Identification of Vaginal Secretions and Menstrual Blood 137

stains, the RNA must first be extracted from the stain and converted into cDNA
using reverse transcription (Ballantyne and Juusola 2007). The cDNA can then be
amplified using PCR with primers specific to the gene of interest, such as hBD1,
MUC4, GAPDH, LDHC, or LTF. The PCR products can be visualized and analyzed
using gel electrophoresis or other methods, such as sequencing or melting curve
analysis. Multiplex PCR is a molecular technique that allows for the simultaneous
amplification of multiple DNA or RNA targets in a single reaction. It is a useful tool
for forensic investigations, as it allows for the identification of multiple genes of
interest in a single sample. Multiplex PCR can be used for the identification of
vaginal stains by targeting multiple genes expressed in vaginal epithelial cells, such
as hBD1, MUC4, GAPDH, LDHC, and LTF (Gipson et al. 1999). For identification
of vaginal stains using the multiplex PCR, DNA or RNA must first be extracted from
the stain. The extracted DNA or RNA is then used as a template for PCR with
multiple sets of primers, each targeting a specific gene of interest. The PCR products
are then visualized and analyzed using gel electrophoresis or other methods.

9.3.3.4 Protein Identification

Protein estimation in vaginal fluid can be helpful in identifying various conditions or
diseases. An increased level of protein in vaginal fluid can indicate inflammation or
infection. There are several methods for protein estimation in vaginal fluid, including
biochemical assays, immunological assays, and electrophoresis. Biochemical assays
involve measuring the total protein content using colorimetric or spectrophotometric
techniques. Immunological assays involve measuring specific proteins using
antibodies that bind to the protein of interest. Electrophoresis separates proteins
based on their size and charge and can provide a more detailed analysis of the protein
composition in vaginal fluid (Igoh et al. 2015). The specific method used for protein
estimation in vaginal fluid will depend on the purpose of the analysis and the
available resources. Protein markers can be used to identify the presence of specific
proteins in a vaginal stain, which may provide additional information about the
source of the stain. Certain proteins are specific to semen or vaginal secretions,
which can help to determine whether the stain came from a male or female individ-
ual. There are several protein markers that can be used for this purpose. Prostate-
specific antigen (PSA) is a protein marker that is specific to semen (Wen et al. 2012).
If PSA is detected in a vaginal stain, it is a strong indication that the stain came from
a male individual. Other protein markers that can be used to identify vaginal
secretions include human cervicovaginal fluid (CVF) proteins such as lactoferrin,
lysozyme, and mucin. These proteins are specific to vaginal secretions and can be
used to identify the presence of such secretions in a stain.
138 A. R. Isukapatla et al.

9.4 Menstruation: D-Dimer Assay and LDH Assay

9.4.1 Menstrual Blood

Menstruation is the regular flow of blood and the removal of the endometrium,
which has deteriorated, from the uterus of non-pregnant women. The uterus is
crucial in preparing the uterine endometrium for the potential implantation of an
embryo in the future. The myometrium and the endometrium make up the uterus’
linings. The uterus’s muscular fibers make up the myometrium. The stroma and
simple columnar epithelium make up the endometrium. Sexual assault is a serious
offense and the identification of body fluids originating from sexual activity is a
crucial aspect of forensic investigations (Bagwe 2018). The discrimination between
peripheral and menstrual blood can be highly relevant for police investigations
because it provides potential evidence regarding the issue of consent. In situations
where blood may be present on a surface, such as clothing, an accurate distinction
between menstrual blood and peripheral blood could be a crucial finding in figuring
out whether the bloodstain had come from trauma or menses, potentially revealing
information about the consent issue. Menstrual blood can be identified using a
variety of methods, including microscopy, the identification of lactate dehydroge-
nase isozymes, messenger RNA (mRNA) and micro-RNA (miRNA) profiling, and
the detection of fibrinolysis by-products.
The PMB test is a duplex test combining human hemoglobin and D-dimer
detection, developed for the identification of blood and menstrual fluid, both at the
crime scene and in the laboratory. Duplex D-dimer/hemoglobin assay reliably
detects the presence of human hemoglobin and identifies samples containing men-
strual fluid by detecting the presence of D-dimers. Post-mortem blood, which also
shows a high D-dimer concentration, can be distinguished from menstrual blood by
the analysis of myoglobin levels. Post-mortem blood is unlikely to be present in a
typical sexual offense case.

9.4.2 D-dimer Assay

D-dimer assay is a blood test used to detect the presence of D-dimer, a small protein
fragment that is produced when a blood clot is degraded in the body. While D-dimer
assay is not typically used to identify vaginal stains directly, it can be used to support
the presence of a vaginal stain and to indicate the possibility of sexual assault (Baker
et al. 2011). In cases of sexual assault, it is common to perform a sexual assault
related tests, which includes the collection of vaginal swabs to test for the presence
of semen, sperm, or other biological materials. If a vaginal stain is identified, a
D-dimer assay may be performed on the vaginal swab to detect the presence of
D-dimer. The presence of D-dimer in a vaginal stain sample can indicate the
presence of blood, which can be consistent with sexual assault or trauma. Although
the presence of D-dimer in a vaginal stain does not necessarily indicate sexual
assault, as it can also be produced by other medical conditions or injuries.
9 Identification of Vaginal Secretions and Menstrual Blood 139

Fibrin D-dimer is the breakdown byproduct of cross-linked fibrin. It stands for the
marker of intravascular thrombogenesis. During menstruation, the fibrinolytic and
coagulation pathways are active. D-dimer fragment assays can be used forensically
to identify menstrual blood (Tsai et al. 2022). In an enzyme-linked immunosorbent
assay, antibodies bind to D-dimer antigens on the solid phase. The D-dimer-antibody
complex can then be examined using an antibody-based detection method. This
method takes a long time, but it is very delicate. In latex agglutination tests, the
interaction of antibodies and D-dimers that is present on carrier’s results in the
formation of aggregates during the agglutination process. D-dimer testing can
positively identify menstrual blood samples. These assays do not respond well to
peripheral blood, despite the low levels of D-dimer present there. Menstrual blood
can be distinguished from peripheral blood using D-dimer assays. Although post-
mortem blood is not usually detected in sexual assault cases, its discovery would
make it more difficult to interpret the results.

9.4.3 Lactate Dehydrogenase (LDH) Assay

Lactate dehydrogenase (LDH) assay can be used in forensic cases to identify body
fluids, such as vaginal fluid, semen, saliva, and blood, in crime scene samples. LDH
is a stable enzyme and can remain detectable for several days after deposition,
making it a useful marker for the identification of body fluids. Forensic scientists
can use LDH assay in combination with other tests, such as acid phosphatase
(AP) and prostate-specific antigen (PSA), to differentiate between various body
fluids. The presence of LDH, AP, and PSA can indicate the presence of semen,
while the presence of only LDH and AP can indicate the presence of vaginal fluid
(Ben et al. 2007). LDH assay can also be used to determine the age of a stain. As time
passes, the amount of LDH in a stain decreases, so measuring the LDH levels can
provide an estimate of the age of the stain. The use of LDH assay in forensic cases
can provide valuable information in identifying body fluids and estimating the age of
stains. Lactate dehydrogenase (LDH) is an enzyme found in many body tissues,
including the vagina. LDH levels can be measured in vaginal fluid to help diagnose
conditions such as bacterial vaginosis, which is a common vaginal infection. To
perform an LDH assay to identify vaginal stains, a sample of vaginal fluid is
collected and analyzed for LDH levels using a commercial LDH assay kit. The kit
contains reagents that react with LDH to produce a measurable signal, which is
typically measured using a spectrophotometer. If the LDH level in the vaginal fluid
is elevated, it may indicate an infection or other abnormal condition. It is important
to note that LDH levels can also be elevated in response to non-infectious factors,
such as trauma or inflammation.
Lactate dehydrogenase (LDH) is a family of enzymes that catalyze the conversion
of lactate to pyruvate. There are five different isoenzymes of LDH, which are named
LDH-1, LDH-2, LDH-3, LDH-4, and LDH-5 (Virkler and Lednev 2009). These
isoenzymes differ in their composition and distribution in different tissues. In the
identification of vaginal stains using LDH assay, the LDH isoenzymes present in
140 A. R. Isukapatla et al.

vaginal fluid are typically LDH-1 and LDH-2. LDH-1 is mainly found in heart
muscle and red blood cells, while LDH-2 is found in the liver and other tissues. In
vaginal fluid, the LDH-1 and LDH-2 isoenzymes are typically found in approxi-
mately equal amounts. The ratio of LDH-1 to LDH-2 can be used to differentiate
between vaginal fluid and semen. Semen contains a higher proportion of LDH-5,
while vaginal fluid contains higher levels of LDH-1 and LDH-2. A low ratio of
LDH-1/LDH-2 in a stain is indicative of vaginal fluid, while a high ratio is indicative
of semen. The LDH isoenzymes used in vaginal stain identification are mainly
LDH-1 and LDH-2, and the ratio of LDH-1 to LDH-2 can be used to differentiate
between vaginal fluid and semen.

9.5 Conclusion

The identification of vaginal stains in criminal cases is significant because it can

provide critical voice in sexual assault investigations. By identifying and analyzing
these stains, forensic examiners can determine whether sexual activity occurred, and
if so, whether it was consensual or non-consensual. The presence of vaginal stains
can also help identify a suspect by linking their DNA to the stain. The significance of
different identification methods may vary depending on the specific case and
circumstances. Some highly sophisticated technological methods for identifying
vaginal stains include enzyme assays, Protein identification, mRNA profiling, and
DNA analysis. These methods can help confirm the presence of bodily fluids and
identify the source of the stain, which can be crucial in linking a suspect to the crime.

References
Adnane M, Meade KG, O’Farrelly C (2018) Cervico-vaginal mucus (CVM)–an accessible source
of immunologically informative biomolecules. Vet Res Commun 42(4):255–263
Amabebe E, Anumba DO (2018) The vaginal microenvironment: the physiologic role of
lactobacilli. Front Med 5:181
Bagwe K (2018) Evaluation of recently developed methods for the forensic detection of menstrual
blood (Doctoral dissertation, Boston University)
Baker DJ, Grimes EA, Hopwood AJ (2011) D-dimer assays for the identification of menstrual
blood. Forensic Sci Int 212(1-3):210–214
Ballantyne J, Juusola J (2007) Messenger RNA profiling: body fluid identification using multiplex
reverse transcription-polymerase chain reaction (RT-PCR). Research Foundation of The Uni-
versity of Central Florida Inc., Orlando
Ben SQ, Ni SS, Shen HH, Shi YX, Huang SB, Xu JH, Huang JF (2007) The dynamic changes of
LDH isoenzyme 3 and D-dimer following pulmonary thromboembolism in canine. Thromb Res
120(4):575–583
Bowen ID, Ryder TA (1976) Use of the p-nitrophenyl phosphate method for the demonstration of
acid phosphatase during starvation and cell autolysis in the planarian Polycelis tenuis Iijima.
Histochem J 8:319–329
Breedveld AC, Schuster HJ, van Houdt R, Painter RC, Mebius RE, van der Veer C, van Egmond M
(2022) Enhanced IgA coating of bacteria in women with Lactobacillus crispatus-dominated
vaginal microbiota. Microbiome 10(1):1–11
9 Identification of Vaginal Secretions and Menstrual Blood 141

Byard R, Payne-James J (2015) Encyclopedia of forensic and legal medicine. Academic Press,
Cambridge
Castro J, Machado D, Cerca N (2019) Unveiling the role of Gardnerella vaginalis in polymicrobial
bacterial vaginosis biofilms: the impact of other vaginal pathogens living as neighbors. ISME J
13:1306–1317
Castro J, Rosca AS, Muzny CA, Cerca N (2021) Atopobium vaginae and Prevotella bivia are able to
incorporate and influence gene expression in a pre-formed Gardnerella vaginalis biofilm.
Pathogens 10(2):247
Cauci S, Monte R, Driussi S, Lanzafame P, Quadrifoglio F (1998) Impairment of the mucosal
immune system: IgA and IgM cleavage detected in vaginal washings of a subgroup of patients
with bacterial vaginosis. J Infect Dis 178(6):1698–1706
Chee WJY, Chew SY, Than LTL (2020) Vaginal microbiota and the potential of Lactobacillus
derivatives in maintaining vaginal health. Microb Cell Factories 19(1):203
Cossu C, Germann U, Kratzer A, Bär W, Haas C (2009) How specific are the vaginal secretion
mRNA-markers HBD1 and MUC4? For Sci Int Genet Suppl Ser 2(1):536–537
Deng L, Schilcher K, Burcham LR, Kwiecinski JM, Johnson PM, Head SR, Doran KS (2019)
Identification of key determinants of Staphylococcus aureus vaginal colonization. MBio 10(6):
e02321
Dobay A, Haas C, Fucile G, Downey N, Morrison HG, Kratzer A, Arora N (2019) Microbiome-
based body fluid identification of samples exposed to indoor conditions. Forensic Sci Int Genet
40:105–113
Elkins KM (2012) Forensic DNA biology: a laboratory manual. Academic Press, Cambridge
Ellem JA, Kovacevic D, Olma T, Chen SA (2017) Rapid detection of Group B streptococcus
directly from vaginal–rectal specimens using liquid swabs and the BD Max GBS assay. Clin
Microbiol Infect 23(12):948–951
Gajer P, Brotman RM, Bai G, Sakamoto J, Schütte UME, Zhong X et al (2012) Temporal dynamics
of the human vaginal microbiota. Sci Transl Med 4:132–152
Gipson IK, Spurr-Michaud S, Moccia R, Zhan Q, Toribara N, Ho SB, Gargiulo AR, Hill JA (1999)
MUC4 and MUC5B transcripts are the prevalent mucin messenger ribonucleic acids of the
human endocervix. Biol Reprod 60:58–64
Haas C, Klesser B, Maake C, Bär W, Kratzer A (2009) mRNA profiling for body fluid identification
by reverse transcription endpoint PCR and realtime PCR. Forensic Sci Int Genet 3(2):80–88
Hadžić G, Lukan A, Drobnič K (2011) Practical value of the marker MUC4 for identification of
vaginal secretion in penile swabs. For Sci Int Genet Suppl Ser 3(1):e222–e223
Hanson EK, Ballantyne J (2013) Highly specific mRNA biomarkers for the identification of vaginal
secretions in sexual assault investigations. Sci Justice 53(1):14–22
Hein M, Petersen AC, Helmig RB, Uldbjerg N, Reinholdt J (2005) Immunoglobulin levels and
phagocytes in the cervical mucus plug at term of pregnancy. Acta Obstet Gynecol Scand 84(8):
734–742
Hochmeister MN, Budowle B, Rudin O, Gehrig C, Borer U, Thali M, Dirnhofer R (1999)
Evaluation of prostate-specific antigen (PSA) membrane test assays for the forensic identifica-
tion of seminal fluid. J For Sci 44(5):1057–1060
Holtkötter H, Dias Filho CR, Schwender K, Stadler C, Vennemann M, Pacheco AC, Roca G (2018)
Forensic differentiation between peripheral and menstrual blood in cases of alleged sexual
assault—validating an immunochromatographic multiplex assay for simultaneous detection of
human hemoglobin and D-dimer. Int J Legal Med 132:683–690
Igoh A, Doi Y, Sakurada K (2015) Identification and evaluation of potential forensic marker
proteins in vaginal fluid by liquid chromatography/mass spectrometry. Anal Bioanal Chem
407:7135–7144
Jakubowska J, Maciejewska A, Pawłowski R, Bielawski KP (2013) mRNA profiling for vaginal
fluid and menstrual blood identification. Forensic Sci Int Genet 7(2):272–278
Jarosik GP, Land CB (2000) Identification of a human lactoferrin-binding protein in Gardnerella
vaginalis. Infect Immun 68(6):3443–3447
142 A. R. Isukapatla et al.

Joshi S, Sharma VK, Sarin AR (1990) Characterisation of vaginal secretion stains in forensic
cases—a critical review. In: 13th congress of the International Society for Forensic
Haemogenetics (Internationale Gesellschaft für forensische Hämogenetik eV) New Orleans,
October 19–21, 1989. Springer, Berlin, pp 355–357
Juusola J, Ballantyne J (2005) Multiplex mRNA profiling for the identification of body fluids.
Forensic Sci Int 152:1–12
Kamenev L, Leclercq M, Francois-Gerard C (1989) An enzyme immunoassay for prostate-specific
p30 antigen detection in the postcoital vaginal tract. J For Sci Soc 29(4):233–241
Kulczycki A, Brill I, Snead MC, Macaluso M (2017) Prostate-specific antigen concentration in
vaginal fluid after exposure to semen. Contraception 96(5):336–343
Lindahl G, Sta M, Areschoug T (2005) Surface proteins of Streptococcus agalactiae and related
proteins in other bacterial pathogens. Clin Microbiol Rev 18:102–127. https://doi.org/10.1128/
CMR.18.1.102-127.2005
Moncla BJ, Chappell CA, Debo BM, Meyn LA (2016) The effects of hormones and vaginal
microflora on the glycome of the female genital tract: cervical-vaginal fluid. PLoS One 11(7):
e0158687
Money D (2005) The laboratory diagnosis of bacterial vaginosis. Can J Inf Dis Med Microbiol
16(2):77–79
Paterson SK, Jensen CG, Vintiner SK, McGlashan SR (2006) Immunohistochemical staining as a
potential method for the identification of vaginal epithelial cells in forensic casework. J Forensic
Sci 51(5):1138–1143
Raffi RO, Moghissi KS, Sacco AG (1977) Proteins of human vaginal fluid. Fertil Steril 28(12):
1345–1348
Rönnqvist PD, Forsgren-Brusk UB, Grahn- Håkansson EE (2006) Lactobacilli in the female genital
tract in relation to other genital microbes and vaginal pH. Acta Obstet Gynecol Scand 85(6):
726–735
Sakurada K, Watanabe K, Akutsu T (2020) Current methods for body fluid identification related to
sexual crime: focusing on saliva, semen, and vaginal fluid. Diagnostics 10(9):693
Salzmann AP, Bamberg M, Courts C, Dørum G, Gosch A, Hadrys T, Haas C (2021) mRNA
profiling of mock casework samples: results of a FoRNAP collaborative exercise. Forensic Sci
Int Genet 50:102409
Schiff AF (1978) Reliability of the acid phosphatase test for the identification of seminal fluid. J
Forensic Sci 23(4):833–844
Schumann GB, Badawy S, Peglow A, Henry JB (1976) Prostatic acid phosphatase: current
assessment in vaginal fluid of alleged rape victims. Am J Clin Pathol 66(6):944–952
Seiden HOWARD, Duncan GT (1983) Presumptive screening test for seminal acid phosphatase
using sodium thymolphthalein monophosphate. J Assoc Off Anal Chem 66(1):207–209
Smith SB, Ravel J (2017) The vaginal microbiota, host defence and reproductive physiology. J
Physiol 595:451–463
Smith A, Kaczmar A, Bamford RA, Smith C, Frustaci S, Kovacs-Simon A, O’Neill P, Moore K,
Paszkiewicz K, Titball RW et al (2018) The culture environment influences both gene regulation
and phenotypic heterogeneity in Escherichia coli. Front Microbiol 9:1–13
Srinivasan S, Fredricks DN (2008) The human vaginal bacterial biota and bacterial vaginosis.
Interdiscip Perspect Inf Dis 2008(2008):750479
Tsai LC, Liu KL, Lin WY, Lin YC, Huang NE, Lee JCI, Hsieh HM (2022) Evaluation of three
commercial kits effective identification of menstrual blood based on the D-dimer. Forensic Sci
Int 338:111389
Valore EV, Park CH, Quayle AJ, Wiles KR, McCray PB Jr, Ganz T (1998) Human beta-defensin-1:
an antimicrobial peptide of urogenital tissues. J Clin Invest 101:1633–1642
Virkler K, Lednev IK (2009) Analysis of body fluids for forensic purposes: from laboratory testing
to non-destructive rapid confirmatory identification at a crime scene. Forensic Sci Int 188(1-3):
1–17
9 Identification of Vaginal Secretions and Menstrual Blood 143

Wen Y, Whitin J, Yu T, Cohen H, Polan ML, Chen B (2012) Identification of protein marker in
vaginal wall tissues of women with stress urinary incontinence by protein chip array. J Obstet
Gynaecol Res 38(1):89–96
Xia Q, Cheng L, Zhang H, Sun S, Liu F, Li H, Diao Y (2016) Identification of vaginal bacteria
diversity and it’s association with clinically diagnosed bacterial vaginosis by denaturing gradi-
ent gel electrophoresis and correspondence analysis. Infect Genet Evol 44:479–486
Zegels G, Van Raemdonck GA, Tjalma WA, Van Ostade XW (2010) Use of cervicovaginal fluid
for the identification of biomarkers for pathologies of the female genital tract. Proteome Sci 8:1–
23
Urine
10
Rudresh Channe, H. Manderiya, Tanya Chauhan, Alka Mishra,
Preeti Bhatnagar, Avinash Puri, and Nithyanandam Mahalakshmi

Abstract

Urine is a liquid waste product excreted by the kidneys through a process known
as urination, and it exits the body via the urethra. Typically, urine appears as a
clear, pale yellow solution, but its color can vary widely, ranging from colorless
to light yellow. The color of urine is primarily determined by the presence of
specific pigments, compounds, waste product concentrations, and hydration
levels.
Urine is a valuable substance for drug detection and monitoring drug exposure
because it generally lacks a significant amount of protein. It contains high
concentrations of metabolites, which allows for a longer detection window for
most drugs. As a result, urine is considered one of the most reliable sources for

R. Channe · H. Manderiya
Department of Forensic Science, Institute for Excellence in Higher Education, Bhopal, Madhya
Pradesh, India
T. Chauhan
Department of Forensic Science, Institute of Excellence, Bhopal, Madhya Pradesh, India
Department of DNA, Forensic Sciences, Chennai, Tamil Nadu, India
A. Mishra
Department of Forensic Science, Medi-Caps University, Indore, India
P. Bhatnagar
Department of Biology, Regional Forensic Science Laboratory, Gwalior, Madhya Pradesh, India
A. Puri (✉)
Department of DNA, Regional Forensic Science Laboratory, Bhopal, Madhya Pradesh, India
N. Mahalakshmi
Department of DNA and Forensic Biology, Regional Forensic Science Laboratory, Indore, Madhya
Pradesh, India

# The Author(s), under exclusive license to Springer Nature Singapore Pte 145
Ltd. 2024
A. Puri et al. (eds.), Fundamentals of Forensic Biology,
https://doi.org/10.1007/978-981-99-3161-3_10
146 R. Channe et al.

drug detection or monitoring drug usage. However, it’s worth noting that some
drugs may not be detectable at low levels in urine.

Keywords

Urine · Drug · Crystal · Nephrons

Urine is a liquid waste secreted by the kidneys by a process called as urination and is
excreted through the urethra. Usually urine is a transparent pale yellow solution, but
it can widely range from colourless to pale yellow. The colour of urine is primarily
influenced by the presence of certain pigments and compounds, as well as the
concentration of waste products and hydration level.
Urine can be extracted directly as urine is relatively free of protein. Urine contains
high concentrations of metabolites and provides longer detection time for most
drugs. Hence urine is considered as one of the best evidence for detection of drugs
or monitoring drug exposure. There are certain drugs that cannot be detected in low
levels in urine.
The specific gravity of urine is 1.005–1.030. The normal pH of urine is between
4.6 and 8.0. The colour of normal urine is that of clear straw, and consists mild odour
and the presence of some crystals and small cells from the tissues which line the
urinary bladder. Such components as sugars, proteins, bacteria, yeast cells, and
parasitic organisms are not present in normal urine. But such components are
detected in urine due to certain medical issues. Antibiotics such as penicillin and
foods such as red beets and asparagus may affect the odour and colour of urine.

10.1 Identification of Urine

The identification of urine can be crucial in forensic investigation particularly in

cases involving sexual assault. The stains of urine identification can be useful in the
investigation of homicidal cases involving ligature or manual strangulation.
Urine is performed less frequently by forensic laboratories because of the insen-
sitivity of the tests and low success rate with DNA profiling. Identifying or detecting
urine has been achieved through UV visual examination. Stains may fluoresce or
luminesce under alternate light sources, but diluted stains are harder to detect. There
are several methods for the identification of urine and have relied on identifying
inorganic ions and organic compounds that concentrate in urine. Urine detection
relies on identifying two organic compounds such as Urea and Creatinine. Both
these components are found in other body fluids such as blood, saliva, and semen.
Urea and creatinine are found at relatively high levels in liquid urine. As liquid urine
is absorbed into fabric surfaces, it spreads across the surface, effectively diluting the
test components.
10 Urine 147

10.2 Constituents of Urine

Normal constituents: Sodium chloride, uric acid, hippuric acid, potassium, oxalate,
amino acid, ammonia, traces of glucose, ketose, vitamins, hormones, calcium,
sulphate, and creatinine.
Abnormal constituents: Sugar, protein, ketone bodies, bile salts, etc.

10.3 Composition of Urine

The principal function of the urinary system is to maintain volume and composition
of body fluids within normal limits. The urinary system has a major role in excretion.
The urinary system, also known as urinary tract or renal system, consists of kidneys,
ureters, bladder, and urethra.
The primary route in which body eliminates substances is through the kidneys.
The kidney excretes body wastes and harmful chemicals into the urine. The forma-
tion of urine takes place in the kidneys, in the nephrons. The basic structural and
functional unit of the kidney is nephron. Each kidney consists of about one million
nephrons. The nephron is composed of a glomerulus (Bowman's capsule) and a renal
tubule.
The first step in the urine formation is filtration. The blood flows through
glomeruli, much of its fluid, except cells and large molecules and filters through
capillaries into Bowman's capsule. The preliminary form of urine is glomerular
filtrate, which consists of water, salts (sodium and potassium ions), glucose, and
urea (waste product). The filtrate then enters the renal tubule where the process of
reabsorption takes place. During the reabsorption process, water, glucose, nutrients,
and ions such as sodium are reabsorbed back into the blood. The secretion process is
the final step in urine formation. The secreted ions combine with the remaining
filtrate and become urine. The urine flows out of the nephron tubule into a collecting
duct. It passes out of the kidney through the renal pelvis, into the ureter, and down to
the bladder.
The nephrons of the kidney process blood and create urine through a process of
filtration, reabsorption, and secretion. Urine is about 95% water and 5% waste
products. Nitrogenous wastes excreted in urine include urea, creatinine, ammonia,
and uric acid. Ions such as sodium, potassium, hydrogen, and calcium are also
excreted (Figs. 10.1 and 10.2).
148 R. Channe et al.

Fig. 10.1 The nephron

10 Urine 149

Renal
Aorta column
Renal
Inferior pyramid
vena cava

Renal
artery Renal
cortex
Kidney
Renal
medulla

Renal vein Renal

pelvis
Ureter
Renal
Urinary
capsule
bladder
(peeled
back)
Urethra
Ureter

a b

Fig. 10.2 Human urinary system. (a) Anterior view of urinary system showing relationship of
kidneys, ureters, urinary bladder, and urethra. (b) A cross section of the human kidney showing the
cortex, medulla, and renal pelvis

10.4 Presumptive Assay

10.4.1 Identification of Urea

Urea is a waste product of many living organisms and is one of the major organic
components of human urine. Urea is a major waste product formed as a result of
breakdown of amino acids, particularly in the metabolism of proteins. These amino
150 R. Channe et al.

Fig. 10.3 Chemical reaction of DMAC assay

acids are metabolized and converted to ammonia, carbon dioxide, water, and energy
in the liver. Since ammonia is toxic, the liver converts it into a non-toxic compound
called urea, which is then safely transported in the blood to the kidneys. The normal
range of urea is 2.6–6.5 mm in human blood. Abnormal urea levels cause diseases
such as liver disease, real disease, hereditary urea cycle abnormalities, and dietary
problems.

10.5 DMAC Assay

The most commonly used assay for the forensic identification of urine stains is the
para-dimethylaminocinnamaldehyde (DMAC) assay. This is a simple and rapid
assay. This assay can be performed using colorimetric and fluorometric methods
(Fig. 10.3).
Colorimetric method is a colour producing method. In this method, a small (-1
cm2) portion of stain is cut and is extracted with distilled water (1 ml). This
extraction is then transferred into a piece of filter paper and is allowed to dry.
After drying add 0.1% DMAC solution. DMAC reacts with urea and it doesn’t
react with creatinine, ammonia, or uric acid. If urea is present then there is produc-
tion of pink-coloured (or magenta coloured) product. The appearance of pink colour
after or within few minutes applying the DMAC reagent is considered as positive
reaction. No colour change is considered as negative reaction (Fig. 10.4).
Fluorometric method is another method for the detection of urea and for
locating urine stains on bedding or clothing. In this method, a large piece of evidence
to be examined such as clothing is covered by moistened filter paper sheet containing
DMAC solution. The clothing (evidence) and filter are then wrapped in aluminium
foil sheet and are left overnight in a press. It should be ensured that the clothing
(evidence) is in close contact with filter paper. Alternatively, the layers can be heated
using an iron so that there is transferring of a small amount of stain into the paper.
The paper is then lifted, and the dyes and pigment can inhibit the fluorescence
(Fig. 10.5).

10.6 Urease Assay

The urease assay is another assay for the identification of urea. The urease assay
identifies those organisms that are capable of hydrolysing urea to produce ammonia
and carbon dioxide. In this method, ammonia is detected using an acid-base
10 Urine 151

Fig. 10.4 DMAC

colorimetric assay

Fig. 10.5 Fluorometric assay

Fig. 10.6 Biochemical reaction of urease

indicator. Bromothymol blue initially appears blue but undergoes a color change to
black when it reacts with manganese and silver nitrates (Fig. 10.6).
152 R. Channe et al.

10.7 Microscopic Crystal Assay

Microscopic examination of urea crystals and urea nitrate crystals converted from
urea and microscopic examination of crystals using xanthydrol have been used for
identification.

10.7.1 Identification of Creatinine

Creatinine is a waste product that comes from the normal wear and tear on muscles
of the body. During this process, phosphocreatine undergoes a breakdown in muscle
cells, resulting in the formation of creatine. This breakdown releases stored energy.
Creatine is then metabolized to creatinine. Creatinine is released from muscle cells
into blood. A small amount of creatinine is secreted by renal distal tubules whereas
serum creatinine is largely filtrated by renal glomeruli. Creatinine is present in urine,
blood, and also in semen (Fig. 10.7).

10.8 Colorimetric Assay (Jaffe’s Method)

The creatinine present in urine can be detected by Jaffe colour test. In this method,
creatinine produces quantitatively a red colour with picnic acid in alkaline medium.
Under alkaline conditions picnic acid is used to convert creatinine to creatinine
picrate. The product formed is bright red (Fig. 10.8).

10.8.1 Identification of Uric Acid

Uric acid has distinctive, strong absorbance at 293 nm and the quantification of the
absorbance at 293 nm is the simplest way for uric acid assay. Measuring the
disappearance of uric acid absorption at 293 nm after treating it with uricase is a
method to quantitatively determine uric acid levels. Uricase converts uric acid to
5-hydroxyisourate, causing a decrease in absorption at 293 nm. This change in
absorbance is directly related to uric acid concentration and is used for clinical
diagnoses and biochemical studies.

Fig. 10.7 Schematic view of the formation of creatinine

10 Urine 153

Fig. 10.8 Chemical reactions of Jaffe’s assay

10.9 Confirmatory Assay

10.9.1 Tamm–Horsfall Protein

Tamm–Horsfall protein is the most abundant urinary protein. It is also known as

“Uromodulin”. THP is exclusively produced by renal tubular cells of the distal loop
of Henle. THP is secreted into lumen from the apical plasma membrane of epithelial
cells. THP excretion decreases in stone formers, and therefore it was proposed as a
potential biomarker for kidney stone disease. A number of assays have been
developed to detect THP including electroimmunodiffusion, gel electrophoresis,
radio immunoassay, and enzyme- linked immunosorbent assay (ELISA).
RSID urine utilizes a polyclonal rabbit antibody that is specific to THP.
These methods are specific to THP that is a protein specific to urine and not
typically found in other body fluids like plasma, saliva, semen, sweat, or vaginal
secretion or fluids.

10.9.2 Identification of 17-Ketosteroids

The group of compounds known as 17-Ketosteroids are metabolites of hormones

produced by the adrenal cortex, the tests, and to a limited extent, the ovaries. These
are groups of metabolites derived from the breakdown of hormones, including
androgens, produced by adrenal cortex, testes, and ovaries. The derivatives of
17-Ketosteroids in human urine include androsterone, dehydroepiandrosterone
(DHEA), and etiocholanolone.
Androsterone is derived from sex hormones and it is a steroid metabolite. It is
produced as a result of the metabolism of testosterone, primarily in the liver.
Androsterone is a steroid hormone with weak potency of testosterone.
154 R. Channe et al.

Fig. 10.9 Results obtained using immunochromatographic assays for identification of THP in
urine. From left to right negative control, undiluted urine samples, diluted (1:10) urine samples, and
diluted (1:100) urine samples. A visible line in Test and Control zone indicates a positive result. The
visible line in Control zone only indicates a negative result

Dehydroepiandrosterone (DHEA) is an endogenous steroid hormone, produced

by adrenal gland, gonads, and brain. DHEA is also known as androstenolone. It is
synthesized from pregnenolone and is also related to androstenedione, testosterone,
and estrogens. This compound serves as a metabolic intermediate in the biosynthesis
of gonadal steroids.
Etiocholanolone (5-Androsterone) is an androgenically inactive metabolite of
testosterone and androstenedione and 5 epimer of androsterone.
17-Ketosteroids, such as androsterone, dehydroepiandrosterone (DHEA), and
etiocholanolone, can undergo further modification in the liver through
glucuronidation and sulfation. These compounds are present in urine as conjugates.
In glucuronidation, glucuronic acids are added to 17-Ketosteroids and in sulfation,
sulphates are transferred to 17-Ketosteroids. These conjugates are more soluble in
water than the non-conjugated 17-Ketosteroids as they contain charged moieties. A
new method for identifying human urine stains utilizes High-Performance Liquid
Chromatography (HPLC) analysis of five major 17-Ketosteroids conjugates.
The five major components of 17-Ketosteroids conjugates present in human urine
are androsterone glucuronide, androsterone sulfate, DHEA sulfate (Dehydroepian-
drosterone sulfate), etiocholanolone glucuronide, and etiocholanolone sulfate. The
analysis of 17-Ketosteroid conjugates is useful for the identification of human urine
stains. Thus these five conjugates of 17-Ketosteroids can be identified and quantified
by Liquid Chromatography–Mass Spectrometry (LC-MS) (Fig. 10.9).

Multiple-Choice Questions

1. In urease assay, urease hydrolyses urea to produce

(a) Ammonia and carbon monoxide
(b) Ammonia and carbon dioxide
(c) Calcium and carbon dioxide
(d) Phosphate and carbon dioxide
10 Urine 155

2. Jaffe test for urine sample is reaction between

(a) Urea and ammonium hydroxide
(b) Creatinine and ammonium hydroxide
(c) Urea and picric acid
(d) Creatinine and picric acid
3. Which of the following is considered as simple and rapid assay
(a) Immunological assay
(b) DMAC assay
(c) Urease assay
(d) Uricase assay
4. Which of the following is abnormal constituent
(a) Sugar
(b) Oxalate
(c) Amino acid
(d) Ketone
5. Which of the following is not involved in the urinary tract
(a) Kidney
(b) Urethra
(c) Lungs
(d) Ureters

Answers

1. (a)
2. (d)
3. (b)
4. (a)
5. (c)
Introduction to Sweat and Its Forensic
Analysis 11
Aditya Kumar Kar, Radha Patel, and Tanima Nandi

Abstract

Sweat analysis in forensic science is an important aspect in the field where the
results obtained can be used to determine the presence of toxic substances in the
body such as drugs, metals, toxins, etc. Advanced analysis of this bio-fluid can
also help us determine the number of persons present in the scene of crime due to
the determination of the composition of constituents present in the sweat. The
most important advantage of sweat evidence is that because of having unique
feature, it can help in distinguishing individuals easily. This is possible due to the
fact that sweat contains a large number of metabolites and amino acids that can be
detected on the surface, which tend to fluctuate over time due to the change in
lifestyle. Because of this reason, sweat stains have become important biological
evidence in cases like kidnapping, rape cases, and molestation which can be
found in the clothes, on the carpet, used handkerchiefs, or on the victim’s/
suspect’s body, etc. at various crime scenes.

Keywords
Thermoregulation · Secretion · Sweat · Fluids

Aditya Kumar Kar, Radha Patel and Tanima Nandi contributed equally with all other contributors.

A. K. Kar (✉) · R. Patel · T. Nandi

Department of Forensic Science, Adamas University, Barasat, Kolkata, India

# The Author(s), under exclusive license to Springer Nature Singapore Pte 157
Ltd. 2024
A. Puri et al. (eds.), Fundamentals of Forensic Biology,
https://doi.org/10.1007/978-981-99-3161-3_11
158 A. K. Kar et al.

11.1 Introduction

Identification of body fluids is an important aspect of forensic science and is based

on the principle of individuality and principle of comparison (Hanssen et al. 2017).
Sweat present in a crime scene is a vital source of evidence. An average square inch
of skin contains 650 sweat glands, meaning our bodies leave tiny amounts of sweat
on everything that we touch, be it our phones or the dining table or the knife that we
use (Jain and Bhattacharya 2020). Thus, sweat is an important evidence for the
forensic investigators, analyzing sweat left behind at a crime scene can be useful in
determining the number of people who were there thus narrowing down the list of
potential suspects (Jain and Bhattacharya 2020).

11.1.1 What is Sweat?

Sweat is a bodily secretion whose main function is to prevent overheating of the

body. It is a clear, salty liquid, and perspiration/sweating is the process by which our
body cools itself. The sweat comes out of the body through tiny holes known as
pores. It is a normal occurrence, when it is hot, or when we exercise, or excited or
nervous. It is produced by the glands present in the dermis, namely, eccrine,
apocrine, and apoeccrine. On average, a person can have 2–4 million sweat glands
present in the body, with most of them on the palms of hands and soles of the feet
(Taylor and Machado-Moreira 2013). Excessive sweating is known as hyperhidrosis
while a lack of it is known as hypohidrosis.
Sweat is normally a transparent biofluid with low tonicity and a slightly acidic
nature with a pH between 4 and 6. It has been found out that basic drugs accumulate
in sweat then blood based on the pH partition theory, all the same making it
important evidence for analysis and study. Although sweat evidence is very hard
to find and collect and has a limited scope, examination and analysis of sweat
evidence or samples is very vital from the forensic point of view (Jadoon et al.
2015). Sweat forms the basis of analysis of latent fingerprints in crime scenes. The
examination of sweat can help us determine a specific odour or an individual’s blood
group, for an instance through the Gee’s urea nitrate test, which we will study later in
this chapter.

11.1.2 What Causes Sweat?

Sweating is caused by the sweat glands present in our body. When our body
temperature rises, the glands, namely, eccrine, and apocrine release fluids cool our
body as they evaporate (Bovell 2015). It is regulated by the sympathetic division of
the autonomic nervous system and we have little control over it. Some of the simple
causes of sweating are listed below:
11 Introduction to Sweat and Its Forensic Analysis 159

• Emotion and stress, for instance, anger, fear, embarrassment, anxiety, etc.
• Elevated temperature
• Any illness such as cancer, fever, hypoglycemia, or specific medications like
painkiller
• Specific type of foods such as spicy foods, caffeinated drinks, alcoholic
beverages, etc.
• Menopause

11.1.3 Functions of Sweat

While it has already been discussed that the most essential function of sweat is
thermoregulation, some of the other functions of sweat which are equally as vital are
given below (Bovell 2015).

• Prevents overheating of the body

• Excrete waste products
• Emotional response
• Keeping the stratum corneum moist to ensure better tactile skills and elasticity of
the palms and soles
• Electrolyte balance

11.2 Biology of Perspiration

11.2.1 Sweat Glands

The sweat producing glands also known as sudoriferous glands are widely
distributed in our skin. A person on average can have more than 2.5 million sweat
glands. The three main types of sweat glands are as follows:

11.2.1.1 Eccrine Glands

They are the most numerous and are widely distributed all over the body. They are
found especially in higher concentration on the palms, soles of feet, and the
forehead. Eccrine glands may be seen in various stages of development at a time.
Eccrine sweat glands first appear on the palms and soles during the fourth month of
gestation. By the eighth fetal month, they resemble adult sweat glands, but are not
fully functional until about 2 years of age. It should be noted that no new sweat
glands are formed after birth (Bovell 2015).

Structure of Eccrine Sweat Gland

Eccrine glands are simple, coiled tubular glands. The secretory part lies in the dermis
and the glands open to the skin surface through ducts or pores. To understand about
this a bit more, take a look at the picture given below.
160 A. K. Kar et al.

The secretory part of the gland displays a single-layered structure, consisting of

three types of cells:

1. Clear cells
2. Dark cells
3. Myoepithelial cells

The cells rest on the basal lamina and are arranged in the form of pseudostratified
epithelium.
The ductal part of the gland is divided into two parts:

1. Intradermal
2. Intraepidermal

This part extends from half of the basal coil in dermis to opening at the surface. It
consists of basal cell, ductal lumen, and luminal cell. It lacks myoepithelium, clear
cells and dark cells. The cells are spread out in the form of stratified cuboidal
epithelium (Bovell 2015).

11.2.1.2 Apocrine Glands

Apocrine sweat glands are associated with hair follicles and are found mostly in the
armpits, the groin, and the area around the nipples of the breast. Apocrine glands in
the skin are scent glands, and their secretion usually has an odour. Apocrine glands
have a low secretory output and hence no significant effect on temperature regulation
of the body (Fortney and Vroman 1985). Apocrine glands are larger than eccrine
glands, with a diameter 10 times greater. They are made up of two primary parts: a
coiled secretory structure and an accompanying straight duct. They first appear
during the fourth to fifth month of gestation. They are dormant postnatally until
they develop their secretory portion and are functional at around puberty under the
influence of ongoing hormonal activity (Fortney and Vroman 1985). They can
occasionally be found on the eyelids, abdomen, and scalp too.

Structure of Apocrine Sweat Glands

The apocrine sweat glands are divided into two main parts which are subdivided into
the following:

1. Ductal part: intradermal & intraepidermal

2. Secretory part: coiled (lower dermis)

The secretory part where the gland is located lies in the lower dermis or the
subcutaneous fat and is made up of only secretory cells. The secretory portion of the
apocrine gland contains several large granules. The gland is made up of a single layer
of columnar or cuboidal cells, that rest on a layer of myoepithelial cells (Groscurth
2002). The ductal part is made up of a layer of basophilic cells with a periluminal
eosinophilic cuticle. When tip of the epithelial cord has reached the level of the
11 Introduction to Sweat and Its Forensic Analysis 161

sebaceous gland, the intradermal ductal lumen begins to form. The secretion and
cellular detritus move mostly through the apocrine duct into the pilosebaceous
follicle present in the infundibulum, but they can be found opening right into the
epidermal surface (Saga 2002).

11.2.1.3 Apoeccrine Gland

Apoeccrine glands are mixed glands that are found in the adult human axillae and
share some of the functional and morphological features of both the eccrine and
apocrine gland. Apoeccrine sweat glands secrete fluid continuously somehow com-
parable to eccrine sweat glands. They represent less than 10% of all glands seen in
human axilla. Apoeccrine glands can be found in the anogenital region. They are
larger than eccrine glands but smaller than apocrine glands and are found in all levels
of the dermis. Apoeccrine glands develop from eccrine like precursor glands that
underwent ‘apocrinization’ during puberty due to the nearby growth factors. They
consist of myoepithelial cells, apocrine secretory, and eccrine secretory cells (Bovell
2015).

Structure of Apoeccrine Gland

A typical morphological characteristic of this gland is the irregular structure of the
tubule and as well as the cells. The structure of apoeccrine sweat glands are
somehow similar to that of the eccrine gland. The secretory segment is irregularly
dilated, and the duct is long and thin and comparable to the eccrine gland. The duct
opens into the skin surface.

11.2.2 How Sweating Occurs?

Sweating is mainly caused by three different physiological stimuli such as:

• Temperature
• Gustatory
• Emotional

11.2.2.1 Thermoregulatory Sweating

Sweating caused due to temperature or heat induced sweating starts at the forehead.
When the temperature of the body rises due to fever or exercise or the environment,
the body’s sweat gland releases a salty liquid known as sweat which when
evaporates leaves behind the sensation of cooling. This type of sweating helps
dissipate excess heat and prevents overheating of the body (Sawka and Wenger
1988).

11.2.2.2 Gustatory Sweating

Eating very spicy food can cause physiologic gustatory sweating in many people due
to a reflex known as trigeminovascular reflex. Gustatory sweating is characterized by
profuse sweating immediately after or during the ingestion of food. The
162 A. K. Kar et al.

trigeminovascular reflex naturally occurs symmetrically on the face or scalp and

predominantly over the nose, lips, neck, and forehead. Gustatory sweating is typi-
cally done by eccrine sweat glands (Wilke et al. 2007).

11.2.2.3 Emotionally Induced Sweating

Emotionally induced sweating is induced by emotional stimuli such as nervousness,
fright, anxiety, or anger, etc. Although this type of sweating can occur all over the
body, this type of sweating is most evident on the face, axilla, palms, soles of feet,
and armpits. This is basically a result of high eccrine sweat gland densities at this
body sites.

11.3 Composition of Sweat

The overall pH of sweat ranges between 4 and 6. While 99% of the content of sweat
is water, it has other important components too. The various constituents of sweat are
listed below (Fig. 11.1)

Small amounts of Water (99%)

some ingested drugs

Some salts (mostly

Vitamin c NaCl)

Dermcidin- A
Antibodies microbe killing
protein
COMPONENTS
OF SWEAT

Lactic acid
Potassium- 0.2 mg/l

Traces of metabolic
waste Sodium- 0.9 mg/l

Magnesium- 0.0013
mg/l Calcium- 0.015 mg/l

Fig. 11.1 Flowchart represent composition of sweat

11 Introduction to Sweat and Its Forensic Analysis 163

11.4 Identification of Sweat

Primarily, the examination that should be done upon finding a suspected sweat
sample in the crime scene is to see is that the particular sample in question is
sweat or not? Sweat is rich in chemicals and can indicate the physiological state of
the body, and sometimes can be the indicator of the emotions if a certain individual
is/was going through. Sweat contains metabolites (glucose, lactose, etc.), trace
elements, electrolytes, and small macromolecular components. Sweat analysis can
substitute blood analysis. Though the chemical composition of sweat samples is
complex, the collected amount is usually small (Yu and Sun 2020). It is very
important to differentiate the components of sweat and to also improve the suscepti-
bility of sweat detecting tests or sensors for sweat analysis.

11.4.1 Preliminary Examination of Sweat

While sweat at times can be identified through odour and its consistency, it is
important to perform sweat identification examinations to get surety of the sample
in question. Although there are not many preliminary tests prescribed for sweat
analysis, the most common preliminary tests done to see if a given sample is sweat
not are Odour test and Gee’s Urea test.

11.4.1.1 Odour Test

A tiny amount of the suspected sweat sample is collected and heated. The particular
scent that it gives off is noted and can be used for the purpose of investigation if it
provides any certain clue pertinent to the case.

11.4.1.2 Gee’s Urea Test

The sweat sample is at first tested or examined for the presence of urea using the
Gee’s urea nitrate test.

Procedure
• The questioned sample is extracted using acetone and the acetone extract with the
help of evaporation is concentrated.
• The concentrated is then filtered and evaporated until it is dried.
• The residue is then treated with acetone solution and then the mixture is mixed
with the help of a glass rod.
• A drop of the solution is taken on a slide and then it is allowed to dry.
• Nitric acid solution with the help of glass rod is added and then the slide is
covered with coverslip and observed under the microscope for urea nitrate
crystals for the indication of the presence of urea in the sample.
164 A. K. Kar et al.

11.4.2 Confirmatory Examination of Sweat

There are many tests that are performed for the analysis of sweat stain sample with
the Dermcidin test being one of the most reliable and efficient ones. Let us get an
overview on the various confirmatory examinations done on sweat sample for the aid
of investigation.

11.4.2.1 Dermcidin Test Using Elisa

Dermcidin present in sweat plays a vital role by protecting the epithelial barrier from
infections. In the field of forensic, it can be used as a biomarker for confirmatory
analysis of sweat identification. The detection of dermcidin in sweat sample can be
performed by utilizing the ELISA technique. This method is highly sensitive and is
able to detect dermcidin in sweat samples that are diluted 10,000 times. Dermcidin is
encoded by the DCD gene (Schittek et al. 2001). The detection of DCD by ELISA
was examined in 10 mL of sweat. It produced very high values compared to the other
body fluids, even in the 10,000-fold dilution.

11.4.2.2 Instrumental Analysis of Sweat

SEM-EDX (Scanning Electron Microscope-Energy Dispersive X-ray Analysis)

Scanning electron microscope (SEM) has been acquired to investigate the morphol-
ogy, microstructure, and composition of the constituents in the sweat sample. The
same instrument, coupled with an energy-dispersive spectrometer (EDX), is used to
carry out the energy-dispersive X-ray spectroscopy to determine the presence and
distribution of the chemical elements in samples. SEM paired with EDX helps to
establish the relative concentrations of metal, phosphorus, sulfur, chlorine, potas-
sium, calcium, and different metal traces. The sweat analysis showed that chlorine
and metal were the sole systematically clear peaks among the various samples, and
metallic element was generally visible. The massive chlorine peak is employed as
the basis of comparison and identification (Quinton 1978).

Fluorescence Spectroscopy
The fluorescence sensing technique can be used to detect sweat by comparing the
levels of electrolytes and metabolites found in the sample collected from a scene of
crime. This technique depends on the link between analyte concentration and light
intensity. Once the fluorescent material is exposed to specific excitation light source,
it generates light. Once the fluorescent material undergoes a particular reaction with
the target analyte, the fluorescent signal changes. The benefits of fluorescence
sensing embody high sensitivity, strong acuteness, and easy use. It can be used to
detect metabolites (such as lactate and urea) and electrolytes (such as Cl-, Na+,
Cu2+) in sweat. This technique can also help us to find and detect the levels of
specific metals (possibly harmful and present in risky levels) present in the body
which are excreted by sweat, for comparison and analysis (Yu and Sun 2020).
11 Introduction to Sweat and Its Forensic Analysis 165

GC-MS (Gas Chromatography–Mass Spectrometry) for Drug Detection

in Sweat
Sweat can be used as a biological matrix for the testing of drugs subject to abuse.
There are many tests that are prescribed to detect the presence of sweat of which the
most utilized ones are GC-MS electron ionization. The basic principle of this
instrument involves the patch test technology for qualitative detection of previously
used drugs by individuals. There are various types of drugs that can be detected with
the help of instrumental analysis of sweat sample such as such as codeine, heroin,
fentanyl, morphine, etc. (Jadoon et al. 2015).

11.5 Conclusion

However, sweat as studied above proves to be an essential biofluid for investigation

purposes. Forensic experts claim that the investigator often tend to overlook the
presence of sweat in crime scene, which is a miscalculation on their part. Sweat
analysis plays an important role in testing the presence of drugs in an individual’s
body and also for the presence of poisons and various harmful metals. It has been
found that upon intensive analysis of sweat sample, DNA can be extracted (provided
skin cells are included in the oils and fluids of sweat) which as we all know serves as
the pinnacle for the purpose of investigation and for the means of individual
identification (Vandewoestyne et al. 2013). Sweat stains have become important
biological evidence in cases like kidnapping, rape cases, molestations, etc. It can be
present on any kind of clothing or, for instance, on the victim’s/suspect’s body which
can associate us to suspect. It can also be present on surfaces/objects touched by
victim or suspect (Lee et al. 2001). Sweat, which is a skin secretion, contains various
metabolites and the levels of those are extremely distinctive to each of us. Three of
those metabolites are lactate, urea, and glutamate. Lactate appears in higher concen-
tration in our sweat and varies greatly based on a person’s lifestyle. Glutamate and
urea are found in different parts of sweat and are also highly concentrated. Studies
show that the chances of any two people having identical levels of all these above-
mentioned metabolites is almost nil, thus proving to be one of the various reasons to
study sweat and its effectiveness in aiding an investigation. Although as already
been discussed sweat can be used to find out how many individuals were present at
the scene of crime, it has been advised that it should not be held as the only basis of
comparison. Contrary to DNA, which always remains constant, a person’s sweat
construct is always changing and based on their lifestyle. Therefore, while these tests
related to sweat can determine the number of personnel present at the crime scene, it
is not reliable for determining who was at the crime scene. Sweat as evidence
regarding to these types of cases should be utilized in concurrence with traditional
DNA testing and investigation procedures rather than as a replacement.
166 A. K. Kar et al.

References
Bovell D (2015) The human eccrine sweat gland: structure, function and disorders. J Local Glob
Health Sci 2015(1):5
Fortney SM, Vroman NB (1985) Exercise, performance and temperature control: temperature
regulation during exercise and implications for sports performance and training. Sports Med
2:8–20
Groscurth E (2002) Anatomy of sweat glands. Curr Probl Dermatol 30:1–9
Hanssen EN, Avershina E, Rudi K, Gill P, Snipen L (2017) Body fluid prediction from microbial
patterns for forensic application. Forensic Sci Int Genet 30:10–17
Jadoon S, Karim S, Akram MR, Kalsoom Khan A, Zia MA, Siddiqi AR et al (2015) Recent
developments in sweat analysis and its applications. Int J Anal Chem 2015:164974
Jain M, Bhattacharya B (2020) Examining the significance of saliva and sweat in forensic science. J
Legal Stud Crim Justice 1(1):6–15
Lee HC, Palmbach T, Miller MT (2001) Henry Lee’s crime scene handbook. Academic Press,
Cambridge
Quinton PM (1978) Techniques for microdrop analysis of fluids (sweat, saliva, urine) with an
energy-dispersive X-ray spectrometer on a scanning electron microscope. Am J Physiol Renal
Physiol 234(3):255–259
Saga K (2002) Structure and function of human sweat glands studied with histochemistry and
cytochemistry. Prog Histochem Cytochem 37(4):323–386
Sawka MN, Wenger C (1988) Physiological responses to acute exercise-heat stress. Army Research
Inst of Environmental Medicine, Natick
Schittek B, Hipfel R, Sauer B, Bauer J, Kalbacher H, Stevanovic S et al (2001) Dermcidin: a novel
human antibiotic peptide secreted by sweat glands. Nat Immunol 2(12):1133–1137
Taylor NA, Machado-Moreira CA (2013) Regional variations in transepidermal water loss, eccrine
sweat gland density, sweat secretion rates and electrolyte composition in resting and exercising
humans. Extreme Physiol Med 2(1):1–30
Vandewoestyne M, Van Hoofstat D, Franssen A, Van Nieuwerburgh F, Deforce D (2013) Presence
and potential of cell free DNA in different types of forensic samples. Forensic Sci Int Genet 7(2):
316–320
Wilke K, Martin A, Terstegen L, Biel S (2007) A short history of sweat gland biology. Int J Cosmet
Sci 29(3):169–179
Yu H, Sun J (2020) Sweat detection theory and fluid driven methods: a review. Nanotechnol Precis
Eng 3(3):126–140
Forensic Significance and Examination
of Faecal Matter 12
Varsha Rani Patel, Himani Sharma, Shivam Chourasiya,
and Tilak Ram Chandrakar

Abstract

Faecal matter is an often overlooked but possibly significant piece of evidence. It

is found in a variety of casework scenarios, ranging from trace amounts to whole
stool deposits. Small amounts of faeces can be transmitted to the sodomite’s penis
or other objects introduced anally in circumstances of sexual assault. In contrast, a
criminal may purposely or unintentionally defecate at the site of a crime, leaving
behind an entire bowel movement. In many situations, the identification and
individualization of faeces can establish a relationship between the victim and
the perpetrator.
Animal metabolism produces faeces as an excretory by-product. It is made up
of bilirubin, muscle fibres, and undigested cellular and vegetable material. Its
identification may occasionally be quite important, particularly in sodomy
situations. For more than a century, faeces have been examined as part of criminal
investigations. In particular, faecal analysis was used in 1948 to connect a
suspect's shoes to a crime scene in a burglary case. Finding a connection between
the reference sample and the faecal evidence is one of the goals of faecal analysis,
which could help connect a suspect to a crime scene. The identification of faecal
matter is valuable in providing important information for a criminal investigation.
For example, the presence of faecal matter may corroborate a sexual assault
involving sodomy, assault with faecal matter, vandalism, bestiality, and burglary
during which the perpetrator defecated at the scene, faeces can be found as
evidence on the penile swab and in the clothing. If faeces are already present at
the crime scene, faeces may be transferred to the suspect's shoes or clothing. In

V. R. Patel (✉) · H. Sharma · S. Chourasiya · T. R. Chandrakar

Faculty of Forensic Science, Medi-Caps University, Indore, Madhya Pradesh, India
e-mail: [email protected]; [email protected];
[email protected]; [email protected]

# The Author(s), under exclusive license to Springer Nature Singapore Pte 167
Ltd. 2024
A. Puri et al. (eds.), Fundamentals of Forensic Biology,
https://doi.org/10.1007/978-981-99-3161-3_12
168 V. R. Patel et al.

sodomy and bestiality, the suspect’s faeces play a key function in determining his
or her drug habit. It has also been noticed that the ingestion of certain medicines
causes faeces to turn green, black, and red.
Alkaline phosphatase, IgA immunoglobulins, intestinal parasites, pancreatic-
amylase, urobilinogen and urobilin, and vegetable remains have been analysed as
part of forensic methods for the characterization of human faeces. It can also be
utilised for blood grouping, hence aiding in the individualization of individuals.
Today, the forensic DNA analysis of sloughed intestinal epithelial cells seen in
faecal debris may efficiently determine the unique properties of a faecal sample as
it enables nuclear DNA-based discrimination and CODIS comparison.

Keywords

Faecal matter · Urobilinogen · Urobilin · Stercobilin

12.1 Formation of Faeces

Food that has been broken down by the digestive system results in a specific sort of
waste material called faeces. Undigested food items, shed intestinal epithelial cells,
intestinal bacteria, bile pigments, electrolytes, and water can all be found in human
faeces. The final stage of digestion causes the intestines to produce faeces. Initially,
liquid faeces travel to the colon. On the small intestine’s surface, the majority of the
nutrients are absorbed. The surface of the lumen in the large intestine is where water,
sodium, and chloride are absorbed. Faeces are formed out of the leftover luminal
contents. The stomach retains food for between 2 and 6 h. The small intestine and
large intestine each add an additional 3–5 h and 12–24 h, respectively, to the total
time required for transit (Fenwick et al. 1983).

12.2 What is in Human Faeces?

It has been determined that, in general, human faeces is made up of 75% water and
25% solid material, which is made up of 30% dead bacteria, 10–20% fat, 10–20%
inorganic material, 2–3% proteins, and 30% of residual food that hasn't been
digested. In addition to bile pigments (bilirubin) and dead leukocytes (white blood
cells), cell debris shed from the intestinal mucosa is also excreted in the waste
material (Shleenkova et al. 2015). The number of excretions per person per day
ranges from 135 to 270 g, and 88 to 97% of the compounds are organic after drying.
Skatole and thiols contribute to the characteristic odour of faeces. These substances
are composed of sulphur, amines, and carboxylic acids. Skatole is generated from the
amino acid tryptophan. The brown colour of faeces results from the activity of
bacteria on bilirubin, the end product of haemoglobin breakdown (red blood
cells) (Nakonechna et al. 2017).
12 Forensic Significance and Examination of Faecal Matter 169

12.3 Urobilinogen: Its Formation

The source of urobilinogen is bilirubin. Bilirubin is created by your body as it

normally breaks down old red blood cells. Bile, a substance that aids in food
digestion in your intestines, is created by your liver using bilirubin. Bilirubin
needs to be processed by the body before it can be eliminated. In this context, the
term “metabolism” refers to the production and disintegration of bilirubin for
elimination. Bilirubin metabolism occurs in three stages:

1. Initial, pre-hepatic
2. Hepatic
3. Post-hepatic

12.3.1 The Pre-hepatic Phase

The pre-hepatic phase involves

1. The breakdown of old red blood cells to release haemoglobin.

2. The pigment heme and globin are produced from haemoglobin. Globin is
disassembled into its component amino acids and then recycled by the body.
3. Iron and the green pigment biliverdin are produced when heme is broken down.
4. The enzyme biliverdin reductase transforms the substance biliverdin into uncon-
jugated bilirubin.
5. Blood albumin binds to unconjugated bilirubin and carries it to the liver.

12.3.2 Hepatic (Liver) Phase

Unconjugated bilirubin is changed by UGT into its conjugated form during the
hepatic (liver) phase. Now that bilirubin is soluble, it can be expelled.

12.3.3 Post-hepatic (Post-liver) Phase

Conjugated bilirubin is discharged into the small intestine as a component of bile

during the post-hepatic (post-liver) phase. In the small intestine, bile breaks down
fat before continuing on through the digestive system. When it gets to the colon, also
known as the large intestine, it is deconjugated and changed into urobilinogen.
Urobilinogen is converted to stercobilin, which gives faeces their brown colour, in
the stomach to an extent of about 80%. Urobilinogen’s remaining 20% is either
recycled back to the liver via re-absorption into the blood or it is transported to the
kidneys where it is transformed to urobilin and then eliminated as urine. A portion of
the reason why urine is yellow is due to urobilin.
170 V. R. Patel et al.

12.4 Identification Assays

The forensic study of faeces frequently requires the identification of faecal stains on
swabs and clothing, from which only minute amounts of sample may be obtained.
For the analysis of faeces stains, macroscopic, microscopic, and chemical testing can
be helpful. The identification of urobilinogen is by far the most prevalent chemical
test conducted on faeces. Urobilinogen, including urobilin and stercobilin, is derived
from the breakdown of heme and is expelled in faeces. Apart from these, DNA
identification and analysis of faecal microbiota plays a crucial role in
individualisation (Barbosa 2012).

12.4.1 Macroscopic Analysis

Macroscopic examination of the general appearance and properties of faeces majorly

include colour and odour, conducted primarily through sight and smell. The general
qualities of scent and hue are as follows:

• Colour
Faecal matter is often dark due to urobilinogen; however, in newborns, it is
yellow due to unaltered bilirubin and a milk-based diet.
Abnormal Colour: yellow, green, blood spot, brilliant red, and black
• Odour
Aromatic scent attributable to indole and skatole.
Increased smell is a result of excessive protein intake.
Common in infants and adults, sour milk digestion is normal in infants.
Gross—Extreme diarrhoea (Maclagan 1946).

12.4.2 Microscopic Analysis

During the microscopic examination, the probable stained regions are softened with
normal saline or distilled water for about 30 min. Scrapping of soften stained region
is taken on a sterile slide followed by adding 1–2 drops of normal saline and 1 drop
of Lugol’s Iodine (aqueous iodine) are added to a little scraping of the stain placed on
a microscope slide. The microscopic slide is covered with a cover slip and viewed
under a microscope to identify undigested food particles such as vegetable residues
and muscle fibres. In addition to huge numbers of bacteria, pus cells, epithelial cells,
Entamoeba histolytica cysts, and giardia intestinal ova of intestinal helminths are
occasionally detected (Muwonge et al. 2010).

12.4.2.1 Why Lugol’s Iodine?

Lugol’s Iodine is a fast, non-specific contrast dye that is applied to direct wet mounts
of the faecal material to help differentiate parasitic cysts from host white blood cells,
which aids in the investigation of microorganisms that vary from person to person.
12 Forensic Significance and Examination of Faecal Matter 171

Lugol’s Iodine stain is designed for use with wet mount preparations and concentra-
tion procedures to detect intestinal protozoa and helminth ova and larvae. Numerous
protozoa and cysts absorb the dye and look brown, while the remainder of the sample
remains transparent. Iodine discolours protozoan nuclei and intracytoplasmic
organelles brown, hence facilitating their identification. Lugol’s Iodine is a very
concentrated substance that must be diluted before usage. Strong iodine solutions
tend to agglomerate faecal particles and disrupt the refractility of other
microorganisms, necessitating dilution. A 100 ml of Lugol’s Iodine requires 5.0 g
of crystalline iodine and 10.0 g of potassium iodide World Health Organization
(2019).

12.4.2.2 Suggested Procedure

(a) Before usage, dilute Lugol’s Iodine with sterile deionized water at a ratio of 1:5
(it is recommended that working solution should be prepared fresh approxi-
mately every 3 weeks).
(b) Mix a little amount (2 mg) of faeces with a drop of sterile physiological (0.85%)
saline on a clean glass slide to create a direct smear of the material.
(c) Cover the sample with a coverslip and inspect the wet mount preparation for the
presence of organisms (motile protozoa and others). The organisms are exceed-
ingly pale and translucent, making them easier to view in dim light.
(d) After a thorough examination of the wet mount, a drop of Lugol’s Iodine
(working solution) may be inserted at the edge of the coverslip, or a new
mount may be produced using iodine alone. If desired, the prepared slide can
be sealed.
(e) Examine the microscope slide for undigested materials or any brown organism
entities World Health Organization (2019).

12.4.3 Chemical Test

Faecal stains can be analysed with the aid of chemical assays. Urobilinogen detec-
tion is by far the most frequent chemical analysis done on faeces. Urobilinogen, such
as urobilin and stercobilin, is produced by the breakdown of heme and expelled in
faeces. Using the Schlesinger and Edelman tests, urobilinogen can be identified.

12.4.3.1 Schlesinger Test

In the Schlesinger test, a sample is combined with saturated zinc acetate in ethanol
solution to generate aurobilinoid–zinc chelation complex, which emits a distinctive
green fluorescence under UV light.
The standard implementation of the Schlesinger’s test, however, is relatively
insensitive to minute urobilin. A new process that has been updated and utilised
for the past 2 years has proven to be significantly more sensitive. The modification
consists primarily of extracting the zinc-urobilin complex with chloroform and
observing the chloroform solution under filtered ultraviolet light for a golden-yellow
fluorescence.
172 V. R. Patel et al.

Method: Add a few crystals of ammonium persulphate to 5 ml of urine in a small

separator and shake vigorously to dissolve. Mix in 5 ml of zinc acetate saturated with
alcohol. Add 10 ml of chloroform, mix gently, allow to separate, and transfer the
chloroform layer to a test tube. Add a few drops of pure alcohol to clear, then blend,
and analyse under ultraviolet light filtration. The presence of urobilin is indicated by
the observation of a golden-yellow fluorescence (Attwood et al. 2006).

12.4.3.2 Edelman Test

Edelman’s test is an altered version of Schlesinger’s test. A sample is treated with a
solution of mercuric salt to produce a pink compound. Fluorescence is produced by
further zinc salt treatment. However, in the Edelman test, less fluorescence is
recorded than in the Schlesinger test.
With these tests, it is common to produce inconclusive and inconsistent findings,
as faeces do not always glow visibly. Furthermore, the intensity of the detected
fluorescence differs between samples. However, a spectrometric measurement of the
fluorescence detection of faecal urobilinogen based on the principle of the
Schlesinger test can boost the reliability and selectivity of the tests (Lloyd and
Weston 1982).

12.4.4 Spectrometric Study of Fluorescence Produced by

Urobilinogen

Fluorescence spectra of faecal material extracts in the presence of zinc ion exhibit the
well-known green fluorescence utilised in the Schlesinger test for urobilinogen, as
well as various additional fluorescence. All of these can be confirmed in a single
spectrum by the synchronous fluorescence approach, which, with new extraction
conditions, permits the detection of urobilinogen fluorescence in as little as 50 ng of
human faeces. This is a 1000-fold reduction in the detection limit of the original
visual approach, and a significant gain in selectivity. On the fluorescence, numerous
reagents’ effects have been investigated. In Edelman’s version of the test, the
presence of mercuric ion significantly suppresses fluorescence.
Method: 1 ml of zinc acetate solution (1% zinc acetate methoxy ethanol solution
and 0.2% Tris) is applied to a dry sample. The resulting suspension is then sonicated
for 5 min, heated to 100°C for 10 min, cooled, and centrifuged. Excitation and
emission peaks at 507 and 514 nm, respectively, can be used to determine the
presence of urobilinogen (Abdalla et al. 2017).

12.4.5 DNA in Faeces

From the stomach’s cardiac opening to the anal canal, the human digestive tract is
lined with columnar epithelium. Human DNA extracted from faeces is derived from
gastrointestinal epithelial cells.
12 Forensic Significance and Examination of Faecal Matter 173

In forensic investigations, the phenol-chloroform extraction method is a success-

ful, general-purpose technique. The organic procedure comprised the following:

1. A cell digestion step (12 h incubation at 56°C in 400 μl of stain extraction buffer
[10 mM Tris, 10 mM EDTA, 100 mM NaCl, 39 mM dithiothreitol, 2% SDS,
20 μl of 10 mg/ml proteinase K, and pH 8.0]).
2. A phenol/chloroform/isoamyl alcohol extraction step.
3. A Centricon R# YM-100 (Amicon) concentration and recovery step. By
vacuum-enhanced evaporation (Savant DNA SpeedVac R# DNA110) and/or
dilution with sterile water, the faecal DNA retentates are adjusted to a final
volume of roughly 45 μl.

The presence of degradative and inhibitory compounds, including plant

polysaccharides and bile salts, in faeces that co-extract with the target DNA poses
a significant challenge. In addition, these compounds may interfere with the study of
other co-occurring physiological fluids using traditional techniques. However, effi-
cacious methods for removing faecal inhibitory compounds have been devised. In
one approach, DNA samples are diluted to lower the inhibitor concentration. In other
techniques, hexadecyl trimethyl ammonium bromide or chromatographic cellulose
fibre powder are utilised with an organic extraction (Ghatak et al. 2013).

12.4.5.1 Advancements in DNA Extraction from Faecal Matter

QIAGEN Inc. (Valencia, CA) has developed a commercially available kit for the
extraction of nuclear DNA from human faeces using a reasonably rapid silica-based
extraction method. Included in the package is a reagent that purportedly eliminates
the faeces-derived PCR inhibitors. In addition, the method permits the preferred lysis
of human cells over bacterial ones. Vandenberg and van Oorschot examined the
effectiveness of the kit. Using the QuantiBlot Human DNA Quantitation Kit (Perkin
Elmer, Foster City, CA), the D17Z1 primate-specific probe, and the SF
Microfiltration Apparatus, extracted DNA samples can be quantified by slot blotting
(Bio-Dot) followed by amplifying the faecal DNA using the AmpFSTR R# Profiler
Plus TM PCR Amplification Kit (PE Biosystems, Foster City, CA). Further, STR
typing can be performed with capillary electrophoresis and laser-induced fluores-
cence with the ABI PRISM 310 Genetic Analyzer.

12.4.6 Identification of Microorganisms in Faeces

Using molecular biological approaches, the identification of faeces bacteria can be

one of the sensitive and straightforward methods for identifying faeces. There are
more than 4000 bacterial species in the human intestinal microbiota. Traditional
methods for detecting faeces use the cultivation of faecal indicator bacteria like
Escherichia coli or Enterococci spp. However, these faecal indicator bacteria only
make up a small part of the faecal microbiota, so they may not be good enough for
forensic identification. Bacteroides makes up around 30% of faecal microbiota,
174 V. R. Patel et al.

which are the most prevalent bacteria in human faeces. Bacteroides could be utilised
to identify faeces for forensic purposes. Bacteroides is a genus of anaerobic, Gram-
negative rod-shaped bacteria. The diet of the host can change the populations of
microorganisms in faeces. Bacteroides species predominate in the faeces of
individuals whose diets are rich in saturate fats and proteins, which are prevalent
in Western diets. Prevotella species, another genus of Gram-negative bacteria, are
prevalent in the faeces of persons who follow a low-fat and carbohydrate-rich diet.
By recognising certain DNA sequences of the rpoB gene, which codes for the
subunit of bacterial RNA polymerase, Bacteroides can be identified. B. uniformis,
B. vulgatus, and B. thetaiosamicron are the three chief species of Bacteroides found
in faeces. B. uniformis and Bacteroides thetaiosamicron cannot be detected in blood,
saliva, sperm, urine, vaginal secretions, or on the surface of the skin. B. uniformis
and Bacteroides thetaiosamicron are therefore regarded as a particular indicator
bacterium for faecal identification. Occasionally, B. vulgatus can also be found in
samples of feminine fluid. Therefore, caution must be exercised while interpreting
the results of a B. vulgatus screening. Real-time PCR can be used to detect bacterial
genes by amplifying the RNA polymerase-subunit gene of B. uniformis and
B. vulgatus and the α-1-6 mannanase gene of B. thetaiotaomicron using a minor
groove binding probe. However, a number of studies have demonstrated that either
B. uniformis or B. vulgatus was present in every sample. Therefore, B. uniformis and
B. vulgatus are more ideal target species for the identification of faecal material than
B. thetaiotaomicron. Upon detection of B. vulgatus and/or B. uniformis, it is likely
that the sample contains faeces.

12.5 Conclusion

The excretory material performs the same vital role as other biological fluids in the
legal procedure of suspect and victim identification. It is as dependable as blood and
other body fluids since it contains undigested food, nucleated epithelial cells, traces
of blood and its other cells, bile pigments, drug metabolites, and many stomach-
dwelling bacteria. Analysis of the aforementioned evidence can assist link a suspect
to a crime. In addition to distinguishing between adult and juvenile faeces, macro-
scopic analysis can also be used to determine the species to some extent. Micro-
scopic analysis leads to the screening of individuals based on the presence of
undigested materials, which can reveal a person’s eating habits. Blood and its
corpuscles and other specific cells can also reveal specific diseases, which can be
used to distinguish between the innocent and the main perpetrator. As it is unique to
human faeces and missing from animal faeces, urobilin can be regarded a beneficial
agent. Some modern technologies, such as spectrophotometry investigation of
fluorescence-produced faeces in the Schlesinger and Edelman test and DNA
profiling, have also been implemented to assess the molecular specificity of stool
matter. Analysing the microbiota in faeces is a new field, as many microorganisms
have yet to be discovered. These microorganisms are as closely associated with a
person as their DNA.
12 Forensic Significance and Examination of Faecal Matter 175

References
Barbosa MR (2012) Chemical composition and formation of human feces–problems and solutions
of large mergers demographics in developing countries. In Tenth International Symposium on
Recent Advances in Environmental Health Research 39
Fenwick GR, Heaney RK, Mullin WJ, VanEtten CH (1983) Glucosinolates and their breakdown
products in food and food plants. CRC Crit Rev Food Sci Nutr 18(2):123–201
Maclagan NF (1946) Faecal urobilinogen: clinical evaluation of a simplified method of estimation.
Br J Exp Pathol 27(3):190
Nakonechna, O., Stetsenko, S., Popova, L., & Tkachenko, A. (2017). Metabolism of proteins and
nucleic acids
Muwonge, R., da Ganda Manuel, M., Filipe, A. P., Dumas, J. B., Frank, M. R., &
Sankaranarayanan, R. (2010). Visual screening for early detection of cervical neoplasia in
Angola. Int J Gynecol Obstet, 111(1), 68–72
World Health Organization (2019) Bench aids for the diagnosis of intestinal parasites. World
Health. Organization
Attwood T, Cammack R, Atwood T, Campbell P, Parish H, Smith T et al (2006) Oxford dictionary
of biochemistry and molecular biology
Lloyd JBF, Weston NT (1982) A spectrometric study of the fluorescence detection of fecal
urobilinoids. J Forensic Sci 27(2):352–365
Abdalla K, Zuhailawati H, Rahmat A, Azizan A (2017) Characteristics of zinc phosphate coating
activated by different concentrations of nickel acetate solution. Metall Mater Trans A 48:771–
779
Ghatak S, Muthukumaran RB, Nachimuthu SK (2013) A simple method of genomic DNA
extraction from human samples for PCR-RFLP analysis. Journal of biomolecular techniques:
JBT 24(4):224
Shleenkova, A., Luta, E., Bogun, L., & Yabluchansky, M. (2015). Hypothyroidism & Thyroiditis.
Introduction to Vomitus and Its Forensic
Analysis 13
Aditya Kumar Kar, Chitrita Chakraborty, and Pooja Uppal

Abstract

Vomiting is a gastrointestinal response to poisoning or drug overdose and also it

can occur due to trauma faced in violent assault like in case of strangulation,
sexual assault, etc. Thus, the identification of gastric fluid in a crime scene can
help in framing the crime scene and can corroborate to a criminal act. Vomitus
contains gastric fluid which contains HCl, mucus, pepsinogen, and various
gastric-specific protein biomarkers like MUC5AC, GAST, etc. along with epi-
thelial cells and food residue. The detection of which in a suspected stain will help
to identify vomitus.

Keywords

Nausea · Gastric secretions · Glands · Ulcers · Assay

13.1 Introduction

Vomiting and nausea are gastrointestinal problems that are generated by varying
emetic stimuli through the nervous system. Vomiting is an involuntary act of
forceful expulsion of gastrointestinal contents through the mouth (Li 2021). They
are regarded as defense mechanism of the body when dangerous toxins,

Aditya Kumar Kar, Chitrita Chakraborty and Pooja Uppal contributed equally with all other
contributors.

A. K. Kar (✉) · C. Chakraborty · P. Uppal

Department of Forensic Science, Adamas University, Barasat, Kolkata, India

# The Author(s), under exclusive license to Springer Nature Singapore Pte 177
Ltd. 2024
A. Puri et al. (eds.), Fundamentals of Forensic Biology,
https://doi.org/10.1007/978-981-99-3161-3_13
178 A. K. Kar et al.

microorganisms, or drugs gain entry into the body through different routes (gastro-
intestinal track or parenteral route).
The process of vomiting begins with the parasympathetic nervous getting
stimulated that in turn increases salivation. Then, there is deep inhalation followed
by closure of glottis to protect the lungs from aspiration of the vomit. This event is
subsequently followed by contractions of diaphragm and then contraction of abdom-
inal muscles that compresses the stomach. Due to relaxation of sphincter and
esophagus, the gastric contents are then forced upward and expelled out though
the mouth (Li 2021). There is also excessive sweating and increased heart rate during
vomiting due to activation of sympathetic nervous system.
Vomitus is sometimes found in cases of strangulation, poisoning or drug over-
dose, sexual abuse, and child abuse. The positive identification of vomit stain may
help to prove or disapprove a suspect and victim’s involvement and further help in
framing the scene of crime (Akutsu et al. 2016).

13.2 Composition of Vomiting

Vomit contains gastric secretions, which consists of secretions from oxyntic glands
and pyloric glands of stomach mucosa. Gastric secretion consists of HCl, pepsino-
gen, mucus, gastrin hormone, and other intrinsic factors. Gastrin hormone is secreted
by ‘G’ cells, the function of which is to stimulate stomach to release gastric acid. It
contains Mucin 5AC (MUC5AC) which is secreted from epithelial goblet cells of
stomach which is a gel-forming glycoprotein. Vomit also contains epithelial cells
that come from the lining of the gastrointestinal track. It also contains digested, semi-
digested, and un-digested food residue.

13.3 Characteristics Feature of Vomitus

1. The pH of vomitus is in general highly acidic. Its optimal pH value is 2, but it is

influenced by the type of food residue it contains (Akutsu et al. 2016).
2. Malodorous.
3. Color-Color of vomit may indicate underlying condition like it is foamy or
whitish in case of acid reflux, gastritis; it is clear in appearance in case of brain
injury, gastric outlet obstruction, cyclic vomiting disorder, migraine, morning
sickness, gastroenteritis; green or yellow colored in case of bile reflux, food
poisoning, gastroenteritis, liver failure; pink or red colored in case of amyloidosis,
damage to throat, mouth or gums, peptic ulcer, stomach cancer; it is brown in
color in case of blocked intestine, severe constipation, stomach cancer. Brownish
or blackish color vomit indicates internal bleeding particularly in the lower
gastrointestinal track region that undergoes oxidation and appears brownish or
blackish (Li 2021).
13 Introduction to Vomitus and Its Forensic Analysis 179

13.4 Examination of Vomitus

1. Mucus: The inner surface of the stomach is lined by two-layer mucus system,
inner attached mucus layer and outer loose/unattached mucus layer which
protects the inner wall of stomach from digestive enzymes and acidic environ-
ment (Johansson et al. 2013). Some amount of mucus comes out while vomiting.
Mucus shows opalescence appearance while adding acetic acid (33%). By
identifying the presence of mucus, we can determine whether the stain is vomit
or not.
2. Free HCL: Some amount of HCL is present in our stomach, which is secreted by
oxyntic glands of parietal cells of mucosa. HCL maintains the low pH in stomach
and protects it from bacteria, microbes and helps in digestion (Beasley et al.
2015). No other body fluid contains HCL other than gastric fluid. For testing of
free HCL in vomit samples, Gunzburg’s reagent is used. Gunzburg’s reagent is
prepared by mixing phloroglucinol, vanillin, and alcohol. It shows brilliant red
color in the presence of free HCL.
3. Microscopic Examination of Food Residue: Vomit may contain digested or
semi-digested food material, which are examined under a microscope. This
method is not reliable because many times vomit does not contain any visible
substance. So, this method cannot verify whether the sample is vomit or not.
4. Microscopic Examination of Endothelial Cells: Vomit may contain few endo-
thelial cells. For viewing the cells under microscope, the extract is first
centrifuged for 10 min and then a thin film of the residue part is made on the
slide and observed under the microscope.
5. Pepsin Assay: Pepsin is the most important endopeptidase present in gastric
fluid. It is secreted by gastric chief cells as an inactive form pepsinogen, which is
activated in the presence of HCL. The main function of this enzyme is break
down of peptide bonds present in the middle of proteins. The preferred amino
acid targets of pepsin for cleavage reaction are tryptophan, phenylalanine, and
tyrosine. This proteolytic activity of pepsin is used as an assay to identify the
vomit samples. In pepsin assay, an insoluble protein dye complex called fibrin
blue is used, which is colorless. If the sample contains vomit, the pepsin present in
vomit cleaves the fibrin blue and releases a chromophore (soluble in water) which
shows blue color. This assay is carried out in fibrin blue containing agarose gel.
The sample is loaded in the gel and incubated for 4–6 h at 37°C. If the sample
contains vomit, a concentric, blue and translucent ring is observed around the
sample. This assay is most reliable, as no other proteolytic enzyme and no other
body fluid shows the positive reaction. It also shows positive reaction for old
vomit stains up to 3–6 months. The gel plate can be photographed, dried, and
preserved for the purpose of record (Yamada et al. 1992).
180 A. K. Kar et al.

6. ELISA for the Detection of Gastric Mucosa-Expressing Proteins: Tomoko

et al. conducted a study to identify vomit samples by ELISA in which they
focused on four gastric mucosa-expressing proteins (gastric-specific protein
biomarkers), pepsinogen I (PGA), pepsinogen II (PGC) which are precursors
for pepsin A and Pepsin C, secreted from chief cells of stomach. Gastrin (GAST)
is a peptide hormone which is secreted from G cells and mucin 5AC (MUC5AC)
is glycosylated protein which is secreted from epithelial goblet cells of stomach.
Results showed that PGC and PGA are reliable but show some cross-reactivity
with other body fluids. However, pepsinogen I show cross-reactivity with urine
and seminal stains due to its expression in these fluids. MUC5AC is only reliable
when used along with the other markers. GAST is not included for the identifica-
tion of vomit because it is a gastrointestinal hormone and not secreted into the
cavity of stomach. PGA and PGC also show positive results for old vomit stains.
Although ELISA is simple to perform and is a robust technique, it has a drawback
of non-specific antibody recognition, especially if a complex matrix is present and
in those cases, it gives false positive or negative results. Also, information
obtained from ELISA is limited to specific detection of only previously
designated proteins. Apart from this, no other information like food consumed
before vomiting can be obtained. So, ELISA is found to be a satisfactory
technique, especially for the detection of pepsinogen I (PGA), thus it is an
effective technique for identification of vomitus (Akutsu et al. 2016).
7. Proteomic Approach Using Mass-Spectroscopy: Proteomics is a technology to
link protein expression patterns to its original tissue or to the biological fluid. This
approach fulfills the requirement of forensic scientist through the identification of
tissue-specific or organ-specific protein expression patterns. Thus, proteomics
can assess the nature of body fluids. So, in case of detection of vomitus, mass
spectroscopy-based proteomics not only help in identification of vomiting stain
through the detection of tissue-specific proteins but also it can detect food-derived
proteins which will help to identify the nature of meal, which might help to frame
the crime scene. It must be considered that type of proteins and peptides found in
vomit is greatly affected by force used for its expulsion and the nature of ingested
food. If duodenal proteins are present in vomit stain, it indicates failure of pylorus
that could be related to some pathological condition. If the force used for
expulsion is more, then there will be increased intra-abdominal pressure because
of retching and contraction, which sometimes induces small intestine reverse
13 Introduction to Vomitus and Its Forensic Analysis 181

peristalsis, so in those cases enzymes from small intestine (pancreatic enzymes)

can be traced in vomit samples. Also, characterization of “digestomes” can
further help to infer about the physiological decomposition of food proteins inside
the human body.
For purification of proteins from vomiting stain for proteomic investigation, the
proteins are solubilized by washing vomiting stain with 400 μl of reducing buffer
consisting of 6 M guanidine HCl, 0.3 M Tris, 1 mM EDTA, 10 mM DTT, pH 8.0,
it is then incubated at 56°C for 1 h. After this, it is alkylated with threefold
iodoacetamide (IAA) for 40 min in a dark room at room temperature. Then,
100 μl aliquot containing reduced proteins are diluted with 25 mM Ammonium
bicarbonate pH 7.8 containing Dithiothreitol. Then, a micro-lowery modified
method kit is used for the quantization of polypeptides. It is further digested
overnight at 37°C with trypsin. After trypsinolysis, peptides are again purified
using prepacked C18 Sep-pak cartridge washed with 0.1% TFA (trifluoroacetic
acid) and then eluted with 70% acetonitrile. It is finally concentrated, lyophilized,
and then re-constituted in 0.1% formic acid (v/v) at a concentration of 0.5 μg/μl
for LC-MS/MS analysis. For LC-MS/MS analysis, Eluent A should consists of
0.1% formic acid (v/v) in LC-MS grade water and Eluent B should consists of
0.1% formic acid (v/v) in acetonitrile. For the purpose of separation, 2–45%
gradient of B for over 150 min at 30 nL/min constant flow rate is used (Pieri et al.
2019).

References
Akutsu T, Saito H, Iwase H, Watanabe K, Takamura A, Sakurada K, Miyasaka S (2016) The
applicability of ELISA detection of gastric mucosa-expressing proteins for the identification of
vomit. Int J Legal Med 131(2):359–364. https://doi.org/10.1007/s00414-016-1409-1
Beasley DE, Koltz AM, Lambert JE, Fierer N, Dunn RR (2015) The evolution of stomach acidity
and its relevance to the human microbiome. PLoS One 10(7):e0134116
Johansson ME, Sjövall H, Hansson GC (2013) The gastrointestinal mucus system in health and
disease. Nat Rev Gastroenterol Hepatol 10(6):352–361
Li R (2021) Identification of vomitus. In: Forensic biology essay. CRC Press, Boca Raton
Pieri M, Silvestre A, De Cicco M, Mamone G, Capasso E, Addeo F, Picariello G (2019) Mass
spectrometry-based proteomics for the forensic identification of vomit traces. J Proteome 209:
103524. https://doi.org/10.1016/j.jprot.2019.103524
Yamada S, Hirata K, Tsugawa N, Bunai Y, Ohya I (1992) Vomit identification by a pepsin assay
using a fibrin blue-agarose gel plate. Forensic Sci Int 52(2):215–221. https://doi.org/10.1016/
0379-0738(92)90110-i
Nucleic Acids: DNA and RNA
14
Rutwik Shedge, Aditi Iyengar, Monisha Samuel, and Tanya Chauhan

Abstract

Nucleic acids are biomacromolecules that exist naturally in all the living
organisms, and play fundamental roles in many biological processes such as
catalysis of biochemical reactions and regulation of a plethora of cell activities
(Cooper, The cell: a molecular approach. 2nd ed. Sinauer Associates, Sunderland,
2000). Various types of nucleic acids have tremendous potential in medicine, in
form of treatments and sensors for detection of ions, small molecules, amino
acids, proteins, and cells (Thatcher, Principles and applications of molecular
diagnostics. Elsevier, Amsterdam, 2018). They are used for gene regulation,
bioimaging, drug delivery, and disease therapy (Thatcher, Principles and
applications of molecular diagnostics. Elsevier, Amsterdam, 2018). In forensic
science, nucleic acids have applications in identification, estimation of post-
mortem interval, paternity and maternity tests, genealogy, toxicology, and pathol-
ogy to name a few (Li, Forensic biology: identification and DNA analysis of
biological evidence. CRC Press, Boca Raton, 2021).

R. Shedge (✉)
School of Forenic Science, National Forensic Sciences University, Gandhinagar, Gujarat, India
A. Iyengar
Impact Science, Cactus Communications, Mumbai, India
M. Samuel
School of Forenic Science, National Forensic Sciences University, Gandhinagar, Gujarat, India
Department of Forensic Science, National Forensic Sciences University, Delhi Campus (LNJN
NICFS), New Delhi, Delhi, India
T. Chauhan
Deparment of Forensic Science, National Forensic Sciences University, Tripura Campus, Agartala,
Tripura, India

# The Author(s), under exclusive license to Springer Nature Singapore Pte 183
Ltd. 2024
A. Puri et al. (eds.), Fundamentals of Forensic Biology,
https://doi.org/10.1007/978-981-99-3161-3_14
184 R. Shedge et al.

Keywords

Nucleic acids · DNA · RNA · Ribose · Nitrogen bases · Phospodiester bonds

14.1 Definitions

Nucleic acids: Biomacromolecules that exist naturally in all the living organisms,
and play fundamental roles in many biological processes
DNA: Fundamental genetic material of humans
RNA: Biomacromolecule vital in multiple biological processes such as coding,
decoding, and expression of genes
miRNA: micro-RNA or short non-coding RNA nucleotides that range between
15–30 bases
Pentose: A five carbon sugar that forms the nucleic acids
Purines: Nitrogenous bases derived from purine heterocyclic rings
Pyrimidines: Nitrogenous bases derived from pyrimidine heterocyclic rings
STR profiling: DNA typing using autosomal and sex chromosomal short tandem
repeats
Chaotropic agents: Chemicals that deplete the hydration cell of DNA and cause
it to reversibly bind to a substrate

14.2 Native Nucleic Acids

Native nucleic acids are DNA and RNA. DNA stands for deoxyribonucleic acid, and
is the hereditary material in humans (Cooper 2000). It carries the genetic instructions
necessary for growth, development, and reproduction of humans (Ha and Bhagavan
2023). RNA stands for ribonucleic acid, and is vital in multiple biological processes
such as coding, decoding, and expression of genes (Grabmüller et al. 2015). Nucleic
acid was first discovered by Friedrich Miescher in 1869, and was dubbed as nuclein,
for its discovery within the nucleus (Dahm 2005).

14.2.1 Structure of Nucleic Acids

Nucleic acids are comprised of nucleotides, which are monomers made of three
constituents such as a 5-carbon sugar (pentose), a phosphate group, and a nitrogen
base (Fig. 14.1) (Thatcher 2018). Depending upon whether the pentose sugar is
deoxyribose or ribose, the resultant nucleic acid is DNA or RNA. The presence of
phosphate group (phosphoric acid) is why the macromolecules are called nucleic
‘acids.’ Nucleic acids consist of five different nitrogenous bases such as two purines
and three pyrimidines. The nitrogenous bases are called purines or pyrimidines on
the account of being derived from purine and pyrimidine heterocyclic rings
(Fig. 14.2). Purine bases include adenine (6-aminopurine) and guanine (2-amino-
14 Nucleic Acids: DNA and RNA 185

Fig. 14.1 Nucleic acid

composition (reference image base
for the illustrator)
NH2

N
phosphate N

O N N
-O P O O
O- H H
H H
OH H

ribose

NH2 O
H
N N N N

N N N N NH2
H Adenine H Guanine

O NH2 O
H H
H3C
N N N

N O N O N O

H H H
Thymine Cytosine Uracil

Fig. 14.2 Nitrogenous bases of nucleic acids (reference image for the illustrator)

6-oxypurine), while pyrimidine bases include thymine (5-methyl-2,4-

dioxipyrimidine), cytosine (2-oxo-4-aminopyrimidine), and uracil
(2,4-dioxoypyrimidine). Since all the nitrogenous bases are aromatic in nature,
they can absorb radiation in the UV spectrum, and thus can be identified and
quantified in an unknown sample (Butler 2015). In DNA, the nitrogenous bases
186 R. Shedge et al.

found are adenine (A), guanine (G), thymine (T), and cytosine (C), while in RNA,
thymine is replaced by uracil (U).

14.3 DNA

DNA or the deoxyribonucleic acid is a polymer that consists of two polynucleotide

chains that are wrapped around each other to form a helical structure (Fig. 14.3). The
two strands are said to be in an antiparallel orientation, and are connected to each
other by means of hydrogen bonds between complimentary nitrogenous bases (Kyle
and Shampo 1998). In the DNA, adenine binds to thymine by means of two
hydrogen bonds, while guanine and cytosine bond to each other by means of three

Nitrogenous bases:

Adenine

Thymine

Guanine

Cytosine

Base pair

Sugar phosphate backbone

Fig. 14.3 Helical structure of DNA (reference image for the illustrator)
14 Nucleic Acids: DNA and RNA 187

Fig. 14.4 Nucleotide with NH2

phosphate group connected to
the 5′-end and hydroxyl group
present at the 3′-end N
(reference image for the O
illustrator)
-O 5' N O
P O
O
O- 4' 1'

3' 2'

HO

Table 14.1 Amount of Forensic evidence Amount of DNA

DNA that can be extracted
Liquid blood 20,000–40,000 ng/mL
from commonly encoun-
tered forensic evidences Blood stain 250–500 ng/cm2
Liquid semen 150,000–300,000 ng/mL
Post coital vaginal swab 10–3000 ng/swab
Liquid saliva 1000–10,000 ng/mL
Oral swab 100–1500 ng/swab
Plucked hair 1–750 ng/root
Shed hair 1–10 ng/root
Urine 1–20 ng/mL
Bone 3–10 ng/mg
Tissue 50–500 ng/mg

hydrogen bonds. Both the strands are coiled around the same axis, and have the same
pitch of 3.4 nm. The pair of strands have a radius of 1 nm, and form two separate
grooves such as a major groove which is 2.2 nm wide and a minor groove which is
1.2 nm wide.
The backbone of DNA is made up from alternating phosphate and deoxyribose
molecules, joint together by means of phosphodiester bonds. The phosphodiester
bonds are formed between the third and fifth carbon atoms of adjacent deoxyribose
rings. These are known as the 3′-end and the 5′-end carbons. Any DNA strand has a
3′-end where the free hydroxyl group (–OH) is attached and a 5′-end where the
phosphate group is attached (Fig. 14.4).

14.3.1 DNA Extraction: Principles

Extraction of DNA, its quantitation, and eventual profiling forms the crux of forensic
molecular biology. Forensic scientists often have to deal with old, impure, degraded
biological fluids as evidences, and are expected to isolate DNA from them for further
downstream processing. This makes it imperative, that the forensic scientists use
standardized methods of DNA isolation, that will ensure that sufficient amount
188 R. Shedge et al.

of DNA is extracted for subsequent STR profiling. While the different methods of
DNA extraction exist, the principle for them is somewhat similar. The amount of
DNA that can be isolated from different forensic evidences are detailed in Table 14.1
(Butler 2015).

14.3.1.1 Cell and Tissue Disruption

DNA extraction begins with cell and tissue disruption. The cells present within the
biological evidence found at a scene of crime or on the victim need to be disrupted so
that the DNA present within their nuclei may be isolated. Cell or tissue disruption
can be done by boiling, heating, treatment with alkalis, or by mechanical methods
such as use of mortar and pestle, homogenizer, or a barocycler (Li 2021). Harder
tissues such as the teeth and bones may be first subjected to liquid nitrogen, and
grinded using any of the aforementioned mechanical methods. However, in case of
teeth and bones, decalcification is a must, and is done by giving the bone or teeth
sample repeated treatment with chelating agents such as EDTA
(Ethylenediaminetetraacetic acid). The time required for successful decalcification
may be as long as several days, and depends upon the size and source of the sample.

14.3.1.2 Lysis of Cellular and Organelle Membranes

After disruption of cells and tissues, the broken membranes of cells and their
organelles need to by lysed to facilitate isolation of DNA. This lysis procedure is
usually conducted in a Tris buffer (trisaminomethane) to maintain a pH where
endogenous DNases remain inactive (Heathfield et al. 2021). In this Tris buffer,
certain chaotropic agents and salts are added, and these carry out the lysis of cell
membrane. Chaotropic agents such as guanidium chloride, 2-propanol, lithium
perchlorate, etc. cause entropic disorder in the lipid bilayer of cell membranes, and
cause loss of their hydrophobic properties. Detergents such as sodium dodecyl
sulphate and sarkosyl are also added to the buffer, and they ‘poke holes’ in the
cell membrane. Other enzymes such as proteinase-k are added which denature
proteins and dissociate histone proteins from the DNA.

14.3.1.3 Removal of Cytoplasmic Constituents

After lysis, the isolated DNA still exists amongst the wreckage of lysed lipids,
proteins, and other organic material. Removal of DNA from this mixture can be
done using multiple rounds of phenol-chloroform extraction, or through repeated
washing or through reversible binding of DNA to a solid material such as silica.

14.3.2 DNA Extraction Methods

14.3.2.1 Organic Extraction

Organic extraction, also known as phenol-chloroform extraction, is one of the most
commonly used manual methods of DNA extraction in a forensic setting. Cell lysis
is performed using a detergent such as sodium dodecyl sulphate (SDS) and
proteinase-K. The removal of cytoplasmic contents is achieved by using a solution
14 Nucleic Acids: DNA and RNA 189

Fig. 14.5 Organic extraction of DNA (reference image for the illustrator)

Fig. 14.6 Chelex®-based method of DNA extraction (reference image for the illustrator)

of phenol:chloroform:isoamyl alcohol in a proportion of 25:24:1 (Heathfield et al.

2021). Phenol is used to separate the proteins and lipids from the cytoplasmic
contents. However, since the density of phenol is just slightly higher than that of
water, separation of phenol from the aqueous phase is difficult. Hence, chloroform is
added to the mixture as it has much higher density than phenol, and forms an organic
layer at the bottom. Since addition of chloroform leads to foaming, isoamyl alcohol
is added to reduce the foam. The aqueous layer rises to the top and contains the
soluble DNA in it. The lipids are found in the organic layer, while the proteins are
found in the interphase between organic and aqueous layers (Fig. 14.5).
The aqueous layer is separated into another tube, and precipitation of DNA is
done. This is achieved by addition of ethanol, which depletes the hydration shell
surrounding the dissolved DNA, causing it to precipitate. Ultrafiltration can also be
used as an alternative for concentration of DNA.

14.3.2.2 Chelex®-Based Extraction

This technique is also known as the boiling and chelation method (Fig. 14.6). The
first step in this method involves thorough washing of the sample to remove any
190 R. Shedge et al.

inhibitors of the polymerase chain reaction. The sample is then incubated at 56°C for
20 min to soften the cell membranes and separate clumps of cells from each other.
Lysis of the cell membrane is then achieved by boiling the sample. The DNA that
gets released during this step is also accompanied by other cellular contents includ-
ing DNases. If allowed to be active, the DNases may degrade the extracted DNA. To
prevent their activity, a chelating resin composed of styrene divinylbenzene
copolymers (Chelex® 100) is used (Ip et al. 2015). This ion exchange resin consists
of paired iminodiacetate groups that bind to the divalent cations such as magnesium.
Magnesium is a cofactor for the activity of DNases, and thus, its pairing with
Chelex® 100 keeps the endogenous DNase inactive. The removal of Chelex® and
other cytoplasmic constituents is done by centrifugation. It is important to
completely separate the extracted DNA and Chelex® as during amplification, mag-
nesium ions are required, and presence of any Chelex® molecules may inhibit the
PCR reaction.

14.3.2.3 Silica-Based Extraction

Silica-based DNA extraction works on the principle of reversible adsorption of the
DNA molecule onto silica surface in the presence of high concentrations of
chaotropic salts (Fig. 14.7) (Vinueza-Espinosa et al. 2019). Normally, in an aqueous
solution, the hydration shell surrounding the DNA molecule shields the negative
charge of the DNA, and ma DNA hydrophilic. In presence of high concentration of
chaotropic salts, the hydration shell of the DNA gets depleted and DNA becomes
hydrophobic. This causes DNA to get reversibly adsorbed onto a silica surface.
The extraction procedure begins with cell disruption using proteinase-K. The
DNA lysate is added to a stationary phase made up of silica (SiO2) in the presence of
chaotropic salts such as guanidinium thiocyanate and guanidinium hydrochloride.
The presence of these salts causes the DNA to reversibly bind to the silica surface,

Column DNA extraction

Loaded
lysate

Centrifuge Centrifuge

Silica
membrane

Sample Column Wash and dry the DNA elution

lysis loading membrane

Fig. 14.7 Silica-based column method of DNA extraction (reference image for the illustrator)
14 Nucleic Acids: DNA and RNA 191

while the other cytoplasmic constituents are not adsorbed. The cytoplasmic
constituents, chaotropic agents, and other contaminants are washed away using an
ethanol-based solution. The adsorbed DNA can be eluted using low salt water
solutions. These solutions cause the DNA to rehydrate and thus elute.

Automated DNA Extraction

Silica membrane devices have been created for automated DNA extraction. Using
96-well silica membrane plates and a plethora of robotic platforms, DNA can be
extracted without any manual input (Li 2021). Another modification of the silica-
based method for automated DNA extraction is the use of silica-coated paramagnetic
beads or particles (Witt et al. 2012). The sample lysate is simply added to the
automated machine, where the DNA gets adsorped onto the magnetic beads. The
cytoplasmic contents are washed away, and the magnetic beads are subjected to a
method which rehydrates the bound DNA. These advances in DNA extraction
technologies have allowed for development of parallel and high-throughput
processing.

14.3.2.4 Differential Extraction

One of the more common cases dealt by forensic biologists are the sexual assault
cases. In such cases, often, the evidences recovered are mixtures of semen of the
perpetrator and the vaginal discharge of the victim. In such cases, different DNA
extraction methods have to be utilized to separate DNA from spermatozoa of male
contributor and from non-sperm cells of the victim such as the epithelial cells. If the
DNA from these two different sources is not separated, complications may arise
during interpretation of resultant DNA profiles.
The method used to differentially extract DNA from sperm cells and non-sperm
cells has its principle based on the different cell membrane properties of these two
types of cells. First, DNA is extracted from the epithelial cells using proteinase-K.
This enzyme can denature the proteins of cell membrane of non-sperm cells with
relative ease, while is ineffective in lysing cell membranes of the sperm cells. The
plasma membrane of sperm cells contains proteins that are linked with disulphide
bonds, which imparts extra mechanical stability and thus makes the plasma mem-
brane resistant to the activity of proteinases. After the non-sperm is extracted, it gets
released in the supernatant, which can be separated. The left-over sperm cells are
separately lysed using a reducing agent called dithiothreitol (DTT). In presence of
DTT and proteinase-K, the sperm cells get lysed and their DNA is extracted
(Fig. 14.8) (Ng et al. 2017; Sinha et al. 2022).

14.4 RNA

RNA or ribonucleic acid is a polymer that is found in a single-stranded structure in

the human body (Busa and Leung 2021). Similar to DNA, RNA molecule too has a
sugar-phosphate backbone, except, in RNA ribose is the pentose sugar. Ribose sugar
has a hydroxyl group attached in the 2′ position, which is absent in the DNA
192 R. Shedge et al.

Differential Extraction

Isolate/Purify
DNA by Organic
or Solid Phase
Transfer Extraction
Supernatant

Add SDS and Incubate and Epithelial Lysate Transfer and Retain
Proteinase K Centrifuge Fraction DNA Extract
Resuspend
Spermatozoa Pellet

Isolate/Purify
DNA by Organic
or Solid Phase
Extraction

Add SDS, Spermatozoa Transfer and Retain

Proteinase K and DTT Lysate Fraction DNA Extract

Fig. 14.8 Differential extraction of DNA (reference image for the illustrator)

molecule. The phosphate group is attached to the 3′-end of one ribose molecule, and
5′-end of the other ribose molecule (Fig. 14.9). As with DNA, nitrogenous bases
form a part of the RNA molecule, but in the RNA, thymine (T) is replaced by uracil
(U).
RNA synthesis happens by the means of DNA through a process known as
transcription, while protein synthesis, or translation happens by the means of RNA
(Cox and Arnstein 2003; Wise and Lou 2021). Three major types of RNA are
involved in the process of translation: mRNA, rRNA, and tRNA (Fig. 14.10).
mRNA stands for messenger RNA, and is the RNA that is transcribed from DNA
during the process of transcription. mRNA is a single-stranded RNA that carries
information required for protein synthesis from nucleus to the cytoplasm where
translation occurs (Liljas 2013). rRNA stands for ribosomal RNA, and is the primary
component of ribosomes, which are cell organelles that perform protein synthesis
(Joseph 2016). tRNA stands for transfer RNA, and is the molecule responsible for
carrying amino acids to ribosomes for protein synthesis (Doherty and Guo 2016).

14.4.1 RNA Extraction

14.4.1.1 RNA-DNA Coextraction

RNA-DNA coextraction allows for simultaneous isolation of high-quality RNA and
DNA extraction for forensic profiling and biological fluid identification (Fig. 14.11).
Biological fluids are first lysed using a lysis buffer that contains high concentration
of chaotropic salts such as guanidinium thiocyanate. These salts inactivate the
endogenous DNases and RNases while also lysing the cell membranes. The lysate
is passed through a silica membrane column, where due to the high concentration of
14 Nucleic Acids: DNA and RNA 193

Fig. 14.9 Structure of RNA (reference image for the illustrator)

chaotropic salts, DNA gets selectively adsorped over RNA. The column is washed,
and DNA gets eluted. The solution that comes out of this silica membrane column
has lysate, chaotropic salts, and the RNA. Ethanol is then added to this liquid, and
passed through another silica membrane column. Ethanol and chaotropic salts
reduce the hydrophilic property of RNA to such an extent that it can now bind to
the silica layer of this second column. RNA including mRNA gets eluted in this
process (Majumdar et al. 2015; van den Berge and Sijen 2022).
194 R. Shedge et al.

Fig. 14.10 mRNA, rRNA,

and tRNA (reference image
for the illustrator)

14.4.1.2 miRNA Extraction

miRNAs or microRNAs are small non-coding RNAs that range between 15 and
30 nucleotides in length. miRNAs have recently been utilized for the identification of
biological fluids and body tissues. Since miRNAs are really small molecules, they
cannot be successfully isolated using traditional RNA extraction methods. Instead,
miRNA isolation happens in two phases: phase 1 involves organic solvent extrac-
tion, and phase 2 involves solid phase extraction (Fig. 14.12) (Corthell 2014;
Tantray et al. 2023).
The cells of biological fluids or body tissues are first lysed. The lysate is then
extracted using organic solvents such as phenol and chloroform, along with a high
concentration of guanidinium thiocyanate. An acidic pH is maintained as at this pH,
DNA partitions to the organic phase, while RNA gets dissolved in the aqueous
phase.
The aqueous phase is then separated, and passed through a silica membrane filter
at low ethanol concentration. Presence of low concentration ethanol and
guanidinium thiocyanate depletes the hydration shell surrounding larger RNAs
and causes them to bind to the silica membrane. The smaller RNAs (miRNAs) do
not bind to the silica membrane, and pass off in the filtrate. This filtrate is passed
through another silica membrane filter, but this time with higher ethanol concentra-
tion. This causes miRNAs to bind to the silica membrane, and can be eluted using
low ionic strength solution.

MCQs

1. The backbone of nucleic acids is made by which bond between the phosphate and
sugar molecules?
(A) Hydrogen bonds
(B) Disulphide bonds
14 Nucleic Acids: DNA and RNA 195

Fig. 14.11 Coextraction of RNA and DNA (reference image for the illustrator)

(C) phosphodiester bonds

(D) None of the above
Answer: C
2. In differential extraction of sperm and non-sperm DNA, lysis of sperm cells is
done by addition of which of the following reducing agents?
(A) Dithiothreitol
(B) Sodium dodecyl sulphate
196 R. Shedge et al.

Fig. 14.12 miRNA extraction (reference image for the illustrator)

(C) Sarosyl
(D) Ethanol
Answer: A
3. Reversible adsorption of DNA happens on silica in presence of which of the
following agents?
(A) Chelating agents
(B) Chaotropic agents
(C) Oxidising agents
(D) Stabilizers
Answer: B
4. The ideal proportion of phenol, chloroform, and isoamyl alcohol in organic
extraction of DNA is _________
14 Nucleic Acids: DNA and RNA 197

(A)
25:25:1
(B)
25:24:1
(C)
25:20:1
(D)
25:1:1
Answer: B
5. Which of the following nitrogenous bases is absent in RNA?
(A) Adenine
(B) Cytosine
(C) Guanine
(D) Thymine
Answer: D

References
Busa VF, Leung AKL (2021) Thrown for a (stem) loop: how RNA structure impacts circular RNA
regulation and function. Methods 196:56–67. https://doi.org/10.1016/j.ymeth.2021.02.019
Butler JM (2015) The future of forensic DNA analysis. Philos Trans R Soc B Biol Sci 370:
20140252. https://doi.org/10.1098/rstb.2014.0252
Cooper GM (2000) Expression of genetic information. In: The cell: a molecular approach, 2nd edn.
Sinauer Associates, Sunderland
Corthell JT (2014) Chapter 2 - DNA and RNA extraction protocols. In: Corthell JT (ed) Basic
molecular protocols in neuroscience: tips, tricks, and pitfalls. Academic Press, San Diego, pp
11–19
Cox RA, Arnstein HRV (2003) Translation of RNA to protein. In: Meyers RA (ed) Encyclopedia of
physical science and technology, 3rd edn. Academic Press, New York, pp 31–51
Dahm R (2005) Friedrich Miescher and the discovery of DNA. Dev Biol 278:274–288. https://doi.
org/10.1016/j.ydbio.2004.11.028
Doherty J, Guo M (2016) Transfer RNA. In: Bradshaw RA, Stahl PD (eds) Encyclopedia of cell
biology. Academic Press, Waltham, pp 309–340
Grabmüller M, Madea B, Courts C (2015) Comparative evaluation of different extraction and
quantification methods for forensic RNA analysis. Forensic Sci Int Genet 16:195–202. https://
doi.org/10.1016/j.fsigen.2015.01.006
Ha CE, Bhagavan NV (2023) Chapter 20 - Structure and properties of DNA. In: Ha CE, Bhagavan
NV (eds) Essentials of medical biochemistry, 3rd edn. Academic Press, San Diego, pp 453–476
Heathfield LJ, Haikney TE, Mole CG et al (2021) Forensic human identification: investigation into
tooth morphotype and DNA extraction methods from teeth. Sci Justice 61:339–344. https://doi.
org/10.1016/j.scijus.2021.05.005
Ip SCY, Lin S, Lai K (2015) An evaluation of the performance of five extraction methods: Chelex®
100, QIAamp® DNA Blood Mini Kit, QIAamp® DNA Investigator Kit, QIAsymphony® DNA
Investigator® Kit and DNA IQTM. Sci Justice 55:200–208. https://doi.org/10.1016/j.scijus.
2015.01.005
Joseph S (2016) Ribosomal RNAs and protein synthesis. In: Bradshaw RA, Stahl PD (eds)
Encyclopedia of cell biology. Academic Press, Waltham, pp 384–395
Kyle RA, Shampo MA (1998) Wilkins, Crick, and Watson: nobel prize for work on the structure of
DNA. Mayo Clin Proc 73:362. https://doi.org/10.1016/S0025-6196(11)63703-8
Li R (2021) Forensic biology: identification and DNA analysis of biological evidence. CRC Press,
Boca Raton
198 R. Shedge et al.

Liljas A (2013) Messenger RNA. In: Maloy S, Hughes K (eds) Brenner’s encyclopedia of genetics,
2nd edn. Academic Press, San Diego, pp 369–370
Majumdar G, Vera S, Elam MB, Raghow R (2015) A streamlined protocol for extracting RNA and
genomic DNA from archived human blood and muscle. Anal Biochem 474:25–27. https://doi.
org/10.1016/j.ab.2014.12.021
Ng HH, Lim M-L, Hoe SY et al (2017) Modified differential DNA extraction to reduce processing
time of sexual assault exhibits. For Sci Int Genet Suppl Ser 6:e252–e254. https://doi.org/10.
1016/j.fsigss.2017.09.094
Sinha SK, Brown H, Holt H et al (2022) Development and validation of a novel method
“SpermX™” for high throughput differential extraction processing of sexual assault kits
(SAKs) for DNA analysis. Forensic Sci Int Genet 59:102690. https://doi.org/10.1016/j.fsigen.
2022.102690
Tantray JA, Mansoor S, Wani RFC, Nissa NU (2023) Chapter 25 - RNA isolation from human
tissueNote: Handling Conditions Standard Precautions must be followed when handling all
solid tissue samples. Samples can be stored in RNA later followed by storage in a -80°C
freezer. In: Tantray JA, Mansoor S, Wani RFC, Nissa NU (eds) Basic life science methods.
Academic Press, New York, pp 107–109
Thatcher SA (2018) 3 - Nucleic acid isolation. In: Rifai N, Horvath AR, Wittwer CT (eds)
Principles and applications of molecular diagnostics. Elsevier, Amsterdam, pp 35–46
van den Berge M, Sijen T (2022) Development of a combined differential DNA/RNA co-extraction
protocol and its application in forensic casework. For Sci Int Rep 5:100261. https://doi.org/10.
1016/j.fsir.2022.100261
Vinueza-Espinosa DC, Santos C, Martínez-Labarga C, Malgosa A (2019) Assessing DNA recovery
from highly degraded skeletal remains by using silica-based extraction methods. For Sci Int
Genet Suppl Ser 7:810–812. https://doi.org/10.1016/j.fsigss.2019.10.204
Wise JA, Lou H (2021) Transcription|Messenger RNA processing in eukaryotes. In: Jez J
(ed) Encyclopedia of biological chemistry III, 3rd edn. Elsevier, Oxford, pp 411–419
Witt S, Neumann J, Zierdt H et al (2012) Establishing a novel automated magnetic bead-based
method for the extraction of DNA from a variety of forensic samples. Forensic Sci Int Genet 6:
539–547. https://doi.org/10.1016/j.fsigen.2012.01.002
Quantitation and Quality Assessment
of DNA 15
Monisha Samuel, Rutwik Shedge, and Tanya Chauhan

Abstract

The structure of DNA consists of two polynucleotide chains that run in opposite
direction to one another and are held together by hydrogen bonds between the
bases. The stacking of bases one upon another gives rise to grooves which run
along the helix and thus makes up the double helical structure of DNA. These
unique structural traits and complimentary nature of this biomolecule along with
the pairing of bases has allowed researchers to create a wide range of sophisti-
cated techniques for determining the quantity and quality of DNA present in a
given sample (Nicklas and Buel, Anal Bioanal Chem 376:1160–1167, 2003a).
Major objectives that have driven the development of DNA quantitative
approaches throughout history have been raising the informational value of the
result as well as increasing the analytical accuracy. Though it is very unique to the
field of forensic science where due to the scarcity of sample along with its
degraded nature, it becomes of paramount importance that the quantitation and
quality assessment techniques used minimize the amount of sample requirement.
Thus, DNA quantification approaches have transformed substantially during the
last many years, as investigators are constantly refining the pre-existing methods
and integrating new technologies.

M. Samuel (✉) · R. Shedge

Department of Forensic Science, National Forensic Sciences University, Tripura Campus, Agartala,
Tripura, India
T. Chauhan
Department of Forensic Science, National Forensic Science University Delhi Campus (LNJN
NICFS), New Delhi, Delhi, India

# The Author(s), under exclusive license to Springer Nature Singapore Pte 199
Ltd. 2024
A. Puri et al. (eds.), Fundamentals of Forensic Biology,
https://doi.org/10.1007/978-981-99-3161-3_15
200 M. Samuel et al.

Keywords

Forensic science · DNA quantification · Alu sequences · Polymerase chain

reaction · Real-time · Human · Florescence

15.1 Definitions

Deoxyribonucleic Acid: Deoxyribonucleic acid, DNA, is a biomolecule with a

double helix structure that carries the sequences of genetic code which form the
basis of all life.
Polymerase Chain Reaction: Polymerase chain reaction (PCR) is a laboratory
technique for rapidly producing (amplifying) millions to billions of copies of a
specific segment of DNA. PCR involves using short synthetic DNA fragments called
primers to select a segment of the genome to be amplified, and then multiple rounds
of DNA synthesis to amplify that segment.
Short Tandem Repeats: STRs are short tandem repeats located on the telomeric
region of chromosome often known as microsatellite. The highly polymorphic
regions of DNA repeated 5–50 times are called as the microsatellite. The STRs are
short repeats of 1–6 bp and occurred up to 50 times, forming a nucleotide length of
100–120 bp.
Alu Sequences: Alu sequences are a heterogeneous group of primate-specific
interspersed repetitive DNA elements with an estimated frequency of 500,000 to
1 million copies per genome.

15.2 Reason for DNA Quantitation

The quantity and quality of DNA in a forensic sample is very crucial, as many other
techniques like effective DNA amplification and STR profiling are directly depen-
dent on it. It is very commonly observed that the quantity, quality, and length of the
extracted DNA can differ significantly depending on the source and extraction
technique. This has thus direct impact on the downstream techniques since the
amount of input DNA and the relative length of that DNA can influence the decision
as to whether the traditional short tandem repeat (STR) typing, mini-STR typing, or
mitochondrial DNA sequencing can be employed as the genotyping approach.
Secondly, before using any destructive analytical technique, it is crucial to calculate
the total amount of DNA accessible because as it is absolutely vital in forensic
analysis to retain as much of the evidence as possible for retesting. Last but not least,
the outcomes of preliminary quantitative and qualitative analyses enable a more
knowledgeable interpretation of subsequent analytical outcomes. Moreover, this is
especially crucial when working on cases where samples must be examined but
analyses frequently include challenging specimen that contain minuscule amounts of
DNA and have probably experienced environmental stress (DNA degradation). In
addition to this, the substrate on which the DNA was deposited has a large degree of
15 Quantitation and Quality Assessment of DNA 201

impact on both the quality and quantity of DNA (for example, blood on Denim or
synthetic fabric). There is also higher possibility of trace substrate chemicals which
may also be removed together with the DNA at the source. This could further affect
the quantity as well as quality of the DNA. Because of this, the effectiveness and
sensitivity of the extraction process are crucial factors in determining whether a
given extraction method is appropriate for a given forensic material (Köchl et al.
2005).

15.3 Methods

The DNA quantitation technique can be broadly categorised into two approaches.
One of the earliest approaches employed in forensic investigation has been quantita-
tion of the total DNA obtained from the specimen irrespective of its origin. This
method was quick but species selectivity was one of the primary drawbacks. Thus,
whether the obtained DNA was human or non-human in nature could not be
identified. On the advent of PCR methodology, the new approach was employing
quantitative analytical techniques for selective identification of the amount of human
DNA in a sample. For the longest time, there was just one method for selectively
determining human DNA; today, there are multiple options available. The method
section includes both non-specific DNA analysis as well as to those that provide
human-specific (primate-specific) DNA quantification.

15.3.1 Non-Nucleic Acid-Based Quantitation Methods

Chemical, immunological, and/or microscopic investigations of the evidence is the

primary technique used to screen for common biological fluids including blood,
semen, and saliva. Even though the findings of these tests are primarily qualitative,
they can also give a rough evaluation of the likely amount of DNA per unit area of a
sample. Due to variations in cell counts per volume of biological fluid and the
likelihood of uneven redistribution of cells during the deposition and drying of the
biological fluid on its substrate, these procedures are limited in that the total number
of cells that contain DNA within each sample may not always be equal. Also, this
technique only superficially analyses the sample and further tests are required for
confirmation. For example, microscopic examination of semen for the purpose of
spermatozoa detection is a typical test used in forensic investigation. Since the
quantity of DNA in each cell is known, this approach can help in estimating the
predicted DNA yield from sexual assault evidence. This visual inspection may be
used to determine the expected amount of male DNA and confirm the existence of
spermatozoa in such a case (Saferstein 2002).
202 M. Samuel et al.

15.3.2 Nucleic Acid-Based Quantitation Methods

15.3.2.1 Spectrophotometric Quantitation

When the species of origin was unimportant, two instrumental techniques—ultravi-
olet and fluorescence spectroscopy—have been widely utilised to quantify DNA. A
relatively straightforward approach known as ultraviolet spectroscopy has been
around for a while and is still in use today, frequently serving as a benchmark for
other methods. The principle behind it is that majority of biological molecules do not
naturally absorb visible light, but they do absorb ultraviolet radiation. DNA’s
heterocyclic bases which are aromatic in nature absorb in the ultraviolet portion of
the electromagnetic spectrum. It is notable that the λmax range of wavelengths for all
Watson-Crick bases is from 250 to 280 nm. In double-stranded DNA (dsDNA),
absorption of UV light at 260 nm is less than expected from the sum total of the bases
present due to the stacking of the bases. They are stacked in such a manner that there
is coupling between them and it thus reduces UV absorption. Thus, during denatur-
ation, the UV absorption of a dsDNA sample rises by 20–30% as it becomes single
stranded in nature. Samples analysed by UV spectroscopy are analysed at 260 nm
and at 280 nm, and the optical density (OD) ratio at 260/280 is used to measure the
purity. Samples with a 260/280 nm ratio of 1.8–2.0 are considered pure or relatively
free or clean from various impurities. Samples with lesser values should be
re-extracted to achieve accurate quantification since they may be contaminated by
protein, phenol, or another UV-absorbing co-extracted material. At 260 nm, uncon-
taminated samples with an OD of 1 in a 1-cm path-length cell contain around 50 μg
mL–1 double-stranded DNA, or 40 μg mL–1 single-stranded DNA or RNA. For
applications where samples provide microgram quantities of DNA, UV spectros-
copy is a quick and easy technique. The technique’s main drawbacks are its inability
to distinguish between ssDNA and dsDNA (unless denaturation studies are
performed), absorption by RNA and other impurities, sensitivity of the technique,
and the larger amount of the sample needed for accuracy (Nicklas and Buel 2003a).

15.3.2.2 Fluorescence-Based Quantitation

Limits of DNA detection using fluorescent-based quantitation techniques could be
very low making them more sensitive than UV-based approaches. However, to
analyse DNA using fluorescence, a suitable dye that will interact with the DNA
must be added. The dye changes its emission spectrum from that in its unbound
condition or fluoresces when it binds with the polymer. The fluorescence amplifica-
tion that happens as a result of the dye’s fixed orientation after binding to DNA is
what allows intercalating dyes to detect DNA. Certain aspects are required to be
taken into account while choosing a dye. Some colours may bind to DNA or RNA
similarly or preferentially, whereas others may have a stronger affinity for ssDNA
than for dsDNA. The instrument must be also equipped with filters that match or
closely correspond to the dye's excitation and emission wavelengths once the dye
has been chosen (Gallagher 1994). Many fluorescent dyes have been used to
quantify DNA and as new dyes are becoming available greater sensitivity and
selectivity in the quantification of DNA is achieved. Single-stranded and double-
15 Quantitation and Quality Assessment of DNA 203

stranded DNA can be now detected using dyes like PicoGreen and OliGreen,
respectively. PicoGreen is able to detect double-stranded DNA concentrations as
low as 25 pg mL-1, which is an improvement of almost 400-fold as compared to
some of the dyes used previously (Singer et al. 1997). The fluorescence data must be
compared to a standard curve that is normally created each time an assay is carried
out since, unlike UV spectroscopy, they are relative. These techniques, while more
sensitive than UV spectrophotometry, are not human-specific and could overstate the
total amount of DNA present due to possible bacterial contamination.

15.3.2.3 Gel-Based Quantitation

The use of agarose gel electrophoresis (AGE) as a qualitative method to assess the
size, purity, and integrity of DNA. The method is based on the fact that equal-sized
fragments have similar migration paths. When spectrophotometric measurements are
unavailable or sample yields are poor, AGE offers an alternative quantitative
evaluation due to the correlation between the amount of DNA present and the
intensity of dye. In this technique, the sample extract is put via gel electrophoresis
process. Although various media can be used, 1–2% agarose is frequently used in
gels (Volkin and Cohn 1954). Extracts that need to be quantified are placed into
wells with samples having known levels of DNA. Following electrophoresis, the
extracts are seen on a short-wavelength UV transilluminator, and comparisons with
the standard samples helps quantifying the sample DNA (Barbisin and Shewale
2010). The DNA in gels can be seen using a variety of dyes. The popular is ethidium
bromide (EtBr), which is frequently used in the gel and running buffer of the
electrophoresis device. Others like DAPI attach to DNA firmly and remain attached
to the molecule, and the DNA-dye complex is visualized after electrophoresis. The
major drawback of this approach is that it has a lower limit of about 1ng of DNA and
thus is not an option for samples with limited amounts of DNA (Sutherland and Shih
1983).

15.3.2.4 Slot-Blot Hybridization Technique

One of the simpler methods for immobilising large amounts of unfractionated DNA
on a nylon or nitrocellulose membrane include the slot blotting technique. The
relative abundance of the target sequences in the blotted DNA preparations can
subsequently be determined using hybridization analysis. The blot produces a
hybridization pattern that may be analysed using densitometric scanning. To elabo-
rate it, the technique comprises hybridization of a biotinylated oligonucleotide probe
to DNA samples immobilized on a nylon membrane and subsequent binding of
streptavidin-horseradish peroxidase conjugate to the arrested biotin molecules. The
peroxidase that is indirectly attached to the DNA samples reduces hydrogen perox-
ide when chemiluminescent detecting reagents are added. This reaction is associated
with the oxidation of luminol, and the photons emitted are sensed using autoradi-
ography film. The amount of DNA immobilised on the membrane in each spot is
correlated with the size and density of the slots created on the film. Therefore, by
comparing the dots made from a series of dilutions of a standard DNA sample, one
may estimate the amount of DNA present in the sample extract slots (Saferstein
204 M. Samuel et al.

2002). Because the denaturation of samples is essential to the process, this technol-
ogy can be applied to DNA that has been extracted using a Chelex. The assay is
“human” DNA-specific as the oligonucleotide probe’s sequence complements the
D17Z1 satellite repeat region, which is only present in higher primates. This
measurement technique is sensitive up to 0.1 ng of DNA (Andersen 1998). It is a
simple technique and can be easily performed with limited resources. Even so, it was
still not as accurate as downstream PCR-based typing techniques. Therefore, even if
the quantification method showed that no DNA was present in the sample, the
majority of laboratories would still amplify it. Additionally, slot blot data interpreta-
tion has been difficult, subjective, and time-consuming.

15.3.2.5 Alu-Element-Based Quantitation

To further develop the existing techniques, procedures that did not require sample
hybridization on membranes were created which eventually helped in speeding up
the quantification process. The AluQuant™ human quantification system is one
example of this kind of system (Mandrekar et al. 2001). The high copy number
Alu repeats in the human and primate lineages are the focus of the AluQuant assay.
A family of repeated elements known as Alu sequences can be found in the human
genome in quantities ranging from 500,000 to 1,000,000 copies, making up 6–13%
of the haploid genome (Schmid 1996; Mighell et al. 1997). A-rich region connects
two comparable monomers that make up the consensus Alu sequence, which is
around 280 base pairs long. Alu sequences are thought to be retroposons descended
from 7SL RNA, which is present in all species and has undergone significant
amplification during the years of primate evolution (Schmid 1996). In this assay,
the target DNA is hybridised with an Alu-based probe, starting a series of enzymatic
processes that result in the creation of light that may be detected by a luminometer.
The test is sensitive down to 50 pg of DNA and has a dynamic range of 0.1–50 ng
(Mandrekar et al. 2001). The advantage of the AluQuant method over the slot blot
method is that the DNA does not need to be blotted or bound to a fixed surface for
this assay. The assay calls for two separate samples of each standard and crime scene
sample, which can add to the operator's workload and material requirements while
also requiring the use of larger quantity of forensic sample. Additionally, a
luminometer is also required for this quantitation method. Alu element-based alter-
native approaches for the rapid identification and quantitation of human DNA are
being now employed that use Alu PCR-based system to quantify human genomic
DNA from 2.5 to 100 pg (Walker et al. 2003; Nicklas and Buel 2003b).

15.3.3 PCR-Based Quantitation

15.3.3.1 Real-Time PCR

One of the most potent instruments for quantitative nucleic acids analysis which has
been made available to the scientific, medicinal, and diagnostic communities has
been PCR in real-time. This new method is an improvement on the original PCR,
which was created in the middle of the 1980s by Kary Mullis and colleagues. Real-
15 Quantitation and Quality Assessment of DNA 205

time qPCR with TaqMan or 5′-nuclease fluorogenic assay is mostly commonly used
where the amplification has to be monitored in real time. A fluorescent reporter is
thus employed to observe the accumulation of amplified products during PCR. The
fluorescence signals of the reporter molecule increase as amplified products gather
with each cycle of PCR. Real-time qPCR is superior to other approaches in that it
operates in a closed-tube system, severely lowering the risk of contamination or
carryover, and it generates a linear response proportionate to the amount of input
DNA up to 5 orders of magnitude. Other advantages include higher sensitivity with a
large dynamic range (30 pg to 100 ng) as well as more precise measurements of
smaller quantities of DNA in samples, lesser laboratory manipulations, flexibility
towards automation and an ability to sense PCR inhibitors (Singh and
Roy-Chowdhuri 2016).
There are commercial qPCR kits available for measuring the amount of Y
chromosome and human DNA. In addition, the qPCR technique can be used to
quantify mtDNA. qPCR amplifies particular DNA sequences while also measuring
their amounts at the same time using commercially available fluorescence-detecting
thermocyclers. A sequence-specific fluorescently labelled oligonucleotide probe or
an intercalating double-stranded DNA-binding dye can serve as the fluorescent
reporter. One of the most commonly used real-time PCR techniques is the TaqMan
method.
A TaqMan assay uses standard PCR procedures. The probe, which has a fluores-
cent molecule (often FAM) on the 5′ end that is quenched by another dye (com-
monly TAMRA) on the 3′ end, attaches to the PCR product during the annealing
phase of the reaction. Through the phenomenon of fluorescent resonance energy
transfers (FRET), the quencher significantly lowers the fluorescence given off by the
reporter while the probe is still intact. As the PCR primer is extended, this probe is
broken down by the 5′ exonuclease activity of Taq polymerase, which allows the
fluorophore to become free of the quencher and report fluorescence. More the
amount of free fluorophore produced during each PCR cycle results in fluorescence
that is directly proportional to the number of cycles and the amount of input DNA.
For a given amount of amplified product, fewer PCR cycles are needed if there is the
presence of higher initial concentration of target templates in the sample. The initial
concentration of target templates can be shown using the cycle threshold (Ct). The
cycle threshold (Ct) value is thus defined as the cycle number when the fluorescence
of a PCR product can be detected above the background signal. Therefore, the Ct
value increases with a decreasing amount of template. A plot of CT against the log10
of the initial concentration of a set of DNA standards will yield the standard curve
(straight line) and target sequences in an unknown sample can be measured by
comparing it to the standard curve. However, artifacts from the reaction mix or
instrument can modify the fluorescence measurements linked with the Ct calculation
and this will result in template-independent changes to the Ct value. Therefore, the
Ct values from PCR reactions run under different conditions or with different
reagents are not compared directly (Pryor and Wittwer 2006).
Further, PCR inhibition can also be quantified by examining the consequence of
the inhibitor on the internal control sequence cycle threshold, curves and their
206 M. Samuel et al.

characteristics. Variations that modify the slope may exhibit lowering of amplifica-
tion efficiency and, therefore, a possible inhibition of the DNA polymerase. A shift
of the curve to later cycles with no modifications in slope may direct towards
competitive template binding inhibition (Lee et al. 2014).

15.4 Conclusion

The chapter describes several techniques for quantifying DNA for forensic studies.
These methods were initially centred on the straightforward quantification of total
DNA using UV or dyes, regardless of the species of origin. But with the advent of
human-specific PCR techniques, exact quantification for STR studies is now possi-
ble with sensitivity reported down to picogram levels. Future multiplexing of assays
focusses on simultaneous quantification of human nuclear, Y chromosome, and/or
mtDNA as well as DNA quality evaluation in a single tube. This is only made
possible by the development of new multiplex qPCR techniques which can target
several loci of varied sizes. Along with this, the use of internal positive controls has
also enabled the measurement of inhibition. All this together has opened up many
different possibilities and will lead into generation of a plethora of useful informa-
tion for the forensic scientist.

Multiple Choice Questions

1. Short fragments of DNA with radioactive tags are known as

(A) Probes
(B) Primers
(C) STRs
(D) SSRs
Answer: A
2. Which of the following cells are not useful for DNA analysis
(A) Spermatozoa
(B) Vaginal cells
(C) Red Blood Cells
(D) Buccal Mucosal cells
Answer: C
3. The first technique that was adopted for forensic DNA analysis was
(A) PCR
(B) STR
(C) RFLP
(D) HLA-DQAI
Answer: C
4. TaqMan assay is a type of method used in
(A) RT PCR
(B) End-Point PCR
(C) Real-time PCR
15 Quantitation and Quality Assessment of DNA 207

(D) Alu Quant

Answer: C
5. Ct value stands for
(A) Cytochrome threshold
(B) Cycle threshold
(C) Cycle time
(D) Cell threshold
Answer: B
6. UV spectroscopy is a technique used for
(A) DNA typing
(B) DNA quantitation
(C) Species specific DNA quantitation
(D) DNA profiling
Answer: B
7. Alu sequences are
(A) Interspersed repetitive DNA elements
(B) Plasmid
(C) Cosmid
(D) Vector
Answer: A
8. EtBr (ethidium bromide) which is a carcinogen is frequently used in
(A) PCR
(B) Agarose gel electrophoresis
(C) DNA profiling
(D) Spectrophotometry
Answer: B
9. Internal control sequences are used in PCR for examining
(A) PCR inhibition
(B) Annealing
(C) Extension
(D) Polymerase activity
Answer: A
10. Streptavidin-horseradish peroxidase conjugate is used in which of the following
quantitation technique.
(A) Electrophoresis
(B) UV spectroscopy
(C) Reverse Transcriptase PCR
(D) Slot Blot assay
Answer: D
208 M. Samuel et al.

References
Andersen J (1998) Quantification of DNA by slot-blot analysis. Methods Mol Biol 98:33–38.
https://doi.org/10.1385/0-89603-443-7:33
Barbisin M, Shewale J (2010) Assessment of DNA extracted from forensic samples prior to
genotyping. For Sci Rev 22(2):199–214. https://doi.org/10.1201/B15361-10
Gallagher SR (1994) Quantitation of DNA and RNA with absorption and fluorescence spectros-
copy. Curr Protoc Hum Genet 116:1–8. https://doi.org/10.1002/0471142905.HGA03DS00
Köchl S, Niederstätter H, Parson W (2005) DNA extraction and quantitation of forensic samples
using the phenol-chloroform method and real-time PCR. Methods Mol Biol 297:13–30. https://
doi.org/10.1385/1-59259-867-6:013/COVER
Lee SB, Mccord B, Buel E (2014) Advances in forensic DNA quantification: a review. Electropho-
resis 35:3044–3052
Mandrekar MN, Erickson AM, Kopp K et al (2001) Development of a human DNA quantitation
system. Croat Med J 42:336–339
Mighell AJ, Markham AF, Robinson PA (1997) Alu sequences. FEBS Lett 417:1–5. https://doi.org/
10.1016/S0014-5793(97)01259-3
Nicklas JA, Buel E (2003a) Quantification of DNA in forensic samples. Anal Bioanal Chem 376:
1160–1167
Nicklas JA, Buel E (2003b) Development of an Alu-based, real-time PCR method for quantitation
of human DNA in forensic samples. J Forensic Sci 48:2002414. https://doi.org/10.1520/
jfs2002414
Pryor RJ, Wittwer CT (2006) Real-time polymerase chain reaction and melting curve analysis.
Methods Mol Biol 336:19–32. https://doi.org/10.1385/1-59745-074-x:19
Saferstein R (2002) Forensic science handbook, vol 1. Prentice Hall, Hoboken
Schmid CW (1996) Alu: structure, origin, evolution, significance and function of one-tenth of
human DNA. Prog Nucleic Acid Res Mol Biol 53:283–319. https://doi.org/10.1016/S0079-
6603(08)60148-8
Singer VL, Jones LJ, Yue ST, Haugland RP (1997) Characterization of PicoGreen reagent and
development of a fluorescence-based solution assay for double-stranded DNA quantitation.
Anal Biochem 249:228–238. https://doi.org/10.1006/ABIO.1997.2177
Singh C, Roy-Chowdhuri S (2016) Quantitative real-time PCR: recent advances. Methods Mol Biol
1392:161–176. https://doi.org/10.1007/978-1-4939-3360-0_15
Sutherland BM, Shih AG (1983) Quantitation of Pyrimidine dimer contents of nonradioactive
deoxyribonucleic acid by electrophoresis in alkaline agarose gels. Biochemistry 22:745–749.
https://doi.org/10.1021/BI00273A006/ASSET/BI00273A006.FP.PNG_V03
Volkin E, Cohn WE (1954) Estimation of nucleic acids. Methods Biochem Anal 1:287–305. https://
doi.org/10.1002/9780470110171.CH11
Walker JA, Kilroy GE, Xing J et al (2003) Human DNA quantitation using Alu element-based
polymerase chain reaction. Anal Biochem 315:122–128. https://doi.org/10.1016/S0003-2697
(03)00081-2
Polymerase Chain Reaction:
An Indispensable Molecular Biology Tool 16
of 21st Century

Parth Sharma, Aditi Mishra, Sarthak Misra, Ulhas Gondhali,

and Tanya Chauhan

Abstract

Due to its universal applications, Polymerase Chain Reaction (PCR) became an

essential technique in various scientific branches such as microbiology, biotech-
nology, oncology, clinical studies, forensic science, phylogenetic studies, migra-
tion studies, and genetic testing. It can selectively amplify a nucleotide sequence
from a complex mixture of sequences with a reproducible and easily operatable
protocols in a common laboratory. The modern PCR workflows and systems have
advanced to a point where it can amplify a low abundant nucleotide sequence
from a single cell and run high-throughput runs using nano well or chip-based
systems. In this chapter we are taking a tour that explores the fundamentals of
PCR and its components, mode of action of various PCR workflows and systems,
foundation of primer designing, and optimizations of PCR protocols.

P. Sharma
School of Applied Sciences and Technology, Gujarat Technological University, Ahmedabad,
Gujarat, India
A. Mishra
Kristu Jayanti College, Bangalore, India
S. Misra
Indira Gandhi Institute of Medical Sciences, Patna, India
U. Gondhali (✉)
Jindal Institute of Behavioural Sciences, O.P. Jindal Global University, Sonipat, India
T. Chauhan
Department of Forensic Science, National Forensic Science University Delhi Campus (LNJN
NICFS), New Delhi, Delhi, India

# The Author(s), under exclusive license to Springer Nature Singapore Pte 209
Ltd. 2024
A. Puri et al. (eds.), Fundamentals of Forensic Biology,
https://doi.org/10.1007/978-981-99-3161-3_16
210 P. Sharma et al.

Keywords

Polymerase chain reaction (PCR) · Primers · Nucleotides · Amplification · Gel

electrophoresis

16.1 Definition of Terms

PCR Polymerase chain reaction

Polymerases Enzymes that extend nucleotide polymers such as DNA
Primers Oligonucleotide that selectively binds to a target sequence and marks the start
point of amplification for DNA polymerase
Template Sequence of interest potentially containing a sequence region to be amplified
Amplicon A target sequence amplified by PCR

16.2 Introduction to Polymerase Chain Reaction (PCR)

Central dogma of molecular biology (CDMB) is the core principle followed by every
known life to manifest its features. Therefore, components of CDMB such as nucleic
acid (DNA and RNA) can be used to infer sequence-specific features of the source
organism via genetic analysis. But recovery of these nucleic acids is dependent on
the type and condition of initial samples, as the samples may contain mixed nucleic
acid from multiple organisms, and the nucleic acids are highly degradable in open
environment. Even if nucleic acids are extracted in high quality and quantity,
analysis at genome level becomes expensive and impractical for most of the cases.
All above-mentioned hurdles can be overcome and reproducibility of the analysis
can be improved by use of the Polymerase Chain Reaction (PCR) technique. Kary
Mullis innovated the PCR method in the year 1983 from an idea he had during a
weekend drive to his cabin in the woods with his girlfriend for which he was
awarded with the Nobel Prize in Chemistry in the year 1993. (Rahman et al. 2013)
Polymerase chain reaction in its essence is a protocol used for amplification of the
nucleic acid strands at specific loci to exponentially multiply the existing copies for
enhanced detection. Due to its wide applications, this technique is used around the
globe routinely by scientists in various fields.
Since its birth, the technique has evolved into multiple generations of PCRs
including traditional PCR wherein the region of interest in the DNA strand was
amplified and the amplicon band was qualitatively visualized on the gel slab of
Agarose or Polyacrylamide Gel Electrophoresis, a quantitative PCR (q-PCR) capa-
ble of quantifying the amplification in real time, and modern digital PCR (d-PCR)
with higher sensitivity and amplification power. There are a lot of advantages of the
PCR technique that has made it indispensable because of its ability to reproduce
results, rapidly generate large concentrations of DNA for analysis, operate in
multiplex samples in a single run easily and economically, and allow dynamic
16 Polymerase Chain Reaction: An Indispensable Molecular Biology Tool of. . . 211

range of run cycles based on the choice and requirement of the researcher. For
example, traditional PCRs become common laboratory utility used by researchers,
whereas q-PCR gained spotlight during the Covid-19 pandemic where it was
considered a Gold-standard for determining if a person was infected with the
virus, and if yes, how much was the viral load present in the individual and up to
what extent was the individual capable of spreading the virus in the surrounding
environment.
With the advantages, there are few limitations associated with the PCR protocol
like necessary prior knowledge of the sequences to be amplified, inhibitor
contaminations can prevent the amplification process, increased number of cycles
or sequence similarity in primer sequences cause generation of non-specific PCR
products, and a smaller number of cycles or non-binding primers generate products
in non-detectable limits. Non-specific binding also occurs with high GC content in
the primer resulting in formation of unnecessary products along with the required
amplified regions giving false positive results.

16.3 Components and Factors Affecting PCR

The PCR is executed with a 0.2–0.5 ml reaction tube placed in a thermocycler

(machine that can modulate temperature change over time). The reaction mixture
includes a target nucleic acid template, short oligonucleotide sequences called
primers that selectively bind and assist in amplifying a sequence region between
the binding sites from the template, thermostable polymerase with co-factor that can
execute the amplification process between bound forward and reverse primer (for-
ward primer attaches to anti-sense strand and reverse primer attaches to the sense
strand), free nucleotides that are used by polymerase as a building block to synthe-
size the amplicon in 5′–3′ direction, and a buffer to maintain optimal pH range of
8.0–9.5. The quality of the amplification can depend upon quantity of template,
effective binding of primers to targeted site, type of polymerase used, concentration
of co-factors, and presence of any inhibitors (Roux 2009) (Fig. 16.1).
Next, the PCR workflow, a program instructing thermocycler to temporally
change the temperature in controlled manner, is divided into three steps: Denatur-
ation, Annealing, and Extension. The denaturation occurs in a temperature range of
94–95 °C, where the unwinding of the double-stranded nucleic acid strands such as
DNA occur so that the primers and polymerase can bind to it in the next step of
annealing where the temperature should be below the denaturing temperature and
compatible with the physical properties of the primers used which can usually range
between 50 and 60 °C for the commonly used universal bacterial 16S ribosomal
RNA gene primers. The third and final step of the protocol is extension wherein the
added dNTPs get attached to the strand to form a complementary strand to the
template strand and the temperature range of this step depends on the type of
polymerase used for the amplification which is 72 °C for commonly used Taq
DNA Polymerase (Joshi and Deshpande 2010).
212 P. Sharma et al.

Fig. 16.1 Components and

factors affecting reaction rate
in PCR

16.4 Types of PCR

With the development of modern molecular tools, PCR technique also advanced to
improve its detection sensitivity, detection resolution, amplification length, detection
of nucleotide modifications, and its error rates. These advancements are usually
attained by incorporation of polymerases with unique properties, use of special
primer setups, chemical or physical modification of the template before or after the
PCR, and/or use of template or probe binding dyes to measure amplification in
real time.

16.4.1 Use of Various Enzymes in PCR

16.4.1.1 Reverse Transcriptase PCR (RT-PCR)

The protocol is based on amplification of RNA sequences by converting the RNA
sequences to cDNA form by use of enzyme called reverse transcriptase. Primers for
this first PCR step are selected based on the target RNA population to be amplified.
For example, if sample source is eukaryotic and the objective is to study mRNA
population, then poly-dT primers are used to selectively amplify RNAs with poly-A
tail, whereas random hexamer primers are used to arbitrarily amplify RNA
molecules from the samples. The cDNA is then subjected to second PCR allowing
16 Polymerase Chain Reaction: An Indispensable Molecular Biology Tool of. . . 213

synthesis of the complementary DNA strand with primers designed based on the
cDNA nucleotide sequence and the protocol is carried out using the steps of the
standard PCR protocol. One of the applications of the DNA amplified using RNA as
a precursor is that the amplified product is devoid of introns. Other applications of
this technique include study of indels, genetic disease detection, oncological detec-
tion, and detection of expressed genes.

16.4.2 Amplified Fragment Length Polymorphism (AFLP)

In this modification of the PCR protocol, the template strand of interest is cut into
fragments via restriction endonucleases that are further ligated with adapters to
ensure primer binding prior to the amplification. The fragments created can vary in
length based on the distribution of endonuclease-specific restriction sites on the
template and hence the amplified products are of varied lengths that are visualized as
separate bands on the agarose gel. The protocol is applicable in cases of assessing
diversity and determination of and within species level organisms assessing migra-
tion patterns, phylogenetic studies, and genetic mapping of organisms (Fig. 16.2).

16.4.3 High-Fidelity PCR

This version of PCR uses proofreading DNA polymerase instead of standard Taq
polymerase to improve the confidence of amplification. These high-fidelity
polymerases commonly have 3′–5′ exonuclease activity to remove erroneous nucle-
otide and incorporate the correct nucleotide to lower the PCR error rate at a cost of

Fig. 16.2 Amplified fragment length polymorphism (AFLP)

214 P. Sharma et al.

longer run time. The high-fidelity PCR is essential for experiments where accuracy
of amplification is required such as next-generation sequencing (NGS), SNP analy-
sis, and cloning protocols. Eckert & Kunkel (1991)

16.4.4 Hot Start PCR

In case of challenging PCR protocol where amplification is carried out at room

temperature, the reaction may reduce the amplification amplitude by developing
primer-dimers. This issue can be solved by using antibody-blocked polymerase that
is activated only after denaturation step, hence preventing formation of primer-
dimers. In simple terms, this method reduces the non-specific amplification and
potentially increases the amplification yield.

16.4.5 Ligation-Mediated PCR

In studies concerning unknown nucleotide sequences, known adapter or linker

sequence is ligated to the unknown sequence of interest by DNA ligase before
amplification using linker-specific primers. Usually, these adapters are short
oligonucleotides and come handy during DNA foot printing, genome walking, and
DNA sequencing. In NGS, ligation-mediated PCR is used to index a nucleotide
sequence using specific adapter that can be identified and utilized to separate the
sequences during post-sequencing analysis.

16.4.6 Fast-Cycling PCR

Fast-Cycling PCR has high speed of amplification due to use of modified

polymerases and/or affinity increasing buffers. This PCR protocol can significantly
reduce the time of amplification cycles and aid in rapid disease diagnosis in clinical
settings.

16.4.7 RNase H-Dependent PCR

RNase H are sequence non-specific endonucleases that cleave DNA/RNA hybrids.

These enzymes are used with RNA blocked primers, which can only conduct
amplification after successful RNase H activity. As commonly used RNase H are
active at higher temperature, this method provides an alternative to the Hot
start PCR.
16 Polymerase Chain Reaction: An Indispensable Molecular Biology Tool of. . . 215

16.4.8 Use of Different Primer Setups in PCR

16.4.8.1 Multiplex PCR

Multiplex PCR allows amplification of multiple target sequences in a DNA strand
using multiple primers at different temperature ranges in a single PCR run. The
primers used in the protocol are designed in a manner that all the primers have the
same annealing temperature. This causes simultaneous attachment of the sequence-
specific primers, and a temperature-mediated DNA polymerase is used for the
reaction. The protocol is employed wherein simultaneous detection of multiple
sequences is required. The protocol is highly benefitting as it provides simultaneous
detection and is economic and less tedious. Application of the technique includes
genotyping, STR analysis, detection of mutations, indels, polymorphism, and study
and detection of disease-causing pathogens and other organisms.(Elnifro et al. 2000)

16.4.9 Allele-Specific PCR

The technique is employed in laboratories for detection of SNPs detection. As the

name suggests, the method is efficient in differentiating the alleles present in the
sample DNA. The newly modified method in the technique uses two forward
primers each containing mismatch of the allele to be amplified. The reverse primer
used is common. The two forward primers used are of varied lengths ensuring their
separation and identification when visualized on the agarose gel post-PCR. Gaudet
et al. (2009) The technique is applicable in detecting single nucleotide variations,
blood group genotype determination, etc. (Fig. 16.3).

Wells with amplified sample for detection

Template Strand with the specific

alleles present on one strand
Allele -specific forward primers of different
lengths and a common reverse primer

Primer length-based separation

Visualization of amplification using Agarose Gel

Electrophoresis

Fig. 16.3 Allele-specific PCR

216 P. Sharma et al.

16.4.10 Asymmetric PCR

In this version of the PCR protocol, there are two primers used, forward and reverse
like the regular PCR protocol with the modification being that one of the primers is
added in excess amounts. This causes higher amplification of one of the DNA
strands as compared to the other. The PCR product generated at the end of the
reaction is in fraction as compared to the total product as the total product is inclusive
of the Single Stranded DNA (ssDNA) formed due to the primer added in excess.
This technique is employed when preferential amplification is expected, and the
preferential amplification can be detected using agarose gel electrophoresis or probe-
based methods (Fig. 16.4).
A modification to this protocol is the Linear After the Exponential (LATE) PCR
wherein the limiting primer uses a higher temperature, and at the start of the PCR
reaction, the efficiencies of both primers are equal thereby providing a good reaction
efficiency, and upon the complete depletion of the limiting primer, the excess
synthesis of the ssDNA begins and carries on for the remaining cycles of the run.
Applications of asymmetric PCR include sequencing, mutagenesis studies, and
hybridization studies.

16.4.11 Intersequence-Specific (ISS) PCR

As the name suggests, the modified PCR protocol employs use of repetitive
sequences present within the desired DNA strands. Primers complementary to
these repeating sequences are designed and then used for amplification of the
DNA strand. The primers designed are short usually between 26 and 25 bp long
ensuring high sensitivity of amplification. This causes the DNA strand to produce a
unique fingerprint product as the number of the repetitive sequences is unique for
each DNA sequence. The varied applications of the protocol include genomic
fingerprinting, phylogenetic analysis, species-specific testing, genetic mapping,
assessment of genetic diversity, and gene tagging.

Excess of Forward primers (FP) along with

Template Strand Amplified dsDNA Excess of ssDNA due to
limiting amounts of Reverse primers (RP) excess of Forward Primer

Fig. 16.4 Asymmetric PCR

16 Polymerase Chain Reaction: An Indispensable Molecular Biology Tool of. . . 217

16.4.12 Mini-Primer PCR

This PCR protocol allows use of primers of short lengths (9–10 nucleotides) by
using an engineered thermostable polymerase enzyme specifically designed to carry
out the reaction. This allows specific binding of the primer to the regions of the DNA
strand of highly conserved nature. This protocol is specifically designed to target 16s
rRNA sequences undetectable by using standard primers. Other applications of
Mini-primer PCR include targeting smaller primer binding regions and amplification
of highly conserved DNA sequences such as 16 (or eukaryotic 18S rRNA genes).

16.4.13 Nested PCR

The protocol is highly sequence-specific. Prior knowledge of the complete sequence

of interest to be amplified is essential before employing this method. The method
uses two different primers for amplification which are used in tandem. Two PCR
runs are required for complete amplification of the product. The first run is identical
to the standard PCR protocol wherein the region of interest is amplified. In the
second run, PCR primers specific to a secondary region of the amplified product are
used ensuring the amplification of only the targeted region. This technique is highly
specific and provides high-quality results and can be employed in cases of low initial
DNA concentration. Application of this technique includes genetic testing, phyloge-
netic studies, migration studies, and detection of different pathogens.

16.4.14 RAPD: Rapid Amplified Polymorphic DNA Analysis

RAPD uses around 10 bp long random primers that bind and amplify non-specific
sites from the template of interest. This protocol allows molecular exploration of
organisms by producing unique band patterns on agarose gel distinguishing between
individuals, strains, species, and other higher taxonomic class.

16.4.15 RACE: Rapid Amplification of cDNA Ends

The RACE protocol completes the unknown end of cDNA by using primers binding
at small known regions within mRNA. If the protocol is amplifying 3′ end of the
mRNA, then it is called 3′-RACE, else it is known as 5′-RACE. Regardless of its
type, the complete protocol may amplify the full-length cDNA. As this method uses
an anchored sequence within mRNA to complete its end, it is also known as
anchored PCR.
218 P. Sharma et al.

16.4.16 Differential Display PCR

Before the development of modern techniques to study differential gene expression

between tissues or cells such as RNA-seq, microarrays, and qRT-PCR, the differen-
tial display PCR was used to separately amplify mRNA load from the samples in
comparison and difference in their agarose gel band patterns was observed to detect
differential gene expression. This method is a cheap alternative to selectively study a
small number of tissue or cell-specific mRNA expressions.

16.4.17 Unidirectional Genome Walking

In this PCR method, partial sequence information is used to design a primer that can
randomly amplify the genome in one direction. It enables charting of unexplored
gene and genome region. Because the method can be utilized to complete the linear
or circular chromosome, it is also called chromosome walking.

16.4.18 Use of Dyes and Chemicals in PCR

16.4.18.1 Real-Time PCR (q-PCR)

It is the qualitative method for estimating the PCR product formed in real time. The
protocol uses the standard PCR techniques with fluorescent dyes that aid in detection
and quantification of the PCR product. The process is carried out by adding a
fluorescent probe (reporter) along with a quencher into the DNA sequence during
the denaturation step. The binding of the reporter and the quencher keeps the reporter
from emitting fluorescence. As the target sequence begins to amplify, the bond
between the reporter and the quencher breaks causing the fluorescent probe to emit
fluorescence. This emitted fluorescence is detected by the detector, and based on the
intensity of fluorescence, a real-time graph is plotted of the amplification products.
The protocol has received high importance during the Covid-19 pandemic for its
ability to detect the SARs-CoV virus. Other application of the technique includes
detection of SNPs, genotyping, oncological detection, testing of bacterial and viral
loads, and GMO detection. Kubista et al. (2006)

16.4.19 High-Resolution Melt (HRM) PCR

The protocol of HRM PCR is remarkably like q-PCR with the modification being the
increased sensitivity of the protocol towards detection of SNPs. This protocol
follows steps like the q-PCR wherein dyes are used as probes for detection of the
amplification product. Herein, the dyes used are highly saturated and can detect PCR
products with very minor temperature variation of 0.01–0.02 °C. Highly
concentrated dyes such as LC Green PLUS, Eva Green, etc. are used as opposed
to SYBR Green used in q-PCR reactions. Detections of SNPs are through their
16 Polymerase Chain Reaction: An Indispensable Molecular Biology Tool of. . . 219

variation in melting behaviour due to change in their nucleotide composition.

Analysis of the PCR product is carried out by studying the amplification and melting
curves. To obtain high-quality results, standardization is essential in this protocol.
Application of this protocol includes detection of indels, SNPs, and food safety
analysis. (Druml & Cichna-Markl 2014)

16.4.20 Methylation-Specific PCR (MSP)

Sodium bisulfite treatment converts unmethylated cytosines to uracil while leaving

methylated cytosines in the DNA sequence. To find the methylated cytosine using
PCR in known sequence, two sets of primers are designed from which one set binds
to unchanged methylated cytosine and another set binds to the uracil representing the
unmethylated cytosine. Successful amplification from specific primer set will con-
firm the cytosine methylation status in the target sequence. It is crucial to conduct a
stringent PCR for this method because of non-specific primer template binding
resulting from uracil presence.

16.4.21 Advanced PCR Protocols and Systems

16.4.21.1 Digital PCR (d-PCR)

The most advanced generation of the PCR technique, dPCR allows amplification of
rare targets. The technique can also be used in case the sample consists of high
amounts of inhibitors. The principle of d-PCR is based on q-PCR workflow. Kuypers
and Jerome (2017) The reagents and amplification occur in the fashion as that of
q-PCR. The detection method is binary based on Poisson Distribution (1,0). The
protocol has a high mutation detection rate with mutations less than or equal to
0.001%; the difference in this technique is that d-PCR uses nanoplates in place of the
96 well plates employed for q-PCR reactions.
The protocol for dPCR includes loading master mix into the nanoplates followed
by sealing the upper end of the plate using the rubber seal. There are probes present
in the thermal cycle that push the samples into the nano wells after which the nano
wells are sealed from the bottom separating each well. Each nano partition then
undergoes thermal cycles and nanoparticles with the template strand amplify. The
templates that amplify emit fluorescence based on the concentration of the amplified
template. Precaution to be taken in case of protocol execution is that the initial
concentration of DNA template taken for amplification should be low as higher
concentrations cause errors in analysis. DNA samples that can be used as template
include gDNA, Formalin fixed paraffin embedded DNA, and circulating free DNA.
Applications of the technique include mutation detection, SNP genotyping,
assessing Copy Number Variations, Microbiome analysis, and Wastewater RNA
determination. Along with all the modifications in the technique, the technique
throughout the recent years has miniaturized to make it easily portable and compact.
These PCR models available are either Droplet-based systems, Chip-based systems,
220 P. Sharma et al.

and Hybrid-systems. Development of these compact models has led to less use of
reagents thereby saving experimentation costs and have increased sensitivity and
thus increasing the accuracy of the protocol. Also, the time required for carrying out
amplification is reduced with the development of the techniques.

16.4.22 Droplet-Based System

Herein, the sample added into the system is in the form of a droplet containing the
sample. This droplet is enclosed within a system of mineral oil or an immiscible
liquid. For performing the protocol, the sample is first split to form droplets which
are then subjected to DNA extraction and purification followed by encircling
the dots with the immiscible liquid. These droplets are then subjected to PCR and
the amplified product is detected by fluorescence. This technique is beneficial as the
sample requirement is in nanolitres and can be specifically used in case of single cell
studies or in sequencing. Example of this system is emulsion PCR used by Ion
torrent NGS platform where primer coated Ion sphere particles are used to amplify
the template DNA in a water-in-oil emulsion droplet before sequencing.

16.4.23 Chip-Based System

Chip-based systems used a chip as a base embedded with microwells or microfluidic

channels wherein amplification takes place. These chips are constructed from
materials such as silicon, glass, or other polymeric entities. The reaction mixture is
added into the chips and the amplification process is carried out within the chips
itself. Well-known example of such chip-based amplification system is the flow cell
used to conduct NGS by illumina.

16.4.24 Hybrid System

In this system, the reaction mixture placed on a stationary surfaced is covered by an

immiscible liquid. The area within the liquid acts as a closed system for the reaction
to occur. The necessary temperature ranges for amplification are provided to the
system externally by heating and cooling apparatus. The amplified product is
visualized using fluorescence-based detection system.

16.4.25 Colony PCR

Colony PCR is heuristic approach carried out directly with addition of intact cells
into the reaction mixture to bypassing the separate nucleic acids extraction proto-
col. (Cavanaugh & Bathrick 2018) This method physically lyses the cells during
denaturation step and releases nucleic acids for amplification via standard PCR
16 Polymerase Chain Reaction: An Indispensable Molecular Biology Tool of. . . 221

protocol. Usually, this method is conducted with an isolated colony of bacteria to

amplify either 16S rRNA gene or gene present on a plasmid and hence known as
colony PCR.
Similar shortcut approach can be applied to other types of cells if it does not
inhibit or contaminate the PCR protocol.

16.4.26 Single-Cell PCR

Current benchtop molecular techniques use the total nucleic acids extracted from a
mix population of cells which can overshadow the unique features of individual cells
or cell type. This limitation can be rectified using advanced cell sorting tools such as
flow cytometry which can separate individual cells based on physical appearance,
dye tagging, and surface markers. After enrichment of specific cells, PCR with high
sensitivity is applied to even amplify a low abundant nucleic acid sequence from the
single cell-derived template.

16.4.27 In Situ PCR

This method is used to study the localization of cell-specific nucleotide sequences

and markers. Tissue or cells of interests are carefully processed and fixed on a slide
or a chip before treating with suitable radiolabelled, fluorescently labelled, or biotin-
labelled nucleic acid primers that can release amplification signals as a result of PCR
protocol. The intensity of these signals depends upon the pre-processing and fixing
of the sample. In situ PCR can be used to assess the disease and development
progression in its native state.

16.5 Primer Designing

An ideal primer should strongly and selectively bind with the target region in
template only at a specific annealing temperature to promote successful PCR
protocol without any non-specific amplification. Therefore, designing of primers
requires consideration of template sequence information, primer GC content, primer
length, and primers’ complimentary and melting temperature difference with those
of other primers used in the same reaction. Usually, length of primer depends upon
the type of PCR it is designed for such as standard PCR primers are 15–30 bps long,
whereas multiplex PCR uses primers in range of 21–30 bps to avoid any inter primer
similarities leading towards formation of primer-dimers. Common GC content of
standard primers is between 30 and 60% with circumventing presence of multiple C
or G in a row at 3′ end. It is crucial to have a strong complementary between 3′ end
of primer and the template at a unique sequence region for higher selectivity. The
maximum temperature difference between the forward and reverse primer strands
should be within 5 °C. Design and selection of best set of primers can be achieved by
222 P. Sharma et al.

use of various in silico tools such as Primer3. Elsalam (2003), Dieffenbach et al.
(1993), Green and Sambrook (2019), Koressaar and Remm (2007), Nimbkar and D,
Bhatt V. (2022). Predesigned commonly used primer sets can also be procured from
a manufacturer.
Above-mentioned designing parameters are followed when nucleotide sequence
of the template is well-known where all forward and all reverse primers are identical
and complementary to the targeted sequence in the template without any cross
binding. However, degenerate primers are designed when only amino acid sequence
information is available. Degenerate primers are mixture of primers having base
change in various positions to offset the degeneracy of genetic code resulting while
nucleotide sequence translation to amino acid sequence. Even with mixture of
variable primers, only few sets will be complementary with the template and the
rest might have similarities with other primers in the mixture, hence amplification
conditions should be optimized to minimize the non-specific amplifications with
careful designing of these primers. Degenerate primers should avoid any degeneracy
in 3′ end to improve template binding efficiency. Degree of degeneracy in these
primers can be increased by incorporating selective mismatches toward 5′ end to
cover more combination that may successfully amplify the unidentified target from
the template. It is advisable to keep degeneracy bellow fourfold at any given position
in a primer for better results. Once the desired primers are designed, they should be
checked against template sequence of interest using in-Silico PCR before their
procurement to verify feasibility of successful amplification and detection of
potential non-specific binding sites in the genome or template of interest. This
computational step will make the trial-and-error iteration of your primer
standardization time- and cost-effective Nybo (2013).

16.6 PCR Optimization

Successful amplification and reproducibility of a PCR workflow depends upon many

factors including features of primers, initial amount of template, type of DNA
polymerase used, nature of reaction additives, and parameters used for the reaction
condition. Results of a PCR protocol are improved by modifying one or more of
these parameters such as the denaturation duration is decided based on the GC
content of the sample as higher GC content is directly proportional to the time
required for denaturation, but longer denaturation steps can also damage the tem-
plate. However, presence of chemicals such as glycerol and DMSO can lower the
denaturation time. For annealing, the temperature range is lower than denaturation
and the formula for calculating annealing temperature or Tm or melting
temperature is: 4(G + C) + 2(A + T). Time required for annealing can vary based
upon presence of modified nucleotides and additives within the reaction mixture.
Extension efficiency is also known as processivity, and processivity of up to
60 bases/s is considered efficient in case of Taq polymerase enzyme. The extension
time required is dependent on the polymerase incorporated and the length of the
strand to be constructed. As each PCR protocol is unique based on the components
16 Polymerase Chain Reaction: An Indispensable Molecular Biology Tool of. . . 223

used in reaction mixture and the objective of the protocol, case-specific optimization
is required to obtain a robust result.

16.6.1 Optimizing Primer Concentration and Annealing

Temperature Using Gradient PCR

First step of PCR optimization is to identify optimal concentration and annealing

temperature of designed primer by trying range of primer concentration across range
of annealing temperatures. This can be achieved with use of modern gradient
temperature-enabled PCRs where the machine creates either horizontal temperature
gradient covering 12 different temperature and 8 reaction tubes per temperature or
vertical temperature gradient covering 12 reaction tubes per 8 individual temperature
setups. Running a single gradient PCR protocol allows assessment of 96 reaction
condition from which most optimal condition can be selected for efficient and
reproducible future PCR protocols.

16.6.2 Improving Amplification Yield by Modifying PCR Cycles

Second step of PCR optimization is finding an efficient cycling iteration to produce

strong amplification without any non-specific contaminations. As single PCR cycle
doubles the initial template concentration, the number of cycles is selected according
to the initial concentration of template used in the reaction. In case of normal
standard PCR protocol, ~30 cycles are run which produce approximately (10)10
copies of the initial strands. In case of lower initial template concentration, cycles
must be increased by 5–10 iterations to potentially produce detectable level of
amplification. Increasing PCR cycles can also improve the amplification signal of
low abundance nucleotide sequence from the sample.

16.6.3 Improving Amplification Sensitivity Using Touch Down PCR

In touch down PCR protocol, the annealing temperature of the primers is set in a
temperature range wherein the temperature reduces with each cycle of the reaction
until the actual annealing temperature of the primer is achieved. This initial high
annealing temperature reduces non-specific primer annealing within the DNA
sequence. The protocol is used in cases wherein the DNA sequence contains high
GC content. Till date, no limitations of the technique have been reported and it is
suggested to be employed on regular basis as the standard PCR protocol due to its
increased sensitivity. (Korbie and Mattick 2008)
Earlier mentioned “Hot-start PCR” and “RNase H-dependent PCR” can also
improve the amplification sensitivity by controlling polymerase activity using
weak inhibitor molecules and extra enzymes. However, the Touch Down PCR is
224 P. Sharma et al.

simpler and easy to operate as it does not require any extra molecular aid and
improve the sensitivity by gradual annealing temperature change.

16.6.4 Optimizing Long length PCR Amplification

Usual PCR reaction amplifies 3–4 kb long amplicons, but longer products are
difficult to produce because of secondary structures in template, suboptimal PCR
cycling condition, problematic primer binding, and depurination damage. These
challenges can be overcome by optimizing cycling condition, buffer additives, and
proofreading activity. Depurination damage during long-range amplification results
in smear band pattern and can be prevented or minimized by shorting the denatur-
ation time (~10 s) and lowering the extension temperature (68 °C). GC-rich region in
template can manifest hairpin loops which can halt the amplification process for
long-range PCR. It can be resolved by adding denaturing agents such as DMSO
which can change the melting behaviour of DNA opens secondary structures at
lower temperature. Use of standard Taq polymerase increases the probability of error
in long products and leads to false positive mutations in the products. This issue can
be solved by addition of proofreading polymerases in the reaction and improves the
efficiency of long-range PCR.

16.7 Conclusion

PCR is one of the benchmark technologies used by forensic investigators in genetic

testing. Based on the DNA samples collected from the scene of crime, investigators
extract the DNA to determine its source using reference samples of possible
suspects. In cases, wherein the concentration of the extracted DNA is low, amplifi-
cation of the extracted DNA provides the investigator with necessary concentration
for analysis. PCR is also a quintessential protocol that can be carried out when
working with samples of Mass Disaster Victims. PCR-based paternity testing can
also be performed in disputed paternity cases. Along with this, migration pattern
analysis, species determination, and phylogenetic analysis can be carried out. Other
applications of PCR protocol involve q-PCR-based amplification for biotechnologi-
cal, biomedical, microbiological, and clinical studies.

Multiple Choice Questions

1. q-PCR is the generation of the PCR technique

(A) 1st
(B) Next generation
(C) 3rd
(D) 2nd
2. Are q-PCR and RT-PCR terms interchangeable
16 Polymerase Chain Reaction: An Indispensable Molecular Biology Tool of. . . 225

(A) No
(B) Yes
(C) Inadequate information
(D) None of the above
3. Within the d-PCR workflow, wells are used
(A) micro
(B) PCR
(C) 96
(D) nano
4. In asymmetric PCR, there is excess formation of
(A) gDNA
(B) cDNA
(C) ssDNA
(D) Template strand
5. Co-factor essential for extension in PCR is
(A) Mg+2
(B) Ca+2
(C) Na+
(D) None of these

Answers

1. (D)
2. (A)
3. (D)
4. (C)
5. (A)

References
Cavanaugh SE, Bathrick AS (2018) Direct PCR amplification of forensic touch and other challeng-
ing DNA samples: a review. Forensic Sci Int Genet 32:40–49
Dieffenbach CW, Lowe TMJ, Dveksler GS (1993) Genome Res 23:566–573
Druml B, Cichna-Markl M (2014) High resolution melting (HRM) analysis of DNA – its role and
potential in food analysis. Food Chem 158:245–254
Eckert KA, Kunkel TA (1991) DNA polymerase fidelity and the polymerase chain reaction.
Genome Res 1:17–24
Elnifro EM, Ashshi AM, Cooper RJ, Klapper PE (2000) Multiplex PCR: optimization and
application in diagnostic virology. Clin Microbiol Rev 13:559–570
Elsalam KAA (2003) Bioinformatic tools and guideline for PCR primer design. Afr J Biotechnol 2:
91–95
Gaudet M, Fara A-G, Beritognolo I, Sabatti M (2009) Allele-specific PCR in SNP genotyping. In:
Komar AA (ed) Single nucleotide polymorphisms: methods and protocols. Humana Press,
Totowa, pp 415–424
Green MR, Sambrook J (2019) Polymerase chain reaction. Cold Spring Harb Protoc 2019:436–456
226 P. Sharma et al.

Joshi M, Deshpande JD (2010) Polymerase chain reaction: methods, principles. Int J Biomed Res 5:
81–97
Korbie DJ, Mattick JS (2008) Touchdown PCR for increased specificity and sensitivity in PCR
amplification. Nat Protoc 3:1452–1456
Koressaar T, Remm M (2007) Enhancements and modifications of primer design program Primer3.
Bioinformatics 23:1289–1291
Kubista M, Andrade JM, Bengtsson M, Forootan A, Jonák J, Lind K et al (2006) The real-time
polymerase chain reaction. Mol Asp Med 27:95–125
Kuypers J, Jerome KR (2017) Applications of digital PCR for clinical microbiology. J Clin
Microbiol 55:1621–1628
Nimbkar PH, D. Bhatt V. (2022) A review on touch DNA collection, extraction, amplification,
analysis and determination of phenotype. Forensic Sci Int 336:111352
Nybo K (2013) Primer design. Biotechniques 54:249–250
Rahman MT, Uddin MS, Sultana R, Moue A, Setu M (2013) Polymerase chain reaction (PCR): a
short review. Anwer Khan Mod Med Coll J 4:30–36
Roux KH (2009) Optimization and troubleshooting in PCR. Cold Spring Harb Protoc 4:66
DNA Electrophoresis
17
Aditi Mishra, Pratiksha H. Nimbkar, and Tanya Chauhan

Abstract

Electrophoretic techniques have come a long way since their discovery and show
continuous potential for advancement. The basic principle of the technique is the
separation of either DNA, RNA, or proteins based upon their charge and size.
Concerning DNA electrophoresis, numerous techniques are currently available
for one to choose from based on the size and type of the DNA sample to be
separated. Today’s techniques not only offer separation, but also aid in identifi-
cation of the DNA sequences, thereby reducing the time required for analysis.
Due to electrophoresis being a very versatile technique, it has applications not
only in the field of research, but also in various allied fields such as clinical
studies, biological, pathological and toxicological laboratories, genotoxicity stud-
ies, food safety surveillance, ecological studies, phylogenetic studies, infection
control and outbreak investigations as well as forensic investigations to name a
few. Conscious and continuous efforts are being put in improving the existing
methods by reducing the time required for analysis, making them compact for
field work and creating more economical and eco-friendly protocols that can
create a sustainable future with minimal waste of the reagents.

A. Mishra (✉)
Kristu Jayanti College, Bangalore, India
P. H. Nimbkar
School of Applied Sciences and Technology, Gujarat Technological University, Ahmedabad,
Gujarat, India
T. Chauhan
Department of Forensic Science, National Forensic Science University Delhi Campus (LNJN
NICFS), New Delhi, Delhi, India

# The Author(s), under exclusive license to Springer Nature Singapore Pte 227
Ltd. 2024
A. Puri et al. (eds.), Fundamentals of Forensic Biology,
https://doi.org/10.1007/978-981-99-3161-3_17
228 A. Mishra et al.

Keywords

DNA electrophoresis · Separation · Application · Identification

17.1 Definition of Terms

Deoxyribonucleic The genetic material present inside a cell

acid (DNA)
Buffer An aqueous solution that either contains a weak acid or a conjugate base
or vice-versa that resists a slight change in pH upon addition of a strong
acid or a strong base
Bioanalytes A biological sample under analysis
Magnetophoresis A process combining magnetism and electrophoresis
Transillumination Process of illuminating light through a sample

17.2 Principle

Ferdinand in 1807 was the first to notice that clay particles dispersed in the water
remained in a steady state and exhibited no movement. However, upon application
of an electric field across the water sample, peculiar movement of clay particles is
observed. When the phenomenon was studied, it was understood that the movement
was due to the presence of minute charges on the surface of the clay particles. When
subjected to an external electric field, the clay particles travelled in the direction
opposite to the charge they carried. This observation prompted the development of
the modern-day electrophoretic methods. Electrophoresis can be defined as the
movement of charged particles to the opposite side of their respective charges
when placed in an electric field. The evolution of electrophoresis is a fascinating
story. After the observations of Ferdinand, for almost a century, there was very little
development in the area. During the 1900s, Tiselius, published his doctoral thesis
titled, “The moving-boundary method of studying the electrophoresis of proteins”.
For his contributions, he was awarded a Nobel Prize in Chemistry in 1948. Tiselius
Apparatus Vesterberg (1989) for performing electrophoresis developed around the
1930s and was reinvented around the 1960s to form U-shaped tubes with minimized
internal diameter wherein the separation could take place in liquid form. Cellulose
acetate gel in electrophoresis was first proposed by Joachin Kohn. Cellulose acetate
gels have remained consistently in use since their discovery and are a routine
practice for clinical tests such as the determination of sickle cell anaemia (Serjeant
et al., 1974). Smithies’ innovative experiments inspired by the use of starch gels as a
separation medium in electrophoresis. The use of gels provided greater resolution
and hence was worked upon for further advancements. In addition to the use of
starch, many compounds were tested for their properties of gelling and separation.
Acrylamide gels were the first to be developed in 1959 by Orstein, Raymond and
17 DNA Electrophoresis 229

Winstraub with their counterpart, the Polyacrylamide gels by Orstein and Davis and
Raymond and Winstraub, presently being utilised for protein separation. Svensson in
1961 developed the isoelectric focusing apparatus through the use of a pH gradient.
His principles are applied even in today’s 2-D Electrophoresis protocols where the
proteins are first separated using 1-D Electrophoresis based on their charge and then
via 2-D electrophoresis based on size. The addition of sodium dodecyl sulphate
(SDS) by Weber and Osborn to the polyacrylamide gel electrophoresis was made in
1969. The use of two different polyacrylamide gels as a modification to the existing
protocols was proposed by Laemmli. Disc electrophoresis, developed by Davis and
Orstein in 1964, used discontinuous buffers of different compositions for protein
resolution using PAG. Along with acrylamide and polyacrylamide gels, agar and
agarose were experimented with to evaluate their potential as gelling media. Both
agar and agarose are provided with larger porosity as compared to the acrylamide
and polyacrylamide gels. However, as compared to agar, agarose provided more
stable conditions for DNA separation. The first recorded use of agarose as a support
medium for electrophoresis is around 1950s. This method with time has evolved to
accommodate the various needs concerning DNA separation and detection. This
book chapter strives to provide a comprehensive summary of the different electro-
phoretic methods that have developed with their applicability and feasibility.
The applicability of electrophoresis concerning DNA has primarily been to
separate and visualise DNA fragments. The protocol has been modified in numerous
ways to suit specific needs. Use of DNA electrophoresis in purification, analysis of
PCR products, characterisation of enzymes involved in DNA reaction, studying
DNA replication intermediates, monitoring genotoxicity, apoptosis, and regenera-
tion of cells, determination of sequencing products, and analysis of cellular bio-
chemical reactions has made the technique a quotidian practice. The basic principle
for any DNA electrophoresis protocol is the separation of the different DNA
fragments based upon the electric field applied and their rate of migration within a
specific matrix. DNA—a negatively charged moiety, when placed in an electric field
tends to travel from the anode towards the cathode. When we discuss the kinetics
within the gel matrix, it is observed that the separation is not only based upon the
size, but is also affected by the gel viscosity (resistance), pH of the buffer, tempera-
ture of the system, run time, the orientation of the DNA, and the sample volume.

17.3 DNA Separation Methods and Instrumentation

DNA separation involves the extraction of the DNA from the nuclear membrane into
the eluant. The presence of the DNA needs to be confirmed and this is where the
electrophoretic techniques come into play. Based on the type of the DNA sample, the
length of the DNA strands, and the accuracy requirements, there are a plethora of
techniques available for selection with the most basic and economical one being the
Agarose Gel Electrophoresis. Along with AGE, its modifications (Pulse Field Gel
Electrophoresis, Comet Assay, etc.,) Heintz and Gong (2019) and other electropho-
retic techniques such as Capillary Electrophoresis, Microfluidic Chip
230 A. Mishra et al.

Electrophoresis, to name a few, are available for selection. The various techniques
along with their instrumentation are mentioned in brief as follows:

17.3.1 Agarose Gel Electrophoresis (AGE)

Customarily, the agarose gel electrophoresis (AGE) protocol is a routine in

laboratories for DNA fragment detection. The AGE setup includes a buffer tank,
gel casting tray, well comb, an electric power supply, and electrodes. A basic AGE
protocol adopted worldwide comprises an agarose solution of the desired concentra-
tion (usually 0.8–1.2%) prepared by mixing agarose powder in a buffer and the
mixture is heated using a microwave oven for 1–1.5 min in bursts of 30 s. Next, the
solution is allowed to cool down before the addition of a visualisation dye. Once the
dye is added, the gel is poured into a casting tray and allowed to solidify. On partial
solidification, the well comb is inserted which is responsible for the formation of
sample loading wells and is removed just prior to sample loading. The cast gel is then
removed from the casting tray and placed onto the platform of the buffer tank
containing the running buffer to the marked level. A note of caution, while adding
the buffer into the tank one should be precautious of not spilling the buffer on the
electrodes and to completely immerse the gel within the buffer. This setup is also
known as a submarine electrophoresis setup. The previously extracted DNA sample
is mixed with a tracking dye and loaded into the wells of the gel. The setup is then
supplied with 90 V and allowed to run for 30 min till the tracking dye reaches half of
the gel length. The electric supply is then cut off and the gel is removed from the
buffer tank and placed in the gel documentation system (Fig. 17.1).
Different laboratories around the world have their own standardised protocols for
performing AGE. Once a gel is cast, it can be used numerous times until all the wells
present in the gel have been utilised. When the number of DNA samples is less than
the number of wells in the gel, the gel can be stored and reused. Herein, the question
as to the changes within the gel structure arises when stored for a longer time period.
To understand the occurrence of any structural changes within the gel, a study using
Nuclear Magnetic Resonance (NMR) as a non-invasive technique was conducted by
Descallar and Matsukawa (2020). The results of the study found a linear relationship
between the gel storage time period and the tightening of the mesh structure within
the gel. The tightening structure forms close aggregates which tend to get more
closely bound with time. This altering gel structure has the potential to affect the
electrophoretic mobility of the DNA sample under analysis. Reuse of gels is one of
the ways by which laboratories try to create more environmentally safe protocols for
conducting experiments. Another environmentally friendly working laboratory pro-
tocol for reusing gels has been devised by which the used agarose gels can be reused
without causing discrepancies in the results. A freeze and thaw method devised
Sasagawa (2018) to reduce the harmful effects of using EtBr on the environment
involves freezing of utilised gels in a paper or plastic container and freezing it
overnight at -20 °C. The next day, the gel is thawed and throughout the thawing
process, the container with the gel is kept inverted to separate the water content and
17 DNA Electrophoresis 231

b
Agarose Gel

Agarose gel at the start of the run Sample well

Tank with buffer

Power supply

Agarose gel at the end of the run

Fig. 17.1 Diagrammatic representation of AGE setup. (a) Agarose gel with sample wells and
loaded with the sample plus dye; (b) submarine electrophoresis setup wherein the gel is completely
immersed in the tank buffer and voltage is applied; (c) The run of the sample can be tracked by
visualising the run of the dye

buffer. First the Buffer along with the dye is eluted. This concentrate can then be
discarded through proper channels. The gel once frozen changes its physical struc-
ture from gel-like to flake-like resulting in the formation of agar flakes. These flakes
can be diluted again by adding 100 mL of water and freezing the gel overnight. The
same steps can be repeated a total of 5 times till the gel becomes completely devoid
of the nucleic acid and dyes. The flakes then retrieved need to be evaluated for the
concentration of agar present within them. Based on the concentration of agar, these
flakes can be diluted using a buffer of necessary volume and then heated to get an
agarose solution of the desired concentration. The regular protocol of electrophoresis
can be performed hereafter with the newly prepared processed gels.

17.3.2 Pulse Field Gel Electrophoresis (PFGE)

AGE can efficiently determine DNA fragments up to a length of 50 kb. For

visualisation of DNA fragments larger than 50 kb and up to 10 Mb, the pulse field
gel electrophoresis (PFGE) protocol was developed in 1984. Based on the size of
DNA fragments, PFGE can be efficiently used to differentiate between bacterial
genomes. Considered to be a gold standard in bacterial DNA typing, the technique is
used to separate large DNA fragments using low agarose concentration. The method
can be practiced for food safety surveillance, vector insertion, phylogenetic studies,
infection control, and outbreak investigations (Lopez-Canova et al. 2019).
232 A. Mishra et al.

Out of the different variations of PFGE available, namely, Rotating Gel Electro-
phoresis (RGE), Transverse Alternating Field Electrophoresis (TAFE), Field Inver-
sion Gel Electrophoresis (FIGE), and Contoured clamped Homogeneous Electric
Field (CHEF) gel electrophoresis, CHEF is the most widely used method. RGE
utilises one of the two alternating electric supplies at a time. PFGE by Rotating Gel
Electrophoresis (RGE) is capable of distinguishing between apoptotic Double-
Stranded DNA breaks (DSBs) and DNA damage-induced DSBs. The applicability
is appreciated in the fields of toxicology, biology, oncology, immunology, and
environmental science wherein the determination of cause is necessary. In TAFE,
the alternating electric field is applied transversely to the electrophoresis tank. The
angles in the application of the electric field are 115° at the top and 165° at the
bottom of the tank. This results in the fine separation of the DNA bands in the second
two thirds of the gel and the formation of DNA blurs in the last one third of the gel.
In FIGE, the electric field is applied at 180° and the electric charges are altered by
inversing the polarity of the applied system. The two methods result in the separation
of the DNA bands, but the necessary resolution is not attained. The limitations of the
above-mentioned variations are overcome by using CHEF wherein the angle
between the alternating electric fields is 120°, which provides a good resolution of
the DNA bands. The run time for PFGE is high, wherein a CHEF setup can require
14–16 h of run time for effective separation and visualisation of the DNA strands. To
reduce the run time and obtain fragmentation of desired resolution as the large-scale
instruments, miniature versions of the PGFE are designed. The miniature versions of
PFGE available include TAFE and CHEF PFGE. The instrumentation of the variants
remains the same and is just scaled down to accommodate the specifications in
smaller dimensions. The most widely and routinely used PFGE variant in the
miniature and regular scale is the CHEF gel electrophoresis.
The workflow of the regular PFGE consists of sample cells embedded in agarose
solution which are solidified into small gel blocks. These gel blocks are termed
plugs. The cells are then subjected to lysis and the DNA extracted from these cells is
present within the plugs. Furthermore, the DNA is treated with restriction enzymes
to create DNA fragments. The plugs are loaded into the wells of the agarose gel cast
for performing AGE. A pulsating charge is applied at a 120° angle between the two
charge points to the gel in the PFGE setup. The pulsating charge causes the DNA
fragments to travel in a zig-zag travel pattern of the DNA within the gel as opposed
to the linear pattern resulting in an increased retention time of the fragments in the
gel. Hitherto, the retention time of DNA fragments is directly proportional to their
separation within the matrix. Hence, the results obtained are more precise and
possess greater resolution. The results of AGE and PFGE are visualised using a
gel documentation system (Figs. 17.2 and 17.3).

17.3.3 Supramolecular Gel Electrophoresis (SUGE)

The limitation associated with AGE and PFGE is that both methods use agarose as a
medium of gelling and hence are capable of separating DNA fragments. To
17 DNA Electrophoresis 233

Plug Plug Plug

Fragmented DNA strands

DNA
sample

Lysis
buffer Restriction
enzymes

a b c

Fig. 17.2 Process of PFGE sample preparation in electrophoresis plug. (a) The electrophoresis
plug; (b) DNA extraction by addition of lysis buffer and treatment of extracted DNA by using
restriction enzymes; (c) DNA fragments within the electrophoresis plug to be loaded into the
PFGE gel

overcome this limitation, a novel alternative to the use of PFGE is devised Yamanaka
(2018), i.e. the use of supramolecular gels for performing electrophoresis. Supramo-
lecular gels can be defined as compounds that form highly flexible non-covalent
bonds between them, thus behaving like a gel (Chivers & Smith, 2019). There are
various compounds used as supramolecular gels. One of them being is composed of
C3-symmetric tris-urea, TGS solution having 25 mM Tris, 195 mM glycine, and
3.5 mM SDS (Fig. 17.4).

17.3.4 Comet Assay (CA) or Single Cell Gel Electrophoresis (SCGE)

Analogous to AGE, comet assay or single cell gel electrophoresis (SCGE) resembles
the size of the DNA fragments that it can analyse. Employed in ecological
biomonitoring and genotoxicity testing, they can determine the presence of dena-
tured DNA and can monitor the effects of genotoxicity within a single cell. DSBs
and SSBs can be studied along with cell apoptosis and regeneration. In case of
DSBs, visualisation of the damaged DNA is feasible in neutral conditions, whereas
for the investigation of SSBs within the DNA, alkaline conditions are necessary for
performing SCGE.
234 A. Mishra et al.

1 2

Zig-zag travel patten of the DNA in case of

PFGE setup

1
2

Fig. 17.3 Movement of DNA sample (zig-zag pattern) within the PFGE setup (on application of
pulsating charges diagonally making a 120° angle (1 and 2 indicate the sets of pulsating electric
charge power supply))

A generalised comet assay protocol entails coating a glass slide with 0.5% w/v
low melting agarose gel. The sample of interest (10 μL) along with 0.5% w/v low
melting agarose gel (90 μL) is taken and placed onto the slide. Subsequently, the
slide is placed in a submarine electrophoresis apparatus and subjected to an alkali
electrophoresis buffer for 20 min before the application of the current. The step
ensures that any damaged DNA (DSBs or SSBs) present within the cell (if any) gets
unwound and can be visualised post the electric field application. The voltage of
0.7V/cm is applied for 20 min. The temperature requirement for the setup is <10 °C.
Upon electrophoresis, the slides are placed in a neutralisation buffer for 5 min,
dehydrated using 99.6% ethanol and allowed to air dry. Slides are stained using
highly diluted SYBR Gold dye and the results are viewed using an image analyser
system. Intact DNA with no breaks in between or the undamaged DNA is observed
as circular fluorescent spots. However, in the case of damaged DNA due to apoptosis
or necrosis leading to damage to the cell’s nuclear membrane, the damaged DNA of
lengths different from the intact DNA is present outside the nuclear membrane. This
damaged DNA flows through the gel matrix based on the varied fragment length
giving it a comet-like appearance with a bright fluorescent head and the lengths of
the fragments in decreasing order appearing as the comet tail. A cell undergone
complete apoptosis/necrosis is observed as a burst entity (Fig. 17.5).
17 DNA Electrophoresis 235

Fig. 17.4 Chemical structure of amphiphilic C3-symmetric

To study programmed cell death (DNA fractionation) and protein fractionation

simultaneously, a novel high-throughput mechanism termed Single-cell Electropho-
resis-Based Viability And Protein assay (SEVAP) can be utilised. Through the
assay, events with respect to the fractionation of the DNA during apoptosis can be
visualised along with the cleaved DNA-repair proteins in the same setup. Apoptosis
in mammalian cells resulting from the DNA-repair proteins occurring apoptotic
mechanisms are fragmented to lengths approximating 50 kbps. Polyacrylamide is
used as the gelling medium in the SEVAP assay as it allows only fragmented DNA
and proteins to travel within the matrix, keeping the intact DNA as a single entity.
The setup is an open microfluidic device on which the results are obtained in a
fashion similar to the ones observed in comet assay. In the case of intact DNA, there
is no fragmentation of the DNA or the repair proteins observed and only one spot
corresponding to the intact DNA observed is identified.

17.3.5 Capillary Electrophoresis (CE)

Developed in 1983, capillary electrophoresis is widely adopted for the separation of

DNA, RNA, and proteins. Capillary electrophoresis revolutionised the slab gel
236 A. Mishra et al.

Fig. 17.5 Results observed for Comet assay. (a) In case of Intact DNA; (b) In case of damaged
DNA; (c) In case of cell undergone apoptosis or necrosis

electrophoresis technique by bringing automation to the process and providing

higher resolution. It is capable of producing high-quality resolution from minute
sample quantities. It also provides a more detailed analysis of the sample with
applications in various industries such as biopharmaceuticals, clinical analysis,
genetic mapping, and forensic analysis. Apart from nuclear DNA, CE can also be
utilised effectively for mtDNA analysis in disaster victim identification, maternity
testing, and historical reconstruction. The methods of CE used for DNA analysis are
either free-zone or gel-facilitated sieving. Free-zone CE has limitations as it can
separate DNA-based only on charge and not size. This limitation is overcome
through the development of gel-facilitated sieving wherein the pore size of the gel
incorporated within the capillaries aids in separating the DNA based on size. For
effective separation of the DNA fragments and opposed to agarose or polyacryl-
amide gels as in traditional electrophoresis, CE utilises soluble polymers. Three
mechanisms for DNA separation are observed in CE: free-solution, Ogston sieving,
and Reptation. The Ogston mechanism of DNA separation assumes DNA to behave
rigidly and the separation of DNA fragments is based on their mobility within the gel
as rigid blocks. However, the reptation mechanism assumes that the DNA fragments
are flexible and hence they travel through the gel matrix in a flowy manner.
17 DNA Electrophoresis 237

When discussed about the general idea of the instrumentation involved in CE, the
setup closely resembles the model of a Gas Chromatography instrument consisting
of six parts: the injector, the capillary, the voltage system, two buffer reservoirs, a
detector, and an output device (Oorschot and Ballantyne 2013).
The basic CE protocol involves DNA extraction followed by PCR and
pre-treatment of the DNA with barcodes and detectors that fluoresce when excited.
This pre-treated DNA sample is then loaded into the capillary via the injector. The
injector port allows the blend of samples to enter into the capillary tube which has a
diameter of less than 100 μm and a length of up to 80 cm. The injection port operates
through differences in charge upon applying an electric field when the injection is in
contact with the DNA sample. The PCR products inserted into the capillaries if not
purified before injecting have the possibility of containing unbound dNTPs and
chloride ions in the loading sample. These additions are negatively charged and
hence will be facilely transported through the injector into the capillary column. This
causes less volume of the required DNA sample to be loaded into the capillary
column, thereby interfering with the final results. Subsequently, the sample enters
the capillary tubes coated with soluble polymers such as polybrene, PolyE-323, etc.;
the sample volume injected in total affects the results in CE. Through a study
conducted by Nakazumi and Hara (2018), it was observed that, at the same of the
DNA concentration, for sample injection volumes of 10 μL and 20 μL, the sample
injection volume of 10 μL provided better results as compared to an injection volume
of 20 μL in terms of migration time of DNA and its size, motility, and size and
resolution length and size. The factors influencing separation in capillary columns
include voltage applied, run time, the buffer used, and the type of the capillary
column used.

17.3.6 Microfluidic Chip Electrophoresis (MCE)

The instrumental setup for CE used today has scaled down proportionately leading to
the development of Microfluidic Chip Electrophoresis (MCE). It is the miniature
version of the traditional CE and can be easily used by researchers as a portable
version performing the same tasks as that of CE at an accelerated rate. MCE provides
instantaneous results with exponentially low requirements of reagents. The applica-
bility of MCE for biomolecule analysis includes analysis of body fluids and other
bioanalytes. A typical MCE setup is ‘T’-shaped, composed of either silicon, glass, or
quartz. The latest single-use chips have shifted to using paper and toner for providing
users with more economic options. Within the chip, one end of the ‘T’ acts as a
sample loading zone, whereas the other end acts as a waste collection area. The stem
of the ‘T’ is where the separation of the sample takes place upon application of the
electric current. After separation, a detector is added at the end for converting the
data to a comprehensible format.
Continuous modification of the existing methods has driven the history of
electrophoresis. Despite that, the process of performing electrophoresis has paradox-
ically evolved and simultaneously retrogressed. Current separation methods involve
238 A. Mishra et al.

highly sophisticated instrumentation utilising minute reagent quantities. Yet, in the

case of the vehicle used for separation, the time has circled back to the use of paper.
The newer ways of electrophoresis embody fibre-based designs to offer features such
as portability and handy instrumentation.
The use of fibre-based microchip analytical devices is a branch explored wherein
the researchers have tested materials such as resin, wax, and paper as carrier vehicles
for DNA separation. A customised microfluidic fibre-based device for DNA separa-
tion (μPADs) caters to the research requirements. The setup embodies a wax paper
heat-fixed microchannel structure on paper. The ends of the setup are coated with
conductive ink to facilitate the flow of current within the system.
Lastly, the coated areas are supplied with voltage via alligator clamps. The paper
strips after the run can be eluted in a DNA elution buffer and can then be verified and
visualised using agarose gel electrophoresis and can be used for further amplification
(Heinsohn et al., 2022).

17.3.7 Magnetophoresis

A modification to the existing MCE suggested by Schneider et al. (2021)

incorporates the use of Solid Phase Reversible Immobilisation (SPRI) magnetic
beads to remove any impurities within the DNA samples. The modification signifi-
cantly reduces the number of pipetting steps required in the library preparation for
CE or MCE. The steps of DNA fragmentation, end repair, adenylation, and adapter
ligation in library preparation are automated via this process, reducing mechanical
errors and enabling the researchers to get more accurate results for analysis. The
procedure encompasses magnetic properties as well as electrophoresis and hence can
prove beneficial. The whole mechanism is incorporated within the microfluidic chip
setup wherein the SPRI beads along with the purified DNA travel in the direction of
the negative charge applied to the system and the unbound DNA is left on the
positive side of the applied electric field. The positive applied electric field is near the
sample loading well, ensuring that only the negatively charged DNA with the
magnetic beads travels to the other end of the setup. This process aids in DNA
purification as only the purified DNA bound to the magnetic beads is obtained when
the run is complete. The process mentioned has several potentials for incorporation
into DNA sequencing, nucleic acid sizing, and genotyping. Statistically, there is no
significant difference in the library preparation done by both methods, i.e. through
the use of microchip and manual off-chip method; there is no statistical difference
between the values obtained.
The demand for single-use DNA separation kits is growing as they offer faster
analysis, are more economic, provide greater convenience to use in the field, and
have a compact design with the microfluidic chip electrophoresis pioneering in
creating portable devices with low reagent requirements and high-throughput values
encouraging future ventures into the subject matter.
17 DNA Electrophoresis 239

17.3.8 Ideal Filter Capillary Electrophoresis (IFCE)

Ideal Filter Capillary Electrophoresis (IFCE) uses DNA aptamers for selective
binding and differentiating between binders and non-binders. The setup used is
that of CE with the difference between the binders and non-binders being that they
travel in opposite directions within the column, leading to efficient separation of the
two. Using the method, the separation efficiency of the protein-DNA complexes
from the unbound DNA in IFCE is greater than regular CE. The separation occurs
due to specific Electroosmotic Flow (EOF) of the running buffer within the capillary
tube by altering either the buffer’s pH orionic strength. The DNA bound with the
proteins has slower electrophoretic mobility as compared to unbound DNA and
hence will experience a greater drag force within the gel matrix. This principle acts
as a backbone for determining the range of EOF mobility range. For determining the
pH range and ionic strength, it has been shown to depict a linear relationship with
EOF when experimented with using Tris HCl as a running buffer. Hence, based on
the two statements, one can predict the necessary range of EOF required for the
separation of the protein-DNA complex and the unbound DNA using IFCE.

17.3.9 Denaturing Gradient Gel Electrophoresis (DGGE)

For analysis of PCR products containing DNA fragments of similar lengths, regular
methods of gel electrophoresis cannot efficiently result in DNA band separation and
the bands are often observed as an aggregate band representing all the amplified
reads. To overcome this limitation, Denaturing Gradient Gel Electrophoresis
(DGGE) can be utilised. The technique uses a gel of varying gradients causing a
variable porosity vertically throughout the gel. Two gels are prepared of different
densities (high denaturing and low denaturing) and are injected simultaneously in
between the glass plates. The setup of DGGE is vertical and requires pre-heating the
running buffer up to 55 °C before inserting the gel rack. As mentioned previously,
gels of two densities (or concentrations) are prepared and then loaded into two
separate syringes. Glass plates previously cleaned with detergent and wiped dry are
taken and attached tightly to the gel rack. The gel rack is then clamped to the stand
with a sponge bottom to hold it firmly in position while the gel is being poured into
the setup. The syringes are then attached to the wheel mechanism and the Y tubing is
attached with the two arms each attached to a syringe and the stem of the tube being
attached to a needle from which the gel is to be poured in between the plates. The
wheel is rotated causing the syringes to release the gel starting with the high-density
gel and then slowly fusing it with the low-density gel. Once the gel is poured in
between the plates, it is allowed to solidify for an hour and the well comb is inserted
within the gel to create wells. Upon solidification, the well comb is removed and the
gel rack is dismantled from the sponge bottom. It is then attached to the gel rack to be
inserted into the buffer tank. The gel rack is inserted into the buffer tank with the
high-density gradient gel at the bottom and the low-density gradient gel at the top.
240 A. Mishra et al.

DGGE Setup

Sample wells Sample wells

Power supply
Gradient gel

Fig. 17.6 DGGE setup

The tank is then completely filled with the buffer and the samples are loaded within
the wells (Fig. 17.6).

17.4 DNA Detection Methods

DNA detection methods provide visual confirmation of the presence of the DNA as
well as the presence of the separated DNA strands in case of determination of
different DNA fragment lengths using suitable techniques. The three main
techniques for DNA visualisation in post-electrophoresis are use of gel documenta-
tion system, fluorescence microscopy, and use of fluorescent detectors using CCD.
Specifically, selected dyes are added within the gel (visualisation dye) as well as
when the DNA samples are loaded (loading/tracking dyes). Examples of
visualisation dyes include Ethidium bromide (EtBr), SYBR Green I, and Thiazole
Orange (TO), (O’Neil et al. 2019) whereas bromophenol blue, Orange G, and xylene
cyanol FF are the widely used tracking dyes. Visualisation of the DNA bands
following electrophoresis is achieved using transilluminating agents such as UV
light/blue light. The documentation apparatus is a boxed structure fitted with a tray,
transilluminating light source, and camera for imaging. Within the documentation
system, options are available for the selection of the visualisation dyes, and once
selected, the transilluminator illuminates the gel with UV light and the image with
the DNA bands is recorded and can be visualised on the screen. A note of caution
while using the gel documentation system, it is crucial to close the gel
17 DNA Electrophoresis 241

documentation tray before the start of imaging as the UV light can cause serious
health hazards if exposed to it.
The mechanism of DNA band visualisation is via nucleic acid binding dye. The
binding of the dye is directly proportional to the amount of DNA present within the
extracted sample. The higher the DNA concentration, the greater is the dye binding
and the more prominent is its visualisation in the captured image. EtBr is the most
commonly used nucleic acid binding dye. The use of EtBr is preferred due to its ease
of availability and economic aspects. Nevertheless, it has a few hazardous effects on
human health as well as the environment. EtBr is a mutagen and has specific disposal
requirements. As a more environmentally friendly and less harmful alternative to
EtBr, thiazole orange (TO) can be used. It is less mutagenic than EtBr. Visualisation
of DNA bands in the case of TO is possible even in blue light which is advantageous
as it causes less damage to the DNA as compared to EtBr.
For visualisation of the DNA in Comet Assay, SYBR Green I dye is used, and
post-electrophoresis, the DNA is viewed at 10× using a fluorescent microscope.
However, in the case of apoptotic cells, there are several smear-like patterns
observed linearly corresponding to the DNA and protein fragments, respectively.
Specialised detectors are used in case of CE and MCE due to their complex
instrumentation as compared to the regular AGE setup. At the terminal end of the
capillary column, the detector (widely used—fluorescence detector) reads the bases
based on the colour of fluorescence emitted and records the data. The sample then
gets eluted into the output device. The recorded data are then converted to compre-
hensible format and further analysed for various purposes such as STR analysis,
SNP profiling, or genome sequencing. Detectors in CE and MCE primarily are
UV/Visible detectors or fluorescence detectors. The fluorescence detectors offer
more sensitivity. Laser-Induced Fluorescence (LIF) is employed in both CE and
MCE as it offers sensitivity to 10-10–10-12 M. LIF has other advantages such as MS
CE and MCE both offer parallel analysis of multiple samples and hence their usage
has become coherent in forensic analysis.

17.5 Conclusion

The evolution of any technique is a continuous process and can be witnessed with
the changing design and complexity. For electrophoresis, the design has come a long
way incorporating many variations throughout the way. The modern electrophoresis
setups still pay heed to the initial designs by incorporating its simplicity, but have
evolved in a manner to provide high-resolution results necessary to keep up with
current requirements. The DNA electrophoretic techniques used today not only
confirm the presence of the DNA, but also allow the researchers to determine its
size, sequence, and the nature of the separated DNA. These additions have made the
use of electrophoretic techniques a regular in many different analyses. Further
evolution of these techniques will primarily revolve around making the techniques
more economical, more compact, and never the least eco-friendly.
242 A. Mishra et al.

Multiple Choice Questions

1. The fragment size that can be analysed using PFGE is

(A) Between 50–70 Mb
(B) Between 50 kb to 10 Mb
(C) >50kb
(D) None of these
2. Results in Comet Assay for damaged DNA with DSBs/SSBs are observed as
(A) A comet-shaped appearance
(B) Burst entity
(C) A circular fluorescent spot
(D) All of the above
3. The instrumentation setup of Capillary electrophoresis resembles that of a
(A) HPTLC
(B) UV-Vis Spectrophotometer
(C) ICP-MS
(D) GC
4. Detectors in CE and MCE are usually
(A) Fluorescence and UV/Vis detectors
(B) Gel documentation system
(C) UV transilluminator
(D) Fluorescence microscope
5. A more environmentally friendly alternative to EtBr is
(A) SYBR green I
(B) Bromophenol blue
(C) Thiazole orange
(D) FastBlue B

Answers

1. (B)
2. (A)
3. (D)
4. (A)
5. (C)

References
Descallar FBA, Matsukawa S (2020) Change of network structure in agarose gels by aging during
storage studied by NMR and electrophoresis. Carbohydr Polym 245:116497. https://doi.org/10.
1016/j.carbpol.2020.116497
Heintz N, Gong S (2019) Examination of bacterial artificial chromosome (BAC) DNA quality and
quantity by pulsed-field gel electrophoresis. In: Cold spring harbor protocols. Cold Spring
Harbor Laboratory Press, New York, pp 746–747. https://doi.org/10.1101/pdb.prot098020
17 DNA Electrophoresis 243

Lopez-Canovas L, Martinez Benitez MB, Herrera Isidron JA, Flores Soto E (2019) Pulsed field gel
electrophoresis: past, present, and future. In: Analytical biochemistry, vol 573. Academic,
New York, pp 17–29. https://doi.org/10.1016/j.ab.2019.02.020
Nakazumi T, Hara Y (2018) Influence of the sample volume upon injection on capillary gel
electrophoresis for the separation of small DNA fragments. Int J Chem Eng Appl 9(1):16–19.
https://doi.org/10.18178/ijcea.2018.9.1.692
O’Neil CS, Beach JL, Gruber TD (2019) DNA electrophoresis using thiazole orange instead of
ethidium bromide or alternative dyes. JoVE 145:59341. https://doi.org/10.3791/59341
Ou X, Chen P, Huang X, Li S, Liu BF (2020) Microfluidic chip electrophoresis for biochemical
analysis. J Sep Sci 43(1):258–270. https://doi.org/10.1002/jssc.201900758
Sasagawa N (2018) A freeze-and-thaw method to reuse agarose gels for DNA electrophoresis.
Biosci Trends 12(6):627–629. https://doi.org/10.5582/bst.2018.01267
Schneider L, Fraser M, Tripathi A (2021) Integrated magneto-electrophoresis microfluidic chip
purification on library preparation device for preimplantation genetic testing for aneuploidy
detection. RSC Adv 11(24):14459–14474. https://doi.org/10.1039/d1ra01732b
van Oorschot RAH, Ballantyne KN (2013) Capillary electrophoresis in forensic biology. In:
Encyclopedia of forensic sciences, 2nd edn. Elsevier, Amsterdam, pp 560–566. https://doi.
org/10.1016/B978-0-12-382165-2.00242-7
Vesterberg O (1989) History of electrophoretic methods. J Chromatogr 480:3–19
Yamanaka M (2018) Supramolecular gel electrophoresis. Polym J 50(8):627–635. https://doi.org/
10.1038/s41428-018-0033-y
Short Tandem Repeats Profiling
18
Tanya Chauhan, Shreya Arora, Rutwik Shedge, and Astha

Abstract

DNA is the blueprint of life, found in almost every living organism, and working
as a set of instructions governing every aspect of the functioning and composition
of each individual. While most of the DNA shared by organisms of a species is
identical, certain locations of DNA exhibit variations in sequences. The analysis
of these locations or loci, with variations in DNA sequences, serves as the basic
principle behind individual identification through DNA profiling. One commonly
practiced method of individual identification using DNA profiling of mapping
variations in the length of repeated sequences is the Short Tandem Repeats
Profiling. Short Tandem Repeats (STR) have played a significant role in advanc-
ing the applications of DNA science in forensic individual identification. The
discovery of Short Tandem Repeat (STR) DNA and its application in forensic
science initiated the implementation of the DNA profiling process to create
databases of DNA at a national level (Gill et al., Forensic Sci Int Genet 18:
100–117, 2015).

T. Chauhan (✉)
Department of Forensic Science, National Forensic Science University Delhi Campus (LNJN
NICFS), New Delhi, Delhi, India
S. Arora
CTM IRTE, Faridabad, Haryana, India
R. Shedge
Department of Forensic Science, NFSU Tripura, Agartala, India
Astha
LNJN National Institute of Criminology and Forensic Science, Delhi, India

# The Author(s), under exclusive license to Springer Nature Singapore Pte 245
Ltd. 2024
A. Puri et al. (eds.), Fundamentals of Forensic Biology,
https://doi.org/10.1007/978-981-99-3161-3_18
246 T. Chauhan et al.

Keywords

DNA · STR · STR genotyping · PCR amplification · CODIS

18.1 Definitions

STR: Short Tandem Repeats (STR), also known as Simple Sequence Repeats (SSR),
are short-length sequences of DNA repeated multiple times within a genome.
STR genotyping: Process of identification of number of short tandem repeats
present at any particular locus in an individual’s DNA.
PCR: Polymerase chain reaction is a process of amplification of a specific DNA
sequence.
CODIS: Combined DNA Index System is a DNA database of the Federal Bureau
of Investigation (FBI) of the Government of the United States of America.

18.2 STR Markers

Short Tandem Repeats, commonly called STR or microsatellites, are short-length

sequences of DNA repeated multiple times within a genome. These variations are
found at different locations within the non-coding region of the genome and
constitute approximately 3% of the whole human genome. The short tandem repeats
are one of the most polymorphic loci in the human genome (Willems et al. 2014)
with the number of repeats varying in each individual. Short tandem repeats (STRs)
are sequences of DNA where two to seven nucleotides long core repeat units are
tandemly repeated about a half dozen to several dozen times (Butler 2005). The most
commonly used STR loci in forensic science are 100–500 base pairs in length. The
repeats are present between flanking regions, a sequence of DNA that is non-variable
or constant. These constant regions play an important role in the identification of
these sequences by primers used in PCR amplification during STR profiling.
There are various advantages of using STR loci as compared to VNTR loci which
include better amplification of loci and even reduction of preferential amplification.
Also, the profiling of mixed samples and degraded DNA samples will be carried out
with improved profiles. The resolution of electrophoretic separation, as well as result
analysis, is much better in STR.
The number of nucleotides in a single repeat unit is called the repeat unit length.
STR nucleotides can range from being two to six in number (Fig. 18.1). In dinucle-
otide repeats, only two nucleotides repeat over and over again. Trinucleotides have
three nucleotides, while tetranucleotides have four and so on in the core repeat unit
length. The tetrameric repeats constitute approximately 9% of the total STRs in the
human genome. Though the pentameric and hexameric repeats are highly polymor-
phic, they are utilized in forensic applications in less number as they are less
abundant in the human genome as compared with the other set of repeats.
18 Short Tandem Repeats Profiling 247

Fig. 18.1 Types of repeat

unit length in the human
genome

Flanking region TCAT Flanking region

6 TCAT repeats

Flanking region Flanking region

7 TCAT repeats

Fig. 18.2 Short Tandem Repeats (STRs)

The STR has multiple variants or alleles, represented by the number of repeats of
the DNA sequence present. Individuals get a set of chromosomes from each of their
parents, and depending on the sequence they inherit, an individual can be homozy-
gous or heterozygous for an STR allele. Homozygous have a set of alleles of equal
lengths for loci, while the length differs in heterozygous conditions. STR profiling
techniques use specific markers to aid in individual identification through a Poly-
merase Chain Reaction- (PCR) based DNA profiling method (Fig. 18.2). The STR
profiling system analyses multiple loci to provide a high power of discrimination to
the result. A commonly used STR system is the 13 tetrameric short tandem repeat
(STR) loci system used by CODIS or the Combined DNA Index System database.
The FBI selected this set of markers in November 1997 (Butler 2005). It has been
used for determining parentage, forensic identification, and for medical diagnostics.
248 T. Chauhan et al.

18.3 STR Genotyping

STR analysis involves DNA extraction from evidence, quantitation of DNA,

subjecting extracted DNA samples to a multiplex polymerase chain reaction
(PCR), separation of alleles and sizing, typing of STR loci, and interpretation on
profile interpretation (Fig. 18.3). In some cases, the statistical significance of the
match is also reported (Evett et al. 1996).
The genotyping process begins with subjecting the DNA extracted from evidence
to a sequence of methods to measure the allele repeats at specific STR loci. It
involves multiplex PCR amplification, capillary electrophoresis, and genotyping.
Polymerase chain reaction yields products from a minimum quantity of biological
evidence in form of different nucleotide lengths based on the number of short tandem
repeats. STR profiling uses Multiplex PCR where multiple STR loci are amplified
simultaneously using different coloured dyes and different length DNA sequences.
This method allows for performance analysis with a small account of DNA
material; 1 ng or less (Butler 2005).

18.3.1 Sex Identification

The ability to identify whether a sample is obtained from a male or female source is
very useful as well as important especially in case of sexual assault cases, where it is
very important to distinguish between the accused and the victim. Similarly, sex
identification is beneficial in cases of mass disaster as well as missing person
investigations. There are various markers now to distinguish between a male and
female sample, but the most commonly used marker is Amelogenin.
Amelogenin is a gene that codes for the proteins that are present in tooth enamel.
Forensic laboratories have a set of primers to detect this locus in any biological
sample collected. The PCR amplification of this generally results in 106 bp and
112 bp DNA lengths from the X and Y chromosomes, respectively. Hence, in the
case of female, one peak of 112 bp marker is observed, while in the case of male two
peaks of 106 and 112 bp are observed in an electropherogram due to their homozy-
gous and heterozygous condition, respectively.

Sample from DNA DNA DNA Typing of

sceme of crime Extraction Quantification Amplification allele

Fig. 18.3 Schematic representation explaining the stages of DNA genotyping

18 Short Tandem Repeats Profiling 249

18.4 STR Kits

The pieces of evidence encountered at the scene of a crime are commonly degraded
due to environmental exposure and decay. STR analysis works with short-sized base
pair DNA sequences, which favours the possibility of getting information from
degraded DNA obtained from such evidentiary material. STR genotyping is also
performed using commercially available kits with a standardized mix of components
such as primers, DNA polymerase, enzyme buffers, and Deoxynucleoside triphos-
phate (dNTP) for uniform and accurate results along with allelic ladders for
genotyping. There are a number of kits available commercially for single or multi-
plex PCR amplification of STR markers for DNA fingerprinting. Commercial kits
also help standardize the procedures for performing analysis. For example, in a
13 loci STR system, the likelihood that any two individuals, except identical twins,
have the same DNA profile can be as high as 1 in 1 billion or greater. The adoption of
13 STR markers started in the USA which eventually led to the development of STR
markers multiplexes. This technology evolved in the late 1990s for being more
sensitive and rapid extents of STR alleles. Also, STR markers can be amplified
simultaneously which makes it more favourable than other techniques.

18.4.1 CODIS

One of the most prominent application of STR typing for forensic purposes is
CODIS. CODIS or the Combined DNA Index System by the FBI (Federal Bureau
of Investigation) was developed with the aim to provide assistance to law enforce-
ment agencies in the investigation of cases where DNA evidence can provide
potential information to identify those involved in the crime. The program uses
STR-based loci for identification and the criminal justice DNA databases. The
program comprises DNA profiles of the alleles at one or two of the 20 CODIS
Core Loci, collected from the participating forensic laboratories across the states.
The 20 CODIS loci used are CSF1PO, FGA, THO1, TPOX, VWA, D3S1358,
D5S818, D7S820, D8S1179, D13S317, D16S539, D18S51, D21S11, D1S1656,
D2S441, D2S1338, D10S1248, D12S391, D19S433, and D22S1045 (Budowle
et al. 1999). The chromosomal location and repeat motifs of each of the aforemen-
tioned markers are shown in Table 18.1.
The use of CODIS for investigation begins with the collection of DNA samples
from the scene, suspect, or victim of a crime. The DNA extracted from such a sample
is treated as an unknown profile that is then searched against the DNA database. Any
match is confirmed by the laboratory, and based on the result, further investigation is
carried out.
250 T. Chauhan et al.

Table 18.1 The 13 STR STR loci Chromosomal Location Repeat Motif
loci involved in STR
CSF1PO 5q33.1 AGAT
profiling
FGA 4q31.3 CTTT/TTCC
THO1 11p15.5 TCAT
TPOX 2p25.3 AATG
VWA 12p13.31 TCTA/TCTG
D3S1358 3p21.31 TCTA/TCTG
D5S818 5q23.2 AGAT
D7S820 7q21.11 GATA
D8S1179 8q24.13 TCTA/TCTG
D13S317 13q31.1 TATC
D16S539 16q24.1 GATA
D18S51 18q21.33 AGAA
D21S11 21q21.1 TCTA, TCTG
D1S1656 1q42 TAGA
D2S441 2p14 TCTA/TCAA
D2S1338 2q35 TGCC/TTCC
D10S1248 10q26.3 GGAA
D12S391 12p13.2 AGAT/AGAC
D19S433 19q12 AAGG/TAGG
D22S1045 22q12.3 ATT

18.5 Challenges of Genotyping for Forensic Samples

STR genotyping involves subjecting extracted DNA samples to a polymerase chain

reaction (PCR) and automated sequencers. The genotyping process begins with
subjecting the DNA extracted from evidence to a sequence of methods to identify
the allele repeats at specific STR loci. It involves multiplex PCR amplification,
capillary electrophoresis, and genotyping. Polymerase chain reaction yields products
in the form of different nucleotide lengths based on the number of short tandem
repeats.
In forensic science, the samples found at the scene of a crime can be highly
variable according to the environment and the method of collection and preservation
adopted. Hence, the end of highly sensitive and reproducible techniques arises. The
following are the challenges faced by the experts in terms of samples.

18.5.1 Degraded Samples

The biological evidence with high environmental exposure including high humidity
and temperature can lead to DNA degradation and eventually lead to DNA fragmen-
tation. The more the degradation, the more the fragmentation. This is one of the
major reasons that in forensic science a shift was observed from VNTRs to STRs.
18 Short Tandem Repeats Profiling 251

Since after fragmentation the larger alleles tend to break into smaller strands, the
chances of STRs amplicons which is 100–500 bp in length remain safe. This also
leads to incomplete or failure in the generation of genetic profiles. To overcome this,
issue amplification was introduced after extraction so that the alleles can be
multiplied multiple folds for better detection.
Wiegand and Kleiber (2001) demonstrated that when the DNA is highly
degraded, it indicates a very less amount of DNA present. Here, the primers can
be redesigned to a closer region of STR core repeat as compared to the other longer
amplicons. They are known as mini-STRs. The major disadvantage of this mini-STR
is that very few loci can be simultaneously amplified as the size aspect is considered.
The chances of having an allele dropout also increase.

18.5.2 PCR Inhibition

The other challenge in profiling an individual from the sample collected at a crime
scene is that PCR amplification process is affected by the inhibitors present either
inside the sample or collected while collecting the sample. In outdoor cases, body
fluids are present on soil, sand, or even dyed cloth pieces. These inhibitors hinder the
activity of cell lysis in the initial steps of DNA extraction, can also capture and
degrade the nucleic acid extracted, and even inhibit the DNA polymerase enzyme
during PCR (Rådström et al. 2008). These inhibitors result in partial profiling in
most cases as they fail to amplify the large STR loci.
There are various strategies proposed to overcome these inhibitions which
include dilution of the sample extracted which eventually dilutes the inhibitors
also (Rådström et al. 2008), and the addition of bovine serum albumin (BSA) or
betaine. Also, the use of sodium hydroxide treatment has neutralized the inhibitors
on various occasions including the use of filters specifically made for this only
(Moreira 1998).

18.5.3 Low Copy Number DNA Testing

DNA analysis in forensic science requires the testing of very fewer amounts of DNA
in a sample collected which could be as less as 100 pg. This type of DNA is collected
from fingerprints and specifically touch DNA. But these low levels of DNA
extracted are further amplified using a PCR machine to increase the number as
well as the sensitivity of the analysis.

18.5.4 Mixed DNA Profiles

In forensic science, we encounter various types of cases including sexual assault

cases in which the evidence recovered from the victim contains a mixed sample of
both accused and the victim. Here the profile generated is of both the contributors.
252 T. Chauhan et al.

Compare
the profiles
Exclude
with the
profiles
Consider all reference
using Y-STR
Estimate combinations samples
specific
the relative of
Identify the marker(if
ratio of the genotype
number of applicable)
Designate individual possibility
the allele contributors
Identify as well as
peaks to the
the sample the marker
profile
containing
mixture

Fig. 18.4 Schematic steps for the interpretation of mixed genetic profiles (Clayton et al. 1998)

The steps involved in interpretation of mixed STR profiles are shown in Fig. 18.4.
The greater the number of contributors, more difficult the interpretation of STR
profiles become. One commonly encountered forensic case with this issue is a sexual
assault case (Laberke et al. 2012).

18.6 Factors Affecting Genotyping Results

There are a number of factors that may affect the accuracy of genotypic profiles.

18.6.1 Mutation and “Off-Ladder Allele”

The selection of STR loci in forensics is also based on the mutation rate of that
region. Hence, loci with low mutation rates are preferred especially for the identifi-
cation of individuals in mass disasters and paternity cases. Rare alleles are also
encountered in the human population which may differ from common or wild types.
However, in some cases mutation occurs, which eventually affects the profiling
results. And if due to the sequence variations observed there is a difference between
the consensus alleles already present as a reference, they can be referred to as ‘off-
ladder allele’ (Cupples et al. 2009).

18.6.1.1 Mutation at STR Core Repeat Regions

This mutation occurs in the core region of STR loci. Mutation can further occur in
two types of cells in the body. Germ cell mutation is where mutation occurs in the
germ line of the individual and will be inherited by the offspring. This type of
mutation helps in the characterization of loci in a population study. However,
somatic mutation means mutation occurs in the somatic cells of the individual and
will be inherited by the offspring of the individual.
Also, the sequence variation due to insertion, deletion, or substitution is com-
pared and is called ad microvariants.
18 Short Tandem Repeats Profiling 253

18.6.1.2 Gene and Chromosome Duplication

A duplication-bearing mutation within the STR loci core repeat region can affect the
number of tandem repeat units. In wild conditions, there are two alleles inherited
from each parent. But in special conditions either three alleles or three chromosomes
(trisomy) often affect the STR profile associated with the concerned locus or
chromosome, while the unaffected do not hinder in profiling (Moreira 1998).

18.6.1.3 Point Mutations

These types of mutations include a change of one single nucleotide due to deletion/
insertion or substitution. They can be a part of flanking region or the core repeat
region on STR loci. If the nucleotide mutation occurs in the flanking region, then the
primer binding region is affected which eventually causes non-specific binding of
primer that reduces the efficiency of binding and/or amplification will be failed. The
complete failure of the gene amplification is called a silent allele or null allele
(Clayton et al. 2004).

18.6.2 Amplification Artifacts

18.6.2.1 Stutter Products

In this, a minor allele peak is observed in an electropherogram which is known as a
stutter peak (Fig. 18.5). The repeat units are either shorter or longer than the parent
allele. They are typically less than 15% of the genuine allele peak height. This
phenomenon is observed infrequently in pentameric and hexameric repeat unit loci
as compared to the other types.
It is also believed that stuttering is observed due to the slippage of polymerase
occurring during amplification. The stutter peaks longer than the parent allele that

1100 1100

1000

750
RFU

500
Stutter Products

250
90 90

0
15 18
DNA size (bp)

Fig. 18.5 Schematic representation of electropherogram having stutter peaks

254 T. Chauhan et al.

are very rare. Also, stutter products have an impact on the electropherogram; if they
are almost of same size as an actual allele, then it becomes challenging to determine
whether a small peak is a real peak or a stutter product (Walsh et al. 1996).

18.6.2.2 Non-Template Adenylation

During amplification, sometimes DNA polymerase adds an extra nucleotide which is
usually adenosine to the 3′ end of the amplicon. This phenomenon is generally
known as non-template adenylation. However, the adenylation is dependent on the
sequence of the template strand. This results in the addition of an extra nucleotide
group (+A) which signifies the amplified product towards the electropherogram and
without the extra nucleotide (-A) which signifies the parent allele of the desired loci.
These peaks are observed generally in the mixture during partial non-template
addition. Also, sharper peaks increase the likelihood that the system’s genotyping
further calls for accuracy (Gomes et al. 2007).

18.6.2.3 Heterozygote Imbalance

It is when one of the alleles has a much greater peak area or amplitude than the other
allele in heterozygous conditions on the same locus (Fig. 18.6). It is said that this
type of condition is observed when the sample extracted contains unequal
proportions of DNA template at the heterozygous loci. This may be due to preferen-
tial amplification which eventually interferes with the interpretation of the samples
provided and results in heterozygous imbalance.

18.6.2.4 Allelic Dropout

Allelic dropout is the condition in which one of the alleles of a heterozygous
individual fails to get detected and leads to an assumption that the individual is

600

500

400
RFU

300

200

100

0
8 9.3
DNA size (bp)

Fig. 18.6 Schematic diagram of heterozygote imbalance. Here the intensity signal of one allele is
quite great than the other allele on the same locus
18 Short Tandem Repeats Profiling 255

homozygous for that particular locus. Though very limited causes of this condition
have been identified, one of them is an extreme situation of preferential amplification
which also leads to heterozygote imbalance. Mutations can cause allelic dropout
as well.

18.6.3 Electrophoretic Artifacts

18.6.3.1 Pull-Up Peaks

This occurs when a minor peak of an electropherogram in one colour is pulled up
from a major peak of an allele in another colour. The colours are of overlapping
spectra and can cause inaccuracy of the genetic profiling. This happens when a
sample is overloaded or the calibration is not done for the matrix file.

18.6.3.2 Spikes
They are sharp peaks with almost similar signal intensities present in all the colour
panels of an electropherogram. They are caused because of an air bubble or urea
crystals trapped in the electrophoretic platform of the electropherogram. These are
non-reproducible in nature and sometimes even the voltage spikes contribute to
it. The electrophoretic artifacts can be confirmed by repeating the process of
electrophoresis and the electropherogram can be analysed accordingly.

18.6.3.3 Contamination
Genetic profiling is one of the most sensitive techniques for individualization. The
laboratory-standardized protocols are followed so to increase the extraction and
quantification rate of DNA. But the problem appears when proper care regarding
amplification or detection is not done. Contamination can occur in any stage of
profiling, but the most likely result is exclusion or inconclusive result (Diegoli
2015).
To avoid the interpretation of contaminated results, the negative control samples
hold a lot of importance. The negative control basically involves the blank which
tests the tubes involved including the reagents used. There are various chances of
contamination starting from the scene of the crime from where the sample is being
collected to the final profiling step. Hence, in each step collection and testing of the
control sample are necessary (Tucker et al. 2012).

18.7 Data Interpretations

There are several guidelines for the interpretation of STR profiles which are pro-
posed by the Scientific Working Group on DNA Analysis Methods (SWGDAM)
and also other scientific bodies involved in deciphering the profiles. Generally, a
conclusion can be given as follows:

1. Inclusion (100% match).

256 T. Chauhan et al.

In this, the STR loci peaks are compared between the profiles generated that
match exactly. This infers that the sample collected from the crime scene or the
victim has the same origin as that of sample collected by the accused.
2. Inconclusive Result:
The data provided or deduced from the results obtained don’t support any
inclusion or exclusion. When the analyst cannot obtain any conclusion due to
insufficient information available.
3. Exclusion Result:
The genotypes of two or more samples in comparison are different. In other
words, they are from different origin as the markers between the samples do not
overlap.

18.8 Statistical Evaluation of DNA Typing Results

The allelic distribution in an individual follows the Mendel law of inheritance. The
gametes are formed during the process known as meiosis and the haploid set of
chromosomes is received from one parent and the next set is received from the other
parent. A diploid individual is composed of 22 pairs of chromosomes and 2 sex
chromosomes (XX in females and XY in males).
To calculate the proportion of alleles at a given locus, the Hardy-Weinberg
Principle can help in estimating the heterozygosity (Ladd et al. 2001).
Also, to determine whether the genotypes of a population obey the Hardy-
Weinberg principle, which is eventually used for database construction using the
chi-square formula (Gazi et al. 2010).

ðOi - Ei Þ2
χ2 =
Ei
Where: Oi = observed genotype frequency; Ei = expected genotype frequency;
n = total number of genotypes.
The allele frequency of one of the CODIS STR Loci is shown in Table 18.2.

18.8.1 Probability of Match

This is basically the discriminating power of the genetic locus that can be estimated
using population match probability (Pm). They define it as the possibility of
matching a genotype between any two randomly chosen individuals. The lower
the value of Pm, it is less likely to get a match between two randomly chosen
individuals.
18 Short Tandem Repeats Profiling 257

Table 18.2 The allelic Allele Allelic Frequency (%)

frequency of one of the
VWA African American Caucasian Hispanic
alleles of 13 CODIS
marker. (Source: (Budowle N = 180 N = 196 N = 203
et al. 1999)) 11 0.278 0.000 0.246
13 0.556 0.510 0.000
14 6.667 10.204 6.158
15 23.611 11.224 7.635
16 26.944 20.153 35.961
17 18.333 26.276 22.167
18 13.611 22.194 19.458
19 7.222 8.418 7.143
20 2.778 1.020 1.232
21 0.000 0.000 0.000

2
Pm = p2 þ ð2pqÞ2
i j

Where: P and q = the frequencies of two different alleles; Pm = can also be used to
compare the discriminating powers of different loci.
It is also stated to evaluate the strength of DNA profiling results and their
possibility of matching between the two random individual profiles. The chances
to have a matching profile from a suspect to the crime scene sample can be because
of the following reasons:

(a) The samples from both the crime scene and suspect belong to the same individ-
ual and have a common origin.
(b) The suspect happens to have the same genetic profile as that of the sample found
at the scene of the crime. The significance of the match can be calculated using
statistical calculations to determine how rare it is to have the same DNA profile
of 2 non-related samples.

This analysis is done by considering the alleles involved with the heterozygosity
and multiplying the heterozygosity of each allele to determine the interpretation
(Vanderheyden et al. 2007).

18.9 Preparation of Reports

After DNA extraction and profile generation, a report is prepared stating whether the
profiles between the samples collected from the accused match with the sample
collected from the crime scene or victim. In this, the STR loci using which were
selected to generate the profile are matched. The electropherogram generated should
overlap in both cases. Also, proper statistical analysis is involved and calculation is
258 T. Chauhan et al.

done to estimate the probability of a match in the respective case (Riccardi et al.
2009).

18.10 Other Usage of STR Typing

In this particular chapter, we have seen the use of STR typing in forensic science.
This particular area of study not only helps in forensic-related problems, but has a
wide area of research.

18.10.1 Cell Lines

Human cell lines are used for various research studies and their authentication is
equally important. When these cell lines are the major issue faced by the research
group in the cross-contamination of cell lines with other cell lines, STR typing
enables the discovery of such conditions as well as analysing any tri/tetra allelic traits
and patterns due to imbalance in the cell cultures (Lucy et al. 2007).

18.10.2 Observing Transplants

STR typing can help in generating the profile of the transplant recipient as well as the
donor to match the grafting profiles and diagnose the graft failure and/or relapse
probability. Generally, the transplants are bone marrow or blood stem cell
transplants where the rejection rate from the body is quite high.

18.10.3 Detection of Cancerous Tumours

The loss of heterozygosity (LOH) is also one of the methods to monitor the genetic
mutations including deletions which eventually causes tumours and many other
types of cancer. This causes severe imbalance at loci and can be amplified using
PCR. This also helps in the prior detection of individuals who are more prone to
cancer than other normal individuals in terms of genetic makeup. During this, using
a tissue sample nine STR loci are studied to check the severe imbalance in the peaks
of the designated markers.

18.10.4 Mapping of Genetic Diseases

The genetic scans comprising the disease genetic mapping are performed for around
400 STR markers covering the whole human genome at an approximate distance of
5–10 centimorgan (cM). The study of the allele frequency between a normal and
diseased population helps in the estimation and association of genetic diseases with
18 Short Tandem Repeats Profiling 259

the proposed markers. The markers are further correlated with the help of linkage
analysis. A set of 5 STR loci has already been identified for this type of study
(Willems et al. 2014).

Multiple Choice Questions

1. Which locus can be used for determining both male and female gender in DNA
fingerprinting?
(a) DYS 19
(b) DYS 393
(c) Amelogenin
(d) Y-plex ladder.
Answers: (c)
2. The genetic markers which are seen close together on the same chromosome
exhibit.
(a) Genetic linkage
(b) Homozygosity
(c) Genetic concordance
(d) Independent segregation.
Answers: (a)
3. What is the length of Amelogenin gene marker in X - Chromosome?
(a) 120 bp
(b) 112 bp
(c) 108 bp
(d) (D)106 bp.
Answers: (d)
4. D13S317 and TPOX are basically:
(a) STR markers.
(b) Regions of mt DNA.
(c) Types of viruses.
(d) Restriction enzymes.
Answers: (a)
5. A computerized database that allows to obtain the information related to an
individual’s DNA profile is:
(a) PCR.
(b) CODIS.
(c) AFIS.
(d) PDQ.
Answers: (b)
260 T. Chauhan et al.

References
Budowle B, Moretti TR, Baumstark AL, Defenbaugh DA, Keys KM (1999) Population data on the
thirteen CODIS core short tandem repeat loci in African Americans, US Caucasians, Hispanics,
Bahamians, Jamaicans, and Trinidadians. J Forensic Sci 44(6):1277–1286
Butler JM (2005) Forensic DNA typing: biology, technology, and genetics of STR markers.
Elsevier, Amsterdam
Clayton TM, Whitaker JP, Sparkes R, Gill P (1998) Analysis and interpretation of mixed forensic
stains using DNA STR profiling. Forensic Sci Int 91(1):55–70
Clayton TM, Hill SM, Denton LA, Watson SK, Urquhart AJ (2004) Primer binding site mutations
affecting the typing of STR loci contained within the AMPFlSTR SGM Plus kit. Forensic Sci Int
139(2–3):255–259
Cupples CM, Champagne JR, Lewis KE, Cruz TD (2009) STR profiles from DNA samples with
“undetected” or low Quantifiler™ results. J Forensic Sci 54(1):103–107
Diegoli TM (2015) Forensic typing of short tandem repeat markers on the X and Y chromosomes.
Forensic Sci Int Genet 18:140–151
Evett IW, Gill PD, Scrange JK, Weir BS (1996) Establishing the robustness of short-tandem-repeat
statistics for forensic applications. Am J Hum Genet 58(2):398
Gazi NN, Eaaswarkhanth M, Ferdous A, Qadri SS, Singh L, Thangaraj K (2010) Genetic
polymorphisms of 15 autosomal STR loci in three isolated tribal populations of Bangladesh.
Forensic Sci Int Genet 4(4):265–266
Gomes AV, Mauricio-da-Silva L, Raposo G, Vieira JRC, dos Santos Silva R (2007) 13 STR loci
frequencies in the population from Paraíba, Northeast Brazil. Forensic Sci Int 173(2–3):
231–234
Laberke PJ, Grossenbacher R, Hausmann R, Balitzki B (2012) Method to predict the chance of
developing a male profile out of mixtures of male and female DNA. Int J Legal Med 126(1):
157–160
Ladd C, Lee HC, Yang N, Bieber FR (2001) Interpretation of complex forensic DNA mixtures.
Croat Med J 42(3):244–246
Lucy D, Curran JM, Pirie AA, Gill P (2007) The probability of achieving full allelic representation
for LCN-STR profiling of haploid cells. Sci Justice 47(4):168–171
Moreira D (1998) Efficient removal of PCR inhibitors using agarose-embedded DNA preparations.
Nucleic Acids Res 26(13):3309–3310
Rådström P, Löfström C, Lövenklev M, Knutsson R, Wolffs P (2008) Strategies for overcoming
PCR inhibition. Cold Spring Harb Protoc 2008(3):pdb-top20
Riccardi LN, Melean G, Rada A, Tirado N, Genuardi M, Ricci U (2009) Genetic profiling of
Bolivian population using 15 STR markers of forensic importance. Legal Med 11(3):149–151
Tucker VC, Hopwood AJ, Sprecher CJ, McLaren RS, Rabbach DR, Ensenberger MG et al (2012)
Developmental validation of the PowerPlex® ESX 16 and PowerPlex® ESX 17 systems.
Forensic Sci Int Genet 6(1):124–131
Vanderheyden N, Mai A, Gilissen A, Cassiman JJ, Decorte R (2007) Identification and sequence
analysis of discordant phenotypes between AmpFlSTR SGM plus™ and PowerPlex® 16. Int J
Legal Med 121(4):297–301
Walsh PS, Fildes NJ, Reynolds R (1996) Sequence analysis and characterization of stutter products
at the tetranucleotide repeat locus vWA. Nucleic Acids Res 24(14):2807–2812
Wiegand P, Kleiber M (2001) Less is more – length reduction of STR amplicons using redesigned
primers. Int J Legal Med 114:285–287
Willems T, Gymrek M, Highnam G (2014) 1000 genomes project consortium Mittelman D., Erlich
Y. the landscape of human STR variation. Genome Res 24:1894–1904
Sex Chromosome Haplotyping
19
Monisha Samuel and Rutwik Shedge

Abstract

Chromosomes X and Y have been true homologues and have evolved differently
over the years. The Y chromosome has shrunk to about 60 Mb in size as a result
of deletions throughout time. Still there is a lot of sequence homology with the X
chromosome. The Y chromosome is made up primarily of heterochromatin and
has the fewest genes of any chromosome. When it comes to sexual development,
the genes on the Y chromosome are crucial (sex-determining region on the Y
gene, SRY, which only determines male sex) (Skaletsky et al. Nature 423:825–
837, 2003). Two pseudoautosomal areas on the Y chromosome can potentially
recombine with the X chromosome during spermatogenesis. These regions are
located at both ends of the chromosome. Ninety-five percent of the
Y-chromosome contains functional genes and transcription-inert heterochromatin
region which contributes to formation of the non-recombining area. This is only
found in males and is passed down intact from father to son and is abundant in
micro- and minisatellite DNA as well as polymorphic repetitive elements. The Y
chromosome’s non-recombining region contains short tandem repeat (STR) loci,
which are inherited as a block of linked haplotypes. The identification of
unknown people, the determination of a person’s paternity, the detection of the
male DNA profile in mixtures and azoospermic people, and the confirmation of
amelogenin-deficient males are all forensic applications that greatly benefit from
Y-STR haplotyping (Quintana-Murci and Fellous J Biomed Biotechnol 1:18,
2001). The use of X-chromosomal markers is also numerous in forensic contexts.
More than 30 STRs have been recognized as forensic markers. Joint typing of
STRs that are extremely closely connected produces stable haplotypes that can be

M. Samuel (✉) · R. Shedge

Department of Forensic Science, National Forensic Sciences University, Tripura Campus, Agartala,
Tripura, India

# The Author(s), under exclusive license to Springer Nature Singapore Pte 261
Ltd. 2024
A. Puri et al. (eds.), Fundamentals of Forensic Biology,
https://doi.org/10.1007/978-981-99-3161-3_19
262 M. Samuel and R. Shedge

utilized to determine the relationship between distant relatives and have been very
beneficial in kindship testing (Kauppi et al. Ann N Y Acad Sci 1267:18, 2012).

Keywords

Y-STR · Y-SNP · Haplotype · PAR · Sex typing · X Chromosome · Amelogenin ·

SRY · Forensic science

19.1 Definitions

Haplotype: A set of genetic determinants located on a single chromosome.

SNP (Single nucleotide polymorphism): In genetics, a single-nucleotide poly-
morphism is a germline substitution of a single nucleotide at a specific position in the
genome.
Sex-typing: the stereotypical categorization of people, or their appearance or
behaviour, according to conventional perceptions of what is typical of each sex.
Polymorphism: Polymorphism, as related to genomics, refers to the presence of
two or more variant forms of a specific DNA sequence that can occur among
different individuals or populations.

19.2 Y Chromosome Haplotyping

19.2.1 Y Chromosome Genome in Humans

Genetic traits on the human Y chromosome serve as a lineage marker for males as
they directly transmit a single haplotype from father to son [R]. Along with 22 pairs
of autosomal chromosomes, the Y chromosomes are one of a pair, with the X
chromosome, of the human sex chromosomes that are found in the nucleus of
human cells. Although there are possibilities of variances in the chromosome
numbers which are very rare and other specific mutations that can alter the pheno-
type, individuals with an X and Y chromosome are typically phenotypically mascu-
line, and those with two X chromosomes are female (de Knijff 2022). The Y
chromosome in males encodes a large number of genes necessary for male-specific
processes, such as sex determination and spermatogenesis. The human Y chromo-
some is made up of 50–60 genes and has a base pair count of around 59 million
which represent around 2%–3% of a haploid genome. The pseudoautosomal region
(PAR) and the male-specific Y region are two very distinct divisions of the Y
chromosome (Quintana-Murci and Fellous 2001).
19 Sex Chromosome Haplotyping 263

19.2.2 Pseudoautosomal Region

Two pseudoautosomal regions (PARs) are present in the terminal ends human Y
chromosomes, one in the end of short arm (Yp) and other in the long arm (Yq) which
are separated by centromeres (Figure). The genes PAR1 and PAR2, which both can
recombine with regions on the X chromosome, are enriched in the lightly packed
chromatin with the remaining sections part of male-specific region (MSY) and are
non-recombing in nature. PAR1 is 2.6 Mb in size and within the PAR1, 24 genes
have been known, whereas four genes are currently known to exist within the 320 kb
of the PAR2 (Quintana-Murci and Fellous 2001).
The correct separation of the X and Y chromosomes during meiosis depends on
the PARs. Sex chromosomal aneuploidies are caused by the improper segregation of
the X and Y chromosomes and have clinical effects like infertility and the Klinefelter
syndrome. Thus, all chromosomes must identify their homologous partners and
complete recombination and pairing in order for meiosis to be successful. The
pseudoautosomal regions, and very specifically PAR1, are the regions where Y
chromosome pairs and exchanges genetic material with the pseudoautosomal region
of the X chromosome during male meiosis. Compared to this, PAR2 is substantially
shorter and exhibits lower pairing frequency than PAR1, therefore deletion of PAR2
results in less severe phenotypes (Kauppi et al. 2012).

19.2.3 Male-Specific Y Region

The male-specific region of the Y chromosome, the MSY which was earlier called
the nonrecombining Y (NRY) region, separates the sexes and encompasses 95% of
the chromosome’s length. There are approximately 23 megabases (Mb) of euchro-
matic DNA sequences in the MSY, with 8 Mb on the short arm (Yp) and 14.5 Mb on
the long arm (Yq). The MSY is an assortment of heterochromatic sequences and
three classes of euchromatic sequences which are X-transposed, X-degenerate, and
ampliconic. These classes comprise the entire 156 known transcription units. This
further includes 78 protein-coding genes that collectively encode 27 distinct
proteins. The X-transposed sequences parade 99% identity to the X chromosome
and thus when choosing Y chromosome-specific markers for forensic DNA
profiling, areas having similarity to the X chromosome should be avoided. The
X-degenerate sequences are remains of ancient autosomes from which the modern X
and Y chromosomes evolved (Skaletsky et al. 2003).

19.2.4 Polymorphic Sequences

The Y chromosome consists of many polymorphic sequences along with many

variable number of tandem repeats (VNTR), single nucleotide polymorphisms
(SNPs) and mobile elements. Some of these sequences are extremely important in
forensic investigation. Most importantly, SNPs and mobile elements have far lower
264 M. Samuel and R. Shedge

discrimination power than Y chromosome short tandem repeats (Y-STRs). Due to

the high-throughput analysis and robust discrimination strength, Y-STRs are most
frequently employed for Y chromosomal DNA testing.

19.2.4.1 Y-STRs
Y-chromosome STRs and single nucleotide polymorphisms on the Y chromosome
(Y-SNPs) are two very distinctly different types of Y-chromosome polymorphisms
that can be used separately or in combination for routine forensic or population
genetic DNA research. In the Y chromosomal genome, around 400 STR sites have
been found. Using information from the sequencing of the human genome, the
precise positions of these loci have been successively mapped. About 60% of the
400 known Y-STR loci are found on the long arm of the chromosome, 22% are on
the short arm, and a small number are found in the centromeric region. In the earlier
days, only a small subset of Y-STRs could be genotyped well by PCR. The
tri-nucleotide repeat locus DYS392 and the tetra-nucleotide repeat loci DYS19,
DYS385a and b, DYS389-I, DYS389-II, DYS390, DYS391, and DYS393, made
up this core collection of Y-STRs. All of the major Y-STR multiplex kits contain this
set of nine Y-STR-loci known as the European minimal haplotype locus set /minimal
haplotype loci as recommended by the International Y-STR User Group for forensic
applications. Three additional tetra-nucleotide loci—DYS437, DYS438, and
DYS439, have also been included in all of the Y-STR kits as approved by Scientific
Working Group for DNA Analysis Methods (SWGDAM) in 2003. Currently, new
multiplex systems are being developed using a large number of newly discovered
Y-STR loci.
There are now commercially accessible kits with additional Y-STR loci that have
been approved for forensic usage.
The majority of Y-STR sets, however, have poor capacity to distinguish between
related males who share similar patrilineage. Therefore, patrilineal relatives of the
suspect cannot be excluded by existing forensic Y-STR profiling. Ballantyne et. al.
initially introduced rapidly modifying Y-STR (RM-Y- STRs) in Y-STR genotyping
and sequencing in the year 2012. RM Y-STR have mutation rates which are above
10-2 and this is significantly greater than the average Y-STR mutation rates. These
RM Y-STRs provide far better probability of being able to distinguish closely related
male relatives by paternity, which is undoubtedly a significant benefit in some
forensic instances (de Knijff 2022).
The Y-STR loci, DYS385 and DYS389, are multilocal (MLL) in nature. The STR
that is present at several sites on the Y chromosome as a result of duplication is
referred to as MLL Y-STRs. About 50 of these MLL Y-STRs have been found thus
far. The Y-STR loci DYS464 occurs at least four times in the highly palindromic
region close to the centre of the long arm of the Y-chromosome. The use of highly
polymorphic markers is helpful in forensic casework applications because the
amount of typable DNA material may be constrained in order to reduce the number
of markers required to distinguish unrelated individuals (Butler and Schoske 2004)
(Table 19.1).
19 Sex Chromosome Haplotyping 265

Table 19.1 Common SL. No. Core loci Additional loci

Y-STR Loci Covered by
1. DYS19 DYS437
some Commercial Kits like
AmpFlSTR® Yfiler® PCR 2. DYS385a/b DYS448
Amplification Kit (Applied 3. DYS389 I DYS456
Biosystems) & PowerPlex® 4. DYS389 II DYS458
Y23 System (Promega) 5. DYS390 DYS481
6. DYS391 DYS533
7. DYS392 DYS549
8. DYS393 DYS570
9. DYS438 DYS576
10. DYS439 DYS635
11. DYS643
12. Y-GATA-H4

19.2.4.2 Y-SNPs
A significant class of biallelic markers on the Y chromosome includes insertion/
deletions (indels) and single nucleotide polymorphisms (SNPs). Due to their lower
mutation rate than STRs (10-8 vs. 10-3 mutations per generation), these markers are
also referred to as unique event polymorphisms (UEPs). STRs, which can contain a
dozen or more alleles (or allelic combinations in the case of multi-copy Y-STRs),
provide more information per marker than SNPs, which only have two alleles. The
history of Y-SNP screening and application has been substantially more nuanced.
Six alternative haplogroup nomenclatures and a wide range of screening
methodologies were employed by various research groups when employing
Y-SNP polymorphisms for population genetic goals. Fortunately, the mtDNA
example was used to resolve the discrepancy in Babylonian nomenclature, leading
to the terminology we still use today (de Knijff 2022). With the advent of whole
genome sequencing and datasets widely available, large scale screening methods for
Y-SNP have begun developing rapidly (Karafet et al. 2008; Tillmar et al. 2021).

19.3 X Chromosome Haplotyping

The X chromosome has a special structure that has evolved to create gender-specific
genetic distinctions that are not shared by its counterpart, the Y chromosome, or the
autosomes. The pseudoautosomal regions, PAR1 and PAR2, are the only places
where the X and Y chromosomes can recombine in male individuals. As a result, in
males the X chromosome is (nearly) fully passed down to female offspring. How-
ever, females have two copies of the X chromosome, which recombines along the
entire chromosome during female meiosis and is passed on to both female and male
offspring. These transmission of traits makes the X chromosome an indispensable
genetic tool for population genetic studies as well as forensic investigations. The
potential uses that result from its distinctive features are what primarily underpin the
use of X chromosomal polymorphisms in population genetics and in human
266 M. Samuel and R. Shedge

identification. X chromosome markers may provide crucial information in a variety

of study fields, either independently or in addition to information provided by the
autosomes, Y chromosome, or mtDNA markers (Gomes et al. 2020). It must be
emphasized that identity testing utilising X-STRs in specific situations, namely in
cases of (complicated) kinship testing, may be the only method available to solve
some issues (Chen et al. 2020).
The exclusion strength of autosomal STRs is significantly diminished in paternity
cases involving close blood relatives as putative fathers, and X-STRs may be
preferable to autosomal markers. For instance, if two putative fathers are father
and son, then they would not share any X-chromosomal alleles identical by descent,
thus making X-STR analysis significant (Hering et al. 2010).
Markers do not segregate independently if they are close to each other and thus
the phenomenon of linkage comes to play. The alleles of the two loci are inherited
together as a haplotype, when two loci are very close to each other. Thus, it is
beneficial to use the recombination fraction (or recombination frequency), which is
the proportion of recombinants produced by chromosomal crossing between two loci
during meiosis among all the progeny, to estimate how closely two distinct loci are
related. Commercially available kits separate the ChrX into the linkage groups like
1-4 at Xp22.2, Xq12, Xq26, and Xq28, which are a collection of unlinked STRs and
produce independent genotype information (Gomes et al. 2020).

19.4 Gender Identification

In forensic investigations specially involving sexual assault or missing persons, sex

determination might be very crucial role. Genetic typing of biological traces is
required, and the classification of the sex is significant in such cases. Sex determina-
tion using genetic typing of fragments specific to the amelogenin gene is one of the
most common methods. Amelogenin is the protein that is most prevalent in secretory
stage of enamel. Defect in AMELX causes the X-linked amelogenesis imperfecta.
The human X chromosome houses the AMELX gene (Xp22.2) and the human Y
chromosome has the AMELY gene (Yp11.2), which are homologous genes that
make up the AMEL locus. Despite being a homologous pair, the genes’ size and
sequence vary. The AMELY gene’s coding sequence is 3272 bp long, while the
AMELX gene’s coding sequence is 2872 bp long. From a single main RNA
transcript, alternative splicing produces several amelogenin isoforms. The
amelogenin gene, which has X and Y chromosome variants (AMELX and
AMELY, respectively), can be used to determine the sex of unidentified human
samples. Comparing AMELX’s intron 1 to AMELY’s, there is a 6-base-pair loss.
The polymerase chain reaction (PCR) and gel electrophoresis can be used to identify
this difference. If both the AMELX and AMELY variants of the gene are present
(i.e. the sample is from a male), then two bands of DNA at 555 bps and 371 bps are
resolved, whereas one band of DNA at 555 bps is observed if the AMELX version
alone is present (i.e. the sample is from a female) (Morrill et al. 2008).
19 Sex Chromosome Haplotyping 267

This method of sex determination is not 100% accurate, however, due to AMELY
variance among people and populations. PCR amplification may not function if
mutations occur in AMELY intron 1 areas that are frequently employed as primer
annealing sites. An amplicon with the same length as AMELX is produced by
inserting a 6 bp sequence into intron 1 of AMELY. Some males may completely
lose the gene for AMELY. In each of these situations, just one band is visible during
the gel electrophoresis of the PCR product, leading to the sample being mistakenly
identified as female. Problems could occur due to amelogenin-specific fragments
being falsely detected (or not detected at all), chimerism (bone marrow transplants),
micro chimerism (pregnant women carrying male foetuses), and potential gender
inconsistencies between the biological gender and the (forensically relevant) legal
gender on personal identity documents.
To be able to overcome this issue, other gene like SRY is co-amplified with
AMEL which aids in the detection of AMELY-null samples. Sex-determining region
Y (SRY) gene located on the Yp11.31 of the Y chromosome is a very useful marker.
The sex-determination pathway is assumed to be steered towards male development
by SRY (Morikawaa et al. 2011). The ability to combine the SRY gene assay for
gender determination into other STR analyses using commercial kits that also
contain AMEL has been shown in many studies and has been validated as well.
The PCR product of this unique marker is 96 bp long and makes it possible to
determine gender when typing extremely damaged forensic evidence (Dash et al.
2020).
A multiplex amplification of the SRY, STS (steroid sulphatase), and amelogenin
gene areas and their homologous sequences has also been used by Morikawa et al.
(Morikawaa et al. 2011) as a method for determining sex. The male DNA component
of mixed samples with a male: female ratio as low as 1:10 may be detected using this
approach, which has a detection limit of 63 pg of genomic DNA. The STS gene for
steroid sulfatase (an enzyme) is responsible for converting sulfated steroid
precursors into physiologically active steroids like estrogens and androgens. The
STS gene is found at Xp22.31, which is the distal end of the short arm of the X
chromosome. Ten exons and nine introns make up the 146 kb long STS gene. The
STSP1 pseudogene is a 100 kb long STS gene located on the long arm of the Y
chromosome. Despite certain sequence homologies between STSP1 and the STS
gene, no functional genes are encoded by the pseudogene. STS and STSP1 alleles are
both used for sex typing.
Additionally, the pentanucleotide microsatellite DXYS156, which can be used to
determine sex, maps to the pseudoautosomal region of both sex chromosomes.
DXYS156 is a multi-allelic STR with geographic-specific allelic distribution that
aids in identifying a person’s sex as well as their likely geographical place of origin
(Mukherjee et al. 2013).
268 M. Samuel and R. Shedge

Multiple Choice Questions

1. Gene that aids in detection of AMELY-null samples are.

(a) SRY.
(b) DXYS156.
(c) Both.
(d) DYS19.
Answer: (c)
2. The alleles of the two loci are inherited together as a haplotype, when two loci are
very close to each other. This phenomenon is known as.
(a) Sex typing.
(b) Linkage.
(c) Polymorphism.
(d) Genetic variation.
Answer: (b)
3. If both the AMELX and AMELY variants of the gene are present, then two bands
of DNA at 555 bps and 371 bps are resolved using electrophoresis of the PCR
products indicating the sample belongs to the gender:
(a) Female.
(b) Male.
(c) Both.
(d) Unidentified.
Answer: (b)
4. The sex-determination pathway is assumed to be steered towards male develop-
ment by which gene?
(a) DXYS156.
(b) Both.
(c) DYS19.
(d) SRY.
Answer: (d)
5. Higher probability of being able to distinguish closely related male relatives by
paternity can be achieved using the following:
(a) Y-STR.
(b) RM Y-STR.
(c) X-STR.
(d) SRY.
Answer: RM Y-STR (Randomly mutating Y-STR)
6. Recombination is more localized to which region of the Y chromosomes?
(a) PAR 1.
(b) PAR 2.
(c) Both.
(d) Male specific Y-region.
Answer: (c)
7. X-STRs are more preferably utilized in which of the following cases?
19 Sex Chromosome Haplotyping 269

(a) Sex typing.

(b) Kinship testing.
(c) Paternity.
(d) None.
Answer: (b)
8. Identify the Y-STR which are multilocal in nature.
(a) DYS385.
(b) DYS389.
(c) Both the above.
(d) DXYS156.
Answer: (c)

References
Butler JM, Schoske R (2004) Forensic value of the multicopy Y-STR marker DYS464, vol 1261, pp
278–280
Chen M, Ren H, Liu Z et al (2020) Genetic polymorphisms and mutation rates of 16 X-STRs in a
Han Chinese population of Beijing and application examples in second-degree kinship cases. Int
J Legal Med 134:163–168. https://doi.org/10.1007/s00414-019-02047-8
Dash HR, Rawat N, Das S (2020) Alternatives to amelogenin markers for sex determination in
humans and their forensic relevance. Mol Biol Rep 47:2347–2360. https://doi.org/10.1007/
s11033-020-05268-y
de Knijff P (2022) On the forensic use of Y-chromosome polymorphisms. Genes (Basel) 13:898.
https://doi.org/10.3390/genes13050898
Gomes I, Pinto N, Antão-Sousa S et al (2020) Twenty years later: a comprehensive review of the X
chromosome use in forensic genetics. Front Genet 11:926. https://doi.org/10.3389/fgene.2020.
00926
Hering S, Edelmann J, Augustin C et al (2010) X chromosomal recombination—a family study
analysing 39 STR markers in German three-generation pedigrees. Int J Legal Med 124:483–491.
https://doi.org/10.1007/s00414-009-0387-y
Karafet TM, Mendez FL, Meilerman MB et al (2008) New binary polymorphisms reshape and
increase resolution of the human Y chromosomal haplogroup tree. Genome Res 18:830–838.
https://doi.org/10.1101/GR.7172008
Kauppi L, Jasin M, Keeney S (2012) The tricky path to recombining X and Y chromosomes in
meiosis. Ann N Y Acad Sci 1267:18. https://doi.org/10.1111/J.1749-6632.2012.06593.X
Morikawaa T, Yamamoto Y, Miyaish S (2011) A new method for sex determination based on
detection of SRY, STS and amelogenin gene regions with simultaneous amplification of their
homologous sequences by a multiplex PCR. Acta Med Okayama 65:113–122. https://doi.org/
10.18926/AMO/45270
Morrill BH, Rickords LF, Schafstall HJ (2008) Sequence length polymorphisms within primate
amelogenin and amelogenin-like genes: usefulness in sex determination. Am J Primatol 70:976–
985. https://doi.org/10.1002/ajp.20590
Mukerjee S, Mukherjee M, Ghosh T et al (2013) Differential pattern of genetic variability at the
DXYS156 locus on homologous regions of X and Y chromosomes in Indian population and its
forensic implications. Int J Legal Med 127:1–6. https://doi.org/10.1007/S00414-011-0646-6
Quintana-Murci L, Fellous M (2001) The human Y chromosome: the biological role of a “func-
tional wasteland”. J Biomed Biotechnol 1:18. https://doi.org/10.1155/S1110724301000080
270 M. Samuel and R. Shedge

Skaletsky H, Kuroda-Kawaguchl T, Minx PJ et al (2003) The male-specific region of the human Y

chromosome is a mosaic of discrete sequence classes. Nature 423:825–837. https://doi.org/10.
1038/NATURE01722
Tillmar A, Sturk-Andreaggi K, Daniels-Higginbotham J et al (2021) The FORCE panel: an all-in-
one SNP marker set for confirming investigative genetic genealogy leads and for general
forensic applications. Genes (Basel) 12:1968. https://doi.org/10.3390/GENES12121968
Mitochondrial DNA Profiling
20
Pratiksha H. Nimbkar, Aditi Mishra, Ulhas Gondhali, Sarthak Misra,
and Tanya Chauhan

Abstract

Mitochondrial DNA (mtDNA) is a versatile tool in understanding the clinical and

non-clinical aspects attributed by the nucleotide sequences. The presence of the
nucleotide sequences and their constant mutations within provide unique pheno-
typic characters to the bearer and are a probable cause of numerous disorders
related to the functional output of the mitochondrion. The study and understand-
ing of these nucleotide sequences have clinical and forensic applications. Clinical
applications include the prognosis of mitochondrial diseases
(mitochondriopathies) and undertaking preventive or delaying measures, whereas
forensic applications of mtDNA are very essential in the case of missing persons
or the case of Disaster Victim Identification (DVI). Apart from these, mtDNA can
also give an idea of the maternal lineage of the victim or suspect. In cases of
disputed maternity, mtDNA can provide information concerning the heredity of
the disputed child. These benefits of the mtDNA make it a valuable asset for

P. H. Nimbkar
School of Applied Sciences and Technology, Gujarat Technological University, Ahmedabad,
Gujarat, India
A. Mishra
Kristu Jayanti College, Bangalore, India
U. Gondhali
Jindal Institute of Behavioural Sciences, O.P. Jindal Global University, Sonipat, India
S. Misra (✉)
Indira Gandhi Institute of Medical Sciences, Patna, India
T. Chauhan
Department of Forensic Science, National Forensic Science University Delhi (LNJN NICFS),
New Delhi, Delhi, India

# The Author(s), under exclusive license to Springer Nature Singapore Pte 271
Ltd. 2024
A. Puri et al. (eds.), Fundamentals of Forensic Biology,
https://doi.org/10.1007/978-981-99-3161-3_20
272 P. H. Nimbkar et al.

research and further study to understand the rate and occurrence of the mutations
and their effects on the phenotypic characters of individuals.

Keywords

Mitochondrial DNA (mtDNA) · Phenotypic characters · Mitochondriopathies ·

Forensic applications

20.1 Definition of Terms

Disaster Victim Identification Process of recovery and identification of the people who have
(DVI) died
during events of multiple deaths such as disasters
Ubiquitination The process of attachment of ubiquitin to a protein for its
degradation
Biopsy Process of removal of a tissue sample for testing

20.2 Human Mitochondrial Genome

Known as the powerhouse of the cell, mitochondria are special due to their unique
property of energy generation not acquired by any other organelle within a cell.
There can be up to 1000 mitochondria present within a single cell with each of the
mitochondrion having 2-10 copies of the mtDNA (Amorim et al. 2019; Ingman and
Gyllensten 2001). They are double membrane rod-shaped structures. It performs
various functions such as calcium signalling, haem synthesis, and steroid synthesis
and aids in apoptosis. Mitochondrial DNA (mtDNA) is a double-stranded circular
moiety present within the mitochondria. First isolated and identified in 1963 by
Margit Nass and Sylvan Nass, the complete sequence of the mtDNA was first
published in 1981 by Cambridge Reference Sequence (CRS). Similar to nuclear
DNA, mtDNA has most of its sequence that is common among the various
mitochondria within the cell. This property of homogeneous sequences is termed
homoplasmy. Vice versa, the presence of the mutant regions with the wild-type
sequences is termed heteroplasmy. The understanding of the occurrence of
heteroplasmy within the mtDNA is crucial in studying mitochondrial diseases.
The mitochondrion over the years has accommodated itself within the eukaryotic
cell. Many theories emerge as to the evolution of the mitochondrion. The most
widely known theory is the theory of the endosymbiotic origin of mitochondria.
According to the theory, the mitochondrion was believed to be an aerobic prokaryote
that was engulfed by a eukaryotic cell. The aerobic prokaryote then formed a
symbiotic relationship with the eukaryote. This led to the development and evolution
of the current mitochondrion. When we trace back the ancestry of the mitochon-
drion, the closest relative from which it can be said to have evolved is the α-
proteobacteria. The presence of these organelles today is representative of those
20 Mitochondrial DNA Profiling 273

Fig. 20.1 Diagrammatic representation of the theory of the endosymbiotic origin of mitochondria

Fig. 20.2 Pedigree diagram depicting the transfer of mtDNA through generations. mtDNA
inherited by males is not passed on to the next generation due to its loss during embryogenesis

ancient symbiotic relationships. The mitochondrion is similar to an ancient bacterial

cell having its DNA and possessing the ability to generate ATP through oxidative
phosphorylation (Fig. 20.1).
mtDNA has been a subject of interest for researchers due to its nature of
conservation through generations. It is representative of the maternal lineage and
ancestry. During fertilization, the mitochondria within the sperm cell have a very low
copy number of the mtDNA as compared to an ovum and the transferred
mitochondria are somehow lost during embryogenesis. Another probable reason
for only maternal mtDNA inheritance is the ubiquitination of the paternal
mitochondria. The mtDNA continuously undergoes mutations. This property of
the mtDNA along with its maternal conservation through generations makes it
ideal for studying migratory patterns. The mutations result in highly specific nucle-
otide sequences evolved over generations within populations residing in a relative
geographic region and having a common maternal ancestor, providing these
individuals with distinct genetic fingerprints (Fig. 20.2).
274 P. H. Nimbkar et al.

F
PT
v 12S
D Ioop E

16S Origin of H

NADH dehydrogenase I L
Q S
Genes (ND1, ND2) M H
NADH dehydrogenase Genes
W
(ND3, ND4L, ND4, ND5)
A
N
C
Y
R

G
SD
K ATPase 6
Origin of L

ATPase 8

Cytochrome Oxidase Genes, I, II, III

Fig. 20.3 Structure of the mtDNA (Alphabets correspond to the amino acid codes for the
22 mitochondrial tRNAs), rRNAs are marked as 12S and 16S, respectively, the origin of the
Heavy (H) and Light (L) strands are marked along with major genes such as CO, ATPase, and ND

Since the copy number of human mtDNA within cells is relatively very high as
compared to nuclear DNA and has a small size of 16569 bps (Anderson et al. 1981), it
can easily be studied. When we specifically talk about the human mitochondrial
genome, the complete structure has been previously studied and recorded. It is a
double-stranded structure consisting of an outer heavy (H) strand and an inner light
(L) strand. The H strand is heavy due to the higher concentration of guanine residues
as compared to the higher concentration of cytosine residues in the L strand. Further-
more, the H strand consists of the majority of the genes for two rRNAs, 14 tRNAs, and
12 polypeptides. The L strand has genes for eight tRNAs and only one polypeptide
(Taanman 1999). The mtDNA is primarily composed of coding regions and is devoid
of introns except for one regulatory region. This makes the mtDNA very systematized
as compared to nuclear DNA. A major site controlling the mtDNA expression is found
as a short three-stranded structure that contains complementary base pairs for the
L-strand. This region is termed the Displacement loop or the D-loop. The leading
strand origin of replication and major promoters for transcription are present on the
D-loop along with the genes for Phenylalanine and Proline tRNAs (Fig. 20.3).
Applications of mtDNA studies include clinical studies, ancestry tracing, mater-
nal phylogenetic studies, and forensic science. Clinical studies involve the determi-
nation of mtDNA regions hosting sequences for diseases such as cancer,
neurogenerative disorders, atrophies, etc. mtDNA holds great importance in forensic
science. mtDNA has allowed investigators to construct a partial profile of suspected
perpetrators. It can be used as evidence in cases of disputed maternity. mtDNA
becomes a great tool for identification in mass disaster victim identification cases due
to its presence in samples such as hair, teeth, and bone which degrade at very slow
rates.
20 Mitochondrial DNA Profiling 275

20.3 mtDNA Polymorphic Regions

As discussed earlier, understanding the reasons for the occurrence of heteroplasmy is

essential for various reasons. Heteroplasmy can be easily defined as the occurrence
of more than one type of detectable mtDNA type within an individual (Luo et al.
2018). Since each cell consists of numerous mitochondria, probability of one tissue
being heteroplasmic and the other tissue exhibiting homoplasmy increases. The
possibility of occurrence of the said case is very low, but can be considered as an
exception. Heteroplasmy can be found within the mtDNA naturally (if the maternal
lineage consists of heterozygous alleles). However, other reasons for heteroplasmy
can include the accidental transfer of the mtDNA from the paternal lineage into the
ovum during fertilization (Sinha et al. 2020). A few recent studies have supported the
hypothesis, but in the majority of the cases, as mentioned previously, the
mitochondria acquired from the sperm cell get destroyed during embryogenesis,
conserving only the maternal lineage. Transfer of the paternal mtDNA can prove
beneficial as it allows recombination of the mtDNA, leading to the strengthening of
the genetic lineage through the introduction of new nucleotide sequences.
Advantages of heteroplasmy include removal of deleterious mutations present
within the mtDNA and reduction of the effect of “mother’s curse” (a hypothesis
stating that strict conservation of the mtDNA can have little or no effect on females,
but can prove to be harmful to males). Heteroplasmy can be divided into two classes,
wherein class one relates to the length polymorphism within the mtDNA and the
second class deals with the point mutations (SNPs) within the mtDNA sequence.
Heteroplasmy is significant in determining migration patterns. Mutant determination
is based upon whether the number of mutant individuals is more than the control
samples, the severity of the mutations, and their positive expression within the
mutant population expressing the presence of mutant genes. The presence and
absence of the level of dominance of specific alleles within the mtDNA are indica-
tive of specific geographical locations. The presence of heteroplasmy affects various
mitochondrial diseases. Mitochondria primarily deal with the energy requirements of
the cell and hence diseases associated with mtDNA are generally observed to affect
body organs and systems with high energy requirements such as the central nervous
system or the heart. A brief explanation of the said phenomena can be as follows:

1. In the case of people residing in high-altitude areas such as Tibet, the 3394C allele
is present dominantly as compared to the people residing in lower altitude regions
(Stewart and Chinnery 2021). The presence of this allele thus becomes indicative
of the geographic-specific mutations as well as if an individual from the region
travels to a different region of the world; the presence of the gene can help in
determining the migratory pattern of the individual.
2. The level of mutation can affect the intensity of the disorders associated. For
example, individuals possessing heteroplasmic mutations (A/G) for the mtDNA
tRNA coding for Leucine exhibit different disorders based on the concentration
of G present. In the case of 20–30% mutation (3243G), individuals are diabetic
276 P. H. Nimbkar et al.

patients, whereas a mutation of 50–90% results in individuals having neuromus-

cular disease and a 100% mutation in the mtDNA leads to lethal perinatal disease
(Wallace 2015).
3. Specific sequence variations within populations create sub-populations having an
almost identical mtDNA sequence, but with a variation in the common region.
These sub-populations can be termed as halogroups of the original population.
These subgroups harbour nucleotide sequences that are not necessarily
heteroplasmic, but the resultant sequence variations can lead to the groups having
associations with specific mitochondrial disorders. For example, within the
European continent, due to migrations, 10 major halogroups have been found
to co-exist within the populations. These halogroups have, however, shown to
harbour sequences for disorders such as Leber’s hereditary optic neuropathy
(LHON). The disorder results in gradual loss of vision as a result of increasing
age (Chinnery and Hudson 2013).
4. Similarly, as the disorders associated with mtDNA are more related to the
metabolically active body systems, changes in the mtDNA sequences can result
in age-related neurogenerative disorders such as Parkinson’s disease, Alzheimer’s
disease, and other age-related disorders affecting the central nervous system,
heart, and muscular tissues.
5. Maintenance of mtDNA is looked upon by genes such as OPA1 and MFN2.
These genes not only act as regulators for the nucleotide sequences within the
mtDNA, but polymorphism due to deletions can result in optic atrophy along with
other disorders visible as phenotypic characters such as deafness and neuromus-
cular disease. Polymorph of MFN2 is associated with Charcot-Marie-Tooth
disease (CMT2A) and hereditary motor and sensory neuropathy.

20.4 mtDNA Testing

Within the mtDNA, along with the high number of mutations in the hypervariable
regions H I and H II, mutations also occur outside these regions. These mutations can
give rise to SNPs within the mtDNA sequences, making the nucleotide sequences
unique for the particular maternal lineage. Studying the nucleotide sequences within
the mtDNA can either concern with understanding the various genetic aspects of
inheritance of diseases and other phenotypic characters or the second approach for
studying mtDNA can be concerning analysing and comparing mtDNA sequences of
reference and test samples for identification from a forensic perspective. mtDNA
presents itself as a suitable candidate for identification as it has a high copy number
among the cells; it can be extracted from older samples such as hair, teeth, and bones
with low nDNA concentration.
Mitochondriopathies or diseases inherited due to the mtDNA mutations are
mutations in the nDNA affecting the normal mitochondrion function.
Mitochondriopathies can also result in a reduction in the number of mitochondria
within the cell, damage in the replication of the mitochondria, and changes in the
oxidation potential within the mitochondrial membranes. These diseases as
20 Mitochondrial DNA Profiling 277

previously stated are found to affect the oxygen utilization and energy production
processes (oxidative phosphorylation—OXPHOS).
Clinical diagnostics for mtDNA testing involve liquid biopsies which offer a less
invasive diagnosis. The liquid biopsies concerned with testing body fluids such as
blood, urine, cerebrospinal fluid (CSF), etc. biomarkers are present within the body
fluids that are indicative of the presence of mitochondriopathies. For example,
Fibroblast growth factor 21 (FGF21), growth/differentiation factor 15(GDF-15),
cell-free circulating mtDNA, and ROS-sensitive miRNA-9/9* are widely used
biomarkers used in mtDNA testing. For determination of Alzheimer’s, biomarkers
within the blood and CSF such as Apolipoprotein E4 (ApoE), lipofuscin-like
pigments, Cytochrome oxidase (COX) activity, mitochondrial aconitase levels,
and reduced antioxidant levels among others give a clear indication as to the
presence or possible future development of Alzheimer’s within individuals. Simi-
larly, there are specific biomarkers for the detection of other mitochondriopathies
such as Parkinson’s disease or Carcinogenesis. These biomarkers have facilitated the
easy and early diagnosis of various mitochondriopathies providing patients with the
option of starting an early treatment to delay the effects of the disorders. When
discussing the forensic aspect of mtDNA testing, more sophisticated and advanced
testing protocols are adopted. Since the analysis is based on nucleotide sequence
matching, analysis is usually performed by using PCR-based methods, Sanger
sequencing, or by using the Next Generation Sequencing Technologies (NGS).
PCR methods capable of detecting hetroplasmy can also detect SNP’s presence in
the mtDNA sequences. These highly sensitive protocols are highly focused on the
detection of either specific regions of nucleotide sequences as in PCR-RFLP or
determining changes within single base pairs using single-stranded conformation
polymorphism (SSCP). With the use of qPCR, one can even assess the level of
heterogenicity within the samples. The only drawback of using PCR-based
techniques is the prior requirement of a reference sequence and in the absence of a
reference sequence, the PCR techniques cannot fulfil the requirements. Hence,
forensic laboratories prefer using sequencing techniques for analysis. Most
laboratories globally prefer using Sanger sequencing for mtDNA matching. Slowly,
the newer platforms of NGS such as Ion torrent and Illumina Sequencing have
started to be used on a routine basis in forensic laboratories. mtDNA analysis, similar
to nDNA analysis, is reference and query sequence matching, where one of the
samples received from a potential crime scene or suspect is matched with a reference
sample for checking the matching percentage. The only difference between mtDNA
testing and nDNA testing is that mtDNA testing is limited to class characteristics
(Parsons and Coble 2001) identification and not individualization as two individuals
of the same maternal lineage can have matching mtDNA sequences.
278 P. H. Nimbkar et al.

20.5 Forensic mtDNA Testing

Forensic analysis in DNA is based completely upon comparative analysis between a

test and reference sample to determine their match percentage. In case of mtDNA
analysis, it provides wider opportunities for researchers and law enforcement
agencies with a more confident say as to the partial origin of the samples specifically
restricted to their maternal lineage. It is one of the preferred methods of testing as it
allows good quality analysis in case of very small sample volume as well in case of
samples that have been degraded or have small amounts of contamination.
There have been numerous protocols for mtDNA analysis, but since the develop-
ment of Next Generation Sequencing (NGS) technology, it has become more
efficient, flexible, and robust due to the ease of entire genome mapping of the
mitochondrial DNA. NGS has allowed researchers as well as forensic investigators
to analyse highly compromised and degraded DNA samples such as in cases of
Disaster Victim Identification (DVA) or multiple DNA donors on a crime scene. For
analysis of disaster victims, short read sequencing can prove more accurate in
determining the samples as high amounts of mtDNA are available in small sample
volumes. This allows the investigators to study more broadly the whole genome
structure as well as the associated SNPs within them. This assists in separation of
mixed samples where there is more than one contributor involved for one DNA
sample pool. Majority of the mutations within the mtDNA are present in the
hypervariable regions of the genome. These regions are focused upon in forensic
investigations as they provide reliable information as to individual identification due
to the presence of unique SNP and STR regions. Forensic analysis of mtDNA can be
conducted using numerous techniques such as Mass spectrometry, MALDI-TOF
(Nahar Sultana 2018), Whole Genome Sequencing (WGS), Amplicon sequencing,
along with another few. These methods provide accurate analysis for testing and
building of mtDNA databases.
A technical challenge associated with mtDNA analysis is hetroplasmy. As priorly
mentioned, hetroplasmy is one of the defining features of mtDNA as it allows a
single cell to have different genetic compositions within the mitochondrion within
it. This creates bias in mtDNA testing as a single donor can possess mutations within
the samples of different tissues making it difficult to identify the donor based on the
available test and reference sample.
Additional assistance in forensic mtDNA testing is the presence of reference
mtDNA databases that can reduce the time required for sequence comparison and
matching. As CODIS, for mtDNA, databases include EDNAP Mitochondrial DNA
Population Database (EMPOP) and Mitomap. EMPOP is used as a reference
database for comparing query sequences. The advantage of EMPOP is that it
provides high-quality results and hence acts as a quality control tool for reference
matching. Mitomap mtDNA database provides various selections to the user based
on the nature of the search to be made. Designed in 1996, the database has data that
can be categorized based on user requirements such as geographic locations and
disease-specific variants. Both the mentioned databases allow ease of sequence
20 Mitochondrial DNA Profiling 279

comparison and analysis and are fit for use by geneticists, forensic scientists, and
doctors interested in understanding inheritance patterns (Amorim et al. 2019).
Concerning mtDNA or nDNA testing, apart from the numerous benefits that they
provide, there are a few legal and ethical aspects to their analysis. Whether nDNA or
mtDNA analysis, the results of the analysis are bound to reveal not just the requested
response, but also other aspects of the nucleotide sequence revealing any current or
future progressive disorders that the individual has without his knowledge or any
disorders that can progress in the future. Hence, it comes under the boundaries of
ethics for the analyst to take action according to the policies set by the said
institution. Therefore, to avoid legal and ethical dilemmas, the analysis of the
nucleotide sequences is being kept limited to the non-coding regions of the
mtDNA that have not yet been identified with diseases or peculiar phenotypic
characters.
Apart from this, mtDNA can be utilized in wildlife forensics. In cases of wildlife
crimes, the samples retrieved for analysis are very difficult to identify due to absence
of phenotypic species identification features such as scales, hair, etc. In such cases
when species identification is essential to establish commission of crime, mtDNA
analysis can offer accurate species level identification. Previous literature has men-
tion of wildlife crime case samples being identified up to species level using mtDNA
gene markers like Cytb and COI (Kumar et al. 2019). Preference in analysis is given
for mtDNA in such cases as its rates of degradation and mutation are inversely
proportional and hence provide stable conditions for analysis even with long
passages of time since the commission of the crime.
Food adulteration can be detected using mtDNA sequences in food products such
as frozen meat and fish, exotic food products, and processed animal products. This
provides a wide scope for researchers to explore the different applications of mtDNA
apart from the clinical and forensic applications.
Thus, the application of mtDNA is not only restricted to humans, but can also be
applied to animals for species determination. However, for plants, mtDNA is not
considered as a major key player in DNA analysis due to slow evolution and very
low number of mutations within its genome sequence.

20.6 Conclusion

The studies with respect to mtDNA have shown the potential that it has in under-
standing various aspects of the organisms. The evolution of mtDNA explains the
evolutionary symbiotic relationships existing for millions of years between
organisms. Today, mtDNA analysis is not only capable of providing information
concerning inheritance and migration patterns, but can also predict a clear picture of
numerous mitochondriopathies that exist or can affect a person in their later stages of
life. The prognosis of possible disorders can help patients by getting early treatment,
thereby increasing their lifespan of individuals. From a forensic perspective, the
mtDNA analysis takes investigators one step closer to the identification of suspects
or missing persons by providing partial genealogical details in context to the case at
280 P. H. Nimbkar et al.

hand. This reduces the stretch of search that the investigators need to undertake, thus
saving valuable time. With this, the horizons of mtDNA testing are continuously
expanding as it continues to prove to be a key player in DNA analysis. The field of
mtDNA analysis is being evolving and is now widely used not only for clinical, but
also for forensic investigations and food adulteration monitoring purposes.

Multiple Choice Questions

1. The size of the mtDNA is.

(a) 14,899 bps.
(b) 22,000 bps.
(c) 16,569 bps.
(d) 15,255 bps.
Answer: (c)
2. Can a father carrying mtDNA lineage pass it on to his future generation?
(a) No.
(b) Yes.
(c) Inadequate Information.
(d) None of the above.
Answer: (a)
3. A non-invasive method for the detection of mitochondriopathies is.
(a) Regular Biopsy.
(b) Surgery.
(c) Both a and b.
(d) Liquid Biopsy.
Answer: (d)
4. Mitomap and EMPOP are.
(a) Mitochondrial DNA Databases.
(b) Ballistic Databases.
(c) Fingerprint Databases.
(d) Bacterial Genome Databases.
Answer: (a)
5. For ethical and legal reasons, mtDNA analysis is restricted to.
(a) Coding regions.
(b) Complete mtDNA.
(c) Non-coding regions.
(d) Nuclear DNA.
Answer: (c)

References
Amorim A, Fernandes T, Taveira N (2019) Mitochondrial DNA in human identification: a review.
PeerJ 7:e7314. https://doi.org/10.7717/peerj.7314
20 Mitochondrial DNA Profiling 281

Anderson S, Bankier A et al (1981) Sequence and organization of the human mitochondrial

genome. Nature 290(9):457–465
Chevigny N, Schatz-Daas D, Lotfi F, Gualberto JM (2020) DNA repair and the stability of the plant
mitochondrial genome. Int J Mol Sci 21(1):328. https://doi.org/10.3390/ijms21010328
Chinnery PF, Hudson G (2013) Mitochondrial genetics. Br Med Bull 106(1):135–159. https://doi.
org/10.1093/bmb/ldt017
Ingman M, Gyllensten U (2001) Analysis of the complete human mtDNA genome: methodology
and inferences for human evolution. J Hered 92:454; https://academic.oup.com/jhered/article/
92/6/454/2187179
Kumar V, Chandra K, Kundu S, Tyagi K, Amin Laskar B, Singha D, Chakraborty R, Pakrashi A
(2019) Utility of mitochondrial DNA in wildlife forensic science: reliable identification of
confiscated materials from eastern India. Mitochondrial DNA B Resour 4(1):583–588. https://
doi.org/10.1080/23802359.2018.1561216
Luo S, Valencia CA, Zhang J, Lee NC, Slone J, Gui B, Wang X, Li Z, Dell S, Brown J, Chen SM,
Chien YH, Hwu WL, Fan PC, Wong LJ, Atwal PS, Huang T (2018) Biparental inheritance of
mitochondrial DNA in humans. Proc Natl Acad Sci 115(51):13039–13044. https://doi.org/10.
1073/pnas.1810946115
Nahar Sultana GN (2018) Medicolegal aspects and examination techniques in exhumation cases
with alleged human rights violation. J Forensic Sci Crim Invest 9(1):1. https://doi.org/10.19080/
jfsci.2018.09.555755
Parsons TJ, Coble MD (2001) Increasing the forensic discrimination of mitochondrial DNA testing
through analysis of the entire mitochondrial DNA Genome. Croat Med J 42(3):304; www.
cmj.hr
Sinha M, Rana M, Kushwaha P (2020) Applications of mitochondrial DNA in forensic science. In:
Forensic DNA typing: principles, applications and advancements. Springer, Singapore, pp
329–343. https://doi.org/10.1007/978-981-15-6655-4_16
Stewart JB, Chinnery PF (2021) Extreme heterogeneity of human mitochondrial DNA 1 from
organelles to populations. Nat Rev Genet 22:106
Taanman J-W (1999) The mitochondrial genome: structure, transcription, translation and replica-
tion. Biochim Biophys Acta 1410(2):103
Wallace DC (2015) Mitochondrial DNA variation in human radiation and disease. Cell 163(1):
33–38. https://doi.org/10.1016/j.cell.2015.08.067
Single Nucleotide Polymorphism
as Evolutionary Evidence of Individuality 21
Sarthak Misra, Parth Sharma, Aditi Mishra, Ulhas Gondhali,
and Tanya Chauhan

Abstract

Since the development of DNA fingerprinting by Sir Alec Jeffery, the technique
has always had a special relevance to forensic science. With the new emerging
technologies, DNA fingerprinting has been performed through detection of spe-
cific DNA sequences within reference and query samples by techniques such as
RFLP analysis and SSCP analysis to name a few. Recent advancement into
determination of individuality includes the detection and analysis of Single
Nucleotide Polymorphs (SNPs) within the samples. These analyses have proven
significance due to their uniqueness within the genetic sequences by acting as
biological markers. SNP detection protocols focus on highlighting the presence of
the sequence modifications by using electrophoretic techniques, probes, primers,
and high-throughput methods such as Sanger sequencing and NGS. The high-
throughput techniques allow simultaneous multi-sample analysis through
sequence by synthesis. With respect to individualization, these techniques have

S. Misra
Indira Gandhi Institute of Medical Sciences, Patna, India
P. Sharma
School of Applied Sciences and Technology, Gujarat Technological University, Ahmedabad,
Gujarat, India
A. Mishra (✉)
Kristu Jayanti College, Bangalore, India
U. Gondhali
Jindal Institute of Behavioural Sciences, O.P. Jindal Global University, Sonipat, India
T. Chauhan
Department of Forensic Science, National Forensic Science University Delhi Campus
(LNJN NICFS), New Delhi, Delhi, India

# The Author(s), under exclusive license to Springer Nature Singapore Pte 283
Ltd. 2024
A. Puri et al. (eds.), Fundamentals of Forensic Biology,
https://doi.org/10.1007/978-981-99-3161-3_21
284 S. Misra et al.

been adopted worldwide on regular basis for forensic investigation analysis of

recent and cold cases.

Keywords

Single Nucleotide Polymorphs (SNPs) · Individualization · Polymorphic

characters · Evolutionary relations · Migratory patterns

21.1 Definition of Terms

Deoxyribonucleic Acid Molecule coding for genetic information of an organism

(DNA)
Next-generation Nucleotide sequencing technique that can execute sequencing of
sequencing (NGS) multiple nucleotide sequences parallelly
Polymerase chain reaction Molecular technique that selectively amplifies targeted region of
(PCR) nucleotide sequence from the sample
Chemical cleavage of Use of chemical agent to cut the nucleotide sequence at the
mismatch (CCM) position of mismatch
Electrophoresis Movement of charged particles due to electric field

21.2 Basic Characteristics

Traditionally, organisms have been classified based on their differentiating physical

traits and adaptations, as these divergences in morphological features provided
evidence for the evolution of a group or species. However, identifying an individual
organism from a group becomes confusing because of similarity in morphological
traits. Therefore, reliance on the molecular remains of evolution on
Deoxyribonucleic acid (DNA) sequence level would be more accurate to spot an
individual from the group.
Adaptation at molecular level occurs through various exposure events producing
mutations in the DNA sequences and changing it gradually towards acquisition of
novel traits in the organism Darwin et al. (1859), Barreiro et al. (2008). Such
mutations limited to change of a nucleotide in DNA sequence are called single
nucleotide variations (SNVs). However, SNVs fixed in germline with the potential to
transmit across generations are considered as single nucleotide polymorphisms
(SNPs) Brookes (1999). Hence, distribution of SNPs in individuals can be utilized
for their identification and assessment of their ancestry. Moreover, SNPs may also
influence the fitness of an organism by producing functional transfiguration or
inefficient translation causing changes in resulting protein sequences Arshad et al.
(2018), Robert & Pelletier (2018). Therefore, only nonlethal SNPs may be conserved
through long-term evolution Morin et al. (2004).
In eukaryotic organisms such as Humans, DNA sequences are present in the
nucleus and mitochondria of a cell Bogenhagen & Clayton (1974). Nuclear DNA
21 Single Nucleotide Polymorphism as Evolutionary Evidence of Individuality 285

(nDNA) sequences are inherited from both parents equally, whereas mitochondrial
DNA (mtDNA) is maternally inherited. For that reason, nDNA can be used to
identify both paternal and maternal-related ancestry, while mtDNA can only resolve
maternal side ancestry. Furthermore, mtDNA collects mutations faster than nDNA in
the vertebrates, accordingly mtDNA markers are widely used to infer evolutionary
relations in animals Allio et al. (2017). Combination of DNA markers from both
sources can be analysed to improve confidence of relatedness and even track
migration patterns of the ancestors Gunter et al. (1994). Due to all of above reasons,
DNA marker to assess diversity should be selected based on objectives of the study.
In this book chapter, we are discussing experiment drafting to detect SNP
signatures as individuality marker by covering gel electrophoresis analysis, PCR
amplification analysis, Next Generation Sequencing (NGS) analysis, and develop-
ment of regional level high-throughput techniques.

21.3 Strategies for SNPs Profiling and Its Applications

SNPs are nucleotide substitutions that do not always result in phenotype such as
genetic diseases or fitness improving traits Fiatal & Adany (2018). Therefore, to
identify individuals using SNPs, genetic approach is preferred. Extraction of genetic
materials from the sample requires to be standardized based on the sample type and
its downstream applications. For the SNP-based individualization, a query SNP
distribution pattern is superimposed on the reference SNP patterns to check their
similarity and validate the source identity.

21.3.1 Reference Sequence Generation and Regional Database

Creation Are Essential to Use SNP Profiles to Identify
Individuals from the Population

SNPs are always searched against a relative sequence, and this known sequence is
called a reference sequence. Therefore, development and availability of robust
reference database are required for accurate SNP-based identifications Marth et al.
(1999). For the development of reference sequence database, planned location-based
sampling and sequencing is important for the development of high-throughput SNP
profiling analysis.
Event-based reference sequences can also be generated and used to profile the
SNPs distribution in the sequence isolated from a query sample. For example,
sequence generated from a crime scene can be considered as a reference sequence
and compared with a query sequence obtained from suspects to identify the individ-
ual leaving the DNA at the crime scene. However, to conduct such SNP-based
analysis, quality sampling and extraction of nucleic acid from the evidence are
technically challenging as the biological material present at the event is usually
scarce and contaminated. As the whole genome from such limited biological sample
is difficult, gene marker-based reference sequence generation is suggested and may
286 S. Misra et al.

result in cost and time efficiency compared to other type of SNP profile analysis and
database building. Moreover, reference sequences can be supplemented with refer-
ence specific metadata such as disease condition, unique phenotypes, geographical
location, migration data, and ancestry information.

21.3.2 Isolation of Query Sequences from the Target Samples

to Compare SNP Profiles with Reference Sequences Is the Key
to Individualization of the Sample

Once the reference sequence is available for the comparison, generation of a query
sequence from target sample brings its own challenges such as ethical constrains
with respect to sample collection and the biological source selection. As sample can
be human or non-human, their availability or accessibility may yield low nucleic
acid concentration and create contamination-based biases. For example, if sample
source went through blood transfusion, SNP profile generated from their blood
sample may not match with their SNP profile from other body cells. Hence, such
false negative biasness can be avoided by selecting robust sampling source. Another
challenge is to recover individual sequence from degrading mixed samples collected
from environmental sources. Apart from these technicalities, especially when work-
ing with non-human IUCN-listed wildlife samples, nucleic acid sequences are
unavailable from invasive methods due to their conservation status. To bypass
such ethical hurdles, non-invasive nucleic acid extraction from scats and shed
exoskeleton is advisable but usually results in limited yield.

21.3.3 Gene Marker-Based SNP Profiling Approaches

for Identification Are Effective and Efficient Compared to de
Novo Whole Genome Sequencing

As gene marker-based approaches selectively amplify a part of the genome using

PCR, it is further sequenced for the identification and sequence compression.
Whereas whole genome sequencing technology sequences random fragments from
the genome and compiles them to identify nucleotide variations, this approach is
tedious and impractical for the high-throughput applications Hillier et al. (2008).
Therefore, selection of gene marker-based approaches is more suitable for large-
scale and efficient screening of nucleotide variations Cargill et al. (1999).
With respect to forensic investigations, phenotypic gene marker tends to be very
useful as they allow to proximate physical characters from nucleotide variations with
high confidence. For such analysis, multi-gene marker panel such as HIrisPlex-S is
available in the market with various phenotypic gene combinations that can predict
the morphological features of the individual Sham et al. (2002). Genes that are used
in the above panel are mentioned in Table 21.1. Presence of these genes is correlated
with its database having 9466 SNP references for eye colour, 1878 SNP references
 21

Table 21.1 Phenotypic gene combination of HIrisPlex-S panel system (modified from https://hirisplex.erasmusmc.nl/ & Breslina et al. 2019)
SNP
Gene marker variation reference Chromosome Number Nucleotide Position Reference Allele Substitut ed. Allele Amplicon Number
TYR rs1042602 11 88,911,696 C A TYR
Amplicon
BNC2 rs10756819 9 16,858,084 G A BNC2
Amplicon
MC1R rs1110400 16 89,986,130 T C BNC2
Amplicon
TYR rs1126809 16 89,017,961 G A MC1R
Amplicon 5
HERC2 rs1129038 15 28,356,859 G A HERC2
Amplicon 4
MC1R rs11547464 16 89,986,091 G A MC1R
Amplicon 2
IRF4 rs12203592 6 396,321 C T IRF4
Amplicon
OCA2 rs12441727 15 28,271,775 G A OCA2
Amplicon 5
KITLG rs12821256 12 89,328,335 T C KITLG
Amplicon
LOC1053 rs12896399 14 92,773,663 G T SLC24A4
70,627 Amplicon
HERC2 rs12913832 15 28,365,618 A G HERC2
Amplicon 1
Single Nucleotide Polymorphism as Evolutionary Evidence of Individuality

TYR rs1393350 11 89,011,046 G A TYR

Amplicon
SLC24A5 rs1426654 15 48,426,484 A G SLC24A5
Amplicon
OCA2 rs1470608 15 28,288,121 G T OCA2
287

Amplicon 3
(continued)
Table 21.1 (continued)
288

SNP
Gene marker variation reference Chromosome Number Nucleotide Position Reference Allele Substitut ed. Allele Amplicon Number
OCA2 rs1545397 15 28,187,772 A T OCA2
Amplicon 4
HERC2 rs1667394 15 28,530,182 C T HERC2
Amplicon 5
SLC45A2 rs16891982 5 33,951,693 C G SLC45A2
Amplicon 2
SLC24A4 rs17128291 14 92,882,826 A G SLC24A4
Amplicon
OCA2 rs1800407 15 28,230,318 C T OCA2
Amplicon 1
OCA2 rs1800414 15 28,197,037 T C OCA2
Amplicon 2
MC1R rs1805005 16 89,985,844 G T OCA2
Amplicon 2
MC1R rs1805006 16 89,985,918 C A OCA2
Amplicon 2
MC1R rs1805007 16 89,986,117 C T OCA2
Amplicon 2
MC1R rs1805008 16 89,986,144 C T OCA2
Amplicon 2
TUBB3 rs1805009 16 89,986,546 G C MC1R
Amplicon 4
MC1R rs201326893 16 89,986,122 C A MC1R
Amplicon 4
MC1R rs2228479 16 89,985,940 G A MC1R
Amplicon 3
HERC2 rs2238289 15 28,453,215 A G HERC2
S. Misra et al.

Amplicon 2
 21

PIGU rs2378249 20 33,218,090 G A PIGU

Amplicon
SLC24A4 rs2402130 14 92,801,203 G A SLC24A4
Amplicon
SLC45A2 rs28777 5 33,958,959 C A SLC45A2
Amplicon 1
ANKRD1 rs3114908 16 89,383,725 T C ANKRD11
1 Amplicon
MC1R rs3212355 16 89,984,378 C T MC1R
Amplicon 6
LOC1053 rs4959270 6 457,748 C A EXOC2
74,875 Amplicon
RALY rs6059655 20 32,665,748 A G RALY
Amplicon
ASIP rs6119471 20 32,785,212 C G ASIP
Amplicon
HERC2 rs6497292 15 28,496,195 A G HERC2
Amplicon 3
TYRP1 rs683 9 12,709,305 C A TYRP1
Amplicon
DEF8 rs8051733 16 90,024,206 A G DEF8
Amplicon
MC1R rs885479 16 89,986,154 G A MC1R
Amplicon 1
Single Nucleotide Polymorphism as Evolutionary Evidence of Individuality
289
290 S. Misra et al.

for hair colour, 854 SNP references for hair shades, and 1423 SNP references for
skin colour to predict the phenotype of sample based on sequence variations.
Apart from above-mentioned phenotype-specific gene marker panel, other inde-
pendent gene markers are also used for objective-oriented studies or investigations.
HLA typing is one of such popular single gene marker-based approaches to identify
an individual Huchard et al. (2006). Another common target genomic region for such
investigation is microsatellite markers which are highly unstable and accumulate
high numbers of mutations, hence can be used for individualization. Moreover, if the
target individual is a carrier of genetic disease, then disease-specific gene markers
can also be used for the same purpose, but resolution of such gene marker may be of
low confidence as frequency of disease-causing mutations might be highly similar in
the population Glazier et al. (2002), Buetow et al. (1999), Liu et al. (1998).

21.4 SNP Techniques

21.4.1 Assessment of Mismatches and Fragmentation Patterns

to Find SNPs in the Target DNA Sequence

Variation at single nucleotide results in development of mismatch in the DNA

molecule and their presence can be identified with chemical modification. Moreover,
their positions can also be identified using chemical cleavage followed by electro-
phoresis. Usually, target sequence is amplified using polymerase chain reaction
(PCR) prior to SNP detection techniques.

21.4.1.1 Oxidative Modifications of DNA Mismatches Can Be Detected

Via Differential Optical Absorbance
Treatment of potassium permanganate (pink in colour) oxidizes mismatches in
hetroduplex DNA and generates hypomanganate diester (yellow in colour) with
release of manganese dioxide. Formation of hypomanganate diester can be detected
by the absorbance profile at 420 nm wavelength using standard UV/vis spectropho-
tometer. Presence of absorbance change due to above oxidation reaction confirms
the presence of single or multiple SNPs in the target sequence. As potassium
permanganate modifies mismatched thymine nucleotide, further sequence validation
is suggested to identify other types of SNPs Hayatsu et al. (1991).

21.4.1.2 Chemical Cleavage of Mismatch (CCM) Can Fragment DNA

at the Mismatch Site and Its Position Can Be Identified Using
Electrophoresis
Chemical cleavage of mismatch (CCM) uses two-step process to first tag
mismatches in the target sequence, and second cleave it at the position of the tag.
Chemical modification as a tag is carried out by hydroxylamine, and potassium
permanganate for cytosine, and thymine mismatches, respectively, before cleavage
by the piperidine at the same sites. Lastly, cleaved fragments are separated on
21 Single Nucleotide Polymorphism as Evolutionary Evidence of Individuality 291

electrophoresis gel to identify the position of the SNPs in the target DNA
sequence Cotton et al. (1988).

21.4.1.3 SNPs in the Restriction Sites of Endonucleases Can Be Detected

Using the PCR–Restriction Fragment Length Polymorphism
(RFLP)
Another convenient and cost-effective method to detect SNPs is the use of selective
endonucleases for the identification of unique presence or absence of restriction sites
resulting from nucleotide variations. Target sequence is searched for the reference
distribution of the restriction sites to select correct endonucleases using tools such as
SNP cutter. Next, target DNA sequence is amplified using PCR and digested with
the selected endonucleases. Lastly, resulting DNA fragments patterns are compared
between reference sequence and target sequence to identify the SNP
distribution Ota et al. (2007).

21.4.2 Detection and Screening of SNPs in Target Sequence Using

Sequence-Dependent Denaturation Profile

Sequence-specific denaturation property of DNA can be used to separate nucleotide

variation-bearing sequences from the reference sequences, as denatured DNA
molecules move slowly than intact DNA molecules in the gel electrophoresis. In
this chapter we will discuss different techniques to utilize DNA’s physical properties
such as size, electrical charge, and denaturation rate for the detection of SNPs.

21.4.2.1 Denaturing Gradient Gel Electrophoresis (DGGE) Can

Distinguish Between Different DNA Denaturation Rates
Resulting from the Presence of SNPs Using Chemical Gradient
Denaturation property of DNA sequence depends upon its GC content and can be
utilized to separate DNA sequences with varying melting characteristics using
DGGE (Fig. 21.1) Myers et al. (1987), Tully et al. (2000). Higher resolution of
DNA separation results from partial denaturation of the sequence. Therefore, DGGE
usually function better with higher density of nucleotide variation, whereas addition
of GC-clamp (40 bp GC rich sequence) may improve the separation of sequences
with single nucleotide variation Sheffield et al. (1989), Fischer & Lerman (1983),
Theophilus et al. (1989). In silico-simulated standardization of DGGE with or
without GC-clamp to detect SNPs is advisable using BIO-RAD’s DNA melting
profile analysis software called WinMelt for windows, and MacMelt for mac-based
computers. To obtain higher resolution via the GC-clamp requires prior knowledge
of sequence for the primer designing. These primers with GC-clamp are used to
amplify targeted sequence using polymerase chain reaction (PCR) before running on
DGGE.
292 S. Misra et al.

Low GC content

C
h
e
m
i
c
a
l

G
r
a
d
i
High GC content
e
n
t

Fig. 21.1 Acrylamide gel created with denaturing agents such as urea and formamide

21.4.2.2 Temporal Temperature Gradient Electrophoresis (TTGE)

Utilizes Differential Denaturation Property of SNP Bearing
Sequence Via Gradual Temperature Increase for the Detection
Next electrophoretic technique to detect sequences with nucleotide variation and
varying denaturation property is TTGE. This method can be used to discover SNPs
in nDNA and mtDNA. Because this protocol doesn’t use chemical denaturation
gradient, it has higher reproducibility than DGGE, specifically for mtDNA Chen
et al. (1999). As this method can also separate heteroplasmic mtDNA, it has been
considered suitable method to detect mutations in mtDNA Ito et al. (2001), Wong
et al. (2004). Target sequence must be amplified before loading on TTGE, and use of
GC-clamp can further improve resolution of separation as it prevents complete
denaturation of the sequence (Fig. 21.2). TTGE standardization can be simulated
using WinMelt/MacMelt as described before to reduce the experimental cost.
21 Single Nucleotide Polymorphism as Evolutionary Evidence of Individuality 293

T
e
Low GC content m
p
e
r
a
t
u
r
e

G
r
a
High GC content d
i
e
n
t

Fig. 21.2 Electrophoresis setup that gradually increase the temperature

21.4.2.3 Zn2+–Cyclen-Based Charge Reduction and Conformation

Change at Thymine Sites in DNA Can Be Used to Identify SNPs
Using Polyacrylamide Gel Electrophoresis (PAGE) System
Zn2+–1,4,7,10-tetraazacyclododecane (Zn2+–cyclen) have property to reversibly
bind with thymine (dT-) bases in DNA sequence and change its conformation and
charge at ph 8.0. Binding of Zn2+–cyclen with dT breaks the hydrogen bond between
Adenine and Thymine and reduce the melting temperature of the DNA
sequence Kikuta et al. (1999), Kukita et al. (2002), Kinoshita et al. (2009),
Kinoshita-Kukita (2002), Shionoya & Shirot (1993). Use of these Zn2+–cyclen
with PAGE and heteroduplex PCR amplification separates DNA sequences in
maximum of four bands which may be further sequenced to identify the SNPs.
294 S. Misra et al.

Fig. 21.3 Fluorescence Quenching Exhibited by Probes/Primers

21.4.3 Probes and Primer-Based Approaches to Identify SNPs

in the Target Sequence

Based on the reference sequence, probes and primers can be designed to detect and
amplify specific sequence from the sample. These probes can be designed with dye
or fluorescent tags to flag the presence of sequences with SNPs Gao et al. (2019). In
case of primers, it can have chemical modification that can change the migration
pattern of the DNA molecules with SNPs on the electrophoresis gel or it can have
specific nucleotide substitutions to selectively amplify with matching nucleotide
variation (Fig. 21.3).

21.4.3.1 Single Strand Conformation Polymorphism (SSCP) Can Be

Detected by Amplification of SNPs Containing DNA Sequences
Prior to Their Fluorescent Tagging and Separation by Capillary
Gel Electrophoresis
Precise identification of SNPs and indel mutations can be verified by post-labelling
PCR product. Post-labelling reduces PCR error of added 3’-end labelled nucleotides.
SNP positions can be detected by running the sample through automated capillary
electrophoresis setup van Oorschot & Ballantyne (2013). In case of pooled DNA
restricted to equal parts DNA contributions, results can be obtained by mapping
allele frequencies in pooled and reference samples Kukita et al. (1997), Kukita et al.
(2002), Higasa et al. (2002), Orita et al. (1989a, b).

21.4.3.2 Formation of Hybridized Probes Using Excimers for Detection

of SNPs in Bacterial Strain
Excimers, herein Pyrene derivatives, emit fluorescence and act as probes for detec-
tion of single nucleotide variations. Fluorescence is emitted in the range of 500–-
510 nm Paris et al. (1998), Yamana et al. (2002), Schü et al. (2018). The technique
can also be utilized for studying genetic mutations.
21 Single Nucleotide Polymorphism as Evolutionary Evidence of Individuality 295

21.4.3.3 Molecular Beacons in Association with TAG SNPs for Detection

of Single Nucleotide Variation
Molecular beacons are highly selective stem-loop structures working as probes for
SNP detection Lohrer & Tangen (2000). Ends of the stem are bound with a
fluorescent tag and a quencher (Fig. 21.3) Varona & Anderson (2019). The apparatus
helps in determination of the specific nucleotide substitution sites. Upon adhesion to
the site of substitution, fluorescence is emitted confirming presence of polymor-
phism Tyagi & Kramer (1996). Nucleotide substitutions are less variable for
populations in close contact. These substitutions can be termed as TAG SNPs.
They provide a picture of the genetic diversity within a region. High-throughput
techniques allow detection of several Tag SNPs simultaneously.

21.4.3.4 5′ -Nuclease Allelic Discrimination Probe-Based Assay for SNP

Detection Through Use of Forward and Reverse Primers
The TaqMan method for SNP detection is probe-based. Fluorescently labelled
probes are incorporated within the forward and reverse primers targeting the test
sequence during the PCR reaction. Opposed to molecular beacons, they are a string
with at 5’ end and a quencher at the 3’end. Detection of homozygosity or heterozy-
gosity is based on the intensity of the colour of fluorescence emitted. Presence of
SNP is verified by unbinding of primer sequences due to nucleotide polymorphism.

21.4.4 Sequence Analysis to Accurately Detect SNPs in the Target

Sequence

Technical advancement of nucleotide sequencing allowed to detect new SNPs

accurately and efficiently. Development of modern panel-based amplification of
multiple phenotype-specific gene markers and advanced bioinformatics tools with
rich database are identifying individuals by accurately generating high-resolution
phenotypic features and deciphering long lost migration histories Tillmar et al.
(2021), Dario et al. 2011.

21.4.4.1 Sanger Sequencing Is Considered a “Gold Standard”

to Accurately Detect SNPs in Targeted and Limited Numbers
of Sequences
Frederick Sanger used dideoxynucleotides substituting normal deoxynucleoties
which can inhibit the DNA replication and produce truncated DNA fragments
from the site of incorporation Sanger et al. (1977). Length of these fragments
suggests the position of respective nucleotide in the DNA sequence and assembling
of all the possible fragments provide complete sequence of the target DNA molecule.
Later on, above-mentioned technique was automated by Applied Biosystems, Inc.
(ABI) with addition of fluorescent nucleotides (Inazuka et al. (1996)) and used to
sequence the first human genome which was published in 2003 Lander et al. (2001).
Moreover, this Sanger sequencing has been known as “gold standard” method to
296 S. Misra et al.

Fig. 21.4 NGS work flow

study SNPs. Limitation of Sanger sequencing is that it is low throughput, as it can

only sequence 96-384 sequences per run.
Sanger sequencer generates nucleotide sequence in fasta format and its quality
assessment can be done from its chromatogram. This sequence represents an indi-
vidual sample and can be compared with reference sequence representing the
comparison point to identify SNPs. For the comparison, query sequence is aligned
on the reference sequence using sequence alignment tools such as MEGA, JalView,
and SeqMan Pro to name a few.

21.4.4.2 Next-Generation Sequencing (NGS) Is High-Throughput

Technique to Identify SNPs in longer and Many Numbers
of Sequences
There are several platforms developed as the advancement of Sanger sequencing and
all of these platforms uses their respective nucleotide detection method to sequence
21 Single Nucleotide Polymorphism as Evolutionary Evidence of Individuality 297

fastq file
Sequence identifier @SIM : 1 : FCX : 1 : 15 : 6329 : 1045 1 : N : 0 : 2
The sequence TCGCACTCAACGCCCTGCATATGACAAGACAGAATC
Separator +
The base call quality scores < >; ##=> < 9 = AAAAAAAAAA9# : < # < ; < < < ? ? ? ? # =

Fig. 21.5 Organization of raw NGS fastq file format

targeted sample (Fig. 21.4) Margulies et al. (2005). Illumina is widely used NGS
platform which can sequence more than 150 bp long DNA fragments and consider-
ably high sequencing depth with respectively low error rates. It uses sequencing by
synthesis (SBS) technology to detect nucleotide sequence. Apart from illumina,
other platforms also exist such as Ion torrent, nanopore, PacBio, etc. with their
respective advantages and limitations. Selection of NGS platform and the sequenc-
ing workflow should be according to the objective of the study Ratan et al. (2013).
For instance, if project expects to sequence complete gene sequence longer than 1 kb
than long read sequencers such as nanopore, or PacBio should be selected, whereas
if sequencing speed and the cost is the limiting factor then Ion torrent platform
should be preferred. Next, shotgun sequencing can be used to explore an unknown
nucleotide sequence to establish a reference data to compare with re-sequenced
nucleotide sequences from the population either via shotgun or amplicon sequencing
to identify SNPs. These newly produced reference sequences can be collected in
public databases such as HapMap, dbSNP Entrez, and National Center for Biotech-
nology Information (NCBI) for easy distribution and access by larger scientific
community Kruglyak & Nickerson (2001), International HapMap Consortium
(2003), Sachidanandam et al. (2001).
Raw reads in fastq format produced from NGS platform contain sequence with
quality scores (Fig. 21.5), which can be further used for SNP detection by process
called the variance calling. In variance calling, raw reads coming from the query
sample are aligned with the reference sequence using reference mapping tools such
as bowtie2 to generate alignment file called Sequence Alignment Map (SAM) or
Binary Alignment Map (BAM) before identifying SNP distribution by generating
Variance Call File (VCF).

21.5 Use of Cases for Human SNP Profiling

SNPs provide information of individualization and their geographical residence.

They are results of evolution and migratory patterns. Studying SNPs provide
information as to the geographical abundance of a haplotype within a
population Belmont et al. (2005), Oldoni et al. (2019). Migratory patterns can be
established with certainty for human cases in presence of reference nucleotide
298 S. Misra et al.

sequences Bas Yavaser et al. (2021). Majority of SNP profiles are generated in cases
of disputes as to confirm the absence or presence of the polymorphic characters for
individualization Bardan (2019).

21.5.1 April M. Tinsley Case

April Tinsley (8 years old), Fort Wayne, Indiana, was the victim of sexual assault
and murder in April, 1988. The body was found few days after the incident. DNA
evidence of suspected perpetrator was obtained from the clothing of the victim. After
a few days of discovery, writing on a nearby barn confessing the murder by the
perpetrator was found with another threat to kill. Law enforcement agencies working
on the case were unable to identify potential suspects. After many rounds of
questioning of potential suspects based on suspect lists of identical crimes, no
match was found. Within this time, more letters of confession and threat from the
perpetrator were received by the law enforcement agencies along with evidence
containing semen sample of the perpetrator which when compared with the sample
found on the victim’s clothing provided with an accurate match. The case remained
unsolved for a long time period as there was no suspect that matched with the profile
generated by the Law enforcement agencies. In the mid-2018, the case was reopened
as the lead genealogist CeCe Moore of a reputed lab found ancestral data proving
relevant to the case. Phenotypic profiles of probable suspects were created based on
the reference SNP profile of DNA sample collected by the Law enforcement
agencies during investigation. From the suspect list, based upon probability and
life expectancy, two matches living in close vicinity from the scene of crime were
detected. Surveillance was carried out for each suspect and their DNA samples were
collected from trash samples and were matched with the reference standard. One
sample (John Miller) was found to be matching and the suspect was called upon for
questioning. Upon questioning, he admitted to the crimes committed against April
Tinsley and was found guilty and sentenced to 80 years in prison for his
crimes Armentrout (2019).

21.5.2 Population Mixture and Human Migration of China

Ancient genomes can be sampled from the mortal remains of humans found from
different geographical locations which further can be compared with modern
genomes from related geographical location to track down the migratory path of
humans through spatiotemporal landscape. Robust database- (>629433 SNP sites)
backed ADMIXTOOLS is applied to infer migratory patterns on the data generated
from similar experiment setup described above. In this study, authors have
deciphered the hazy genetic history of Yellow and West Liao River-associated
human society. They suggested the probable migration of Yellow River-associated
humans to modern day southern and southeast Chinese population following the
movement of humans to yellow river from West Liao River. They also discussed the
21 Single Nucleotide Polymorphism as Evolutionary Evidence of Individuality 299

possible need for such migration to be likeness towards farming and accessibility to
developed economies Ning et al. (2020).

21.6 Conclusion

SNPs act as unique tags in identification of individuals. Evolution and adaptation of

the different species within varied environments provide them with their unique
identification tags. Analysis of these polymorphic characters via the different
techniques gives an exact overview of their genetic composition. The data generated
from the analysis are raw and upon processing have numerous clinical and
non-clinical applications.
Currently, human identification and individualization through the use of SNPs
has gained importance in the field of forensic science. Forensic DNA Phenotyping
(FDP) based on Externally Visible Characteristics (EVC) has opened new horizons
for law enforcement agencies allowing them to generate possible suspect profiles
based on the trace amounts of DNA evidence obtained from the scene of crime.
Single nucleotide variations have enabled the investigating agencies to narrow down
suspect list considerably as the SNPs provide adequate data for phylogenetic
analysis.
Further, research within the subject has great potential not only with respect to
criminalistics, but also within areas of clinical researches like oncological and
migratory studies, etc. Generation of SNPs databases and construction of SNP
Tags will offer a helping hand to researchers and law enforcement agencies looking
forward for research and analysis.

Multiple Choice Questions

1. What is responsible for accumulation of SNPs in nucleotide sequence?

(a) Transcription.
(b) Mutation.
(c) Translation.
(d) Post-translation modification.
Answers: (b)
2. SNP produces.
(a) Mismatch.
(b) Difference in melting temperature.
(c) Sequence variation.
(d) All of the above.
Answers: (d)
3. SNP may result in.
(a) Phenotypic variation.
(b) Disease condition.
(c) Both of above.
(d) None of above.
300 S. Misra et al.

Answers: (c)
4. Who solved the cold case of April M. Tinsley using SNP profiling.
(a) Sir Francis Galton.
(b) CeCe Moore.
(c) Sir Alec Jeffery.
(d) Dr. Edmond Locard.
Answers: (b)
5. Which tool can be used to detect migration pattern from SNP profile.
(a) ADMIX tools.
(b) Alignment tools.
(c) Phylogenetic tools.
(d) All of above.
Answers: (a)

References
Allio R, Donega S, Galtier N, Nabholz B (2017) Large variation in the ratio of mitochondrial to
nuclear mutation rate across animals: implications for genetic diversity and the use of mito-
chondrial DNA as a molecular marker. Mol Biol Evol 34:2762–2772
Armentrout S. Using SNP genotyping to solve crimes: the cold case of April Tinsley warning: this
presentation contains graphic sexual content. 2019
Arshad M, Bhatti A, John P (2018) Identification and in silico analysis of functional SNPs of human
TAGAP protein: a comprehensive study. PLoS One 13:1–13
Bardan F. New forensic DNA profiling techniques for human identification. 2019
Barreiro LB, Laval G, Quach H, Patin E, Quintana-Murci L (2008) Natural selection has driven
population differentiation in modern humans. Nat Genet 40:340–345
Bas Yavaser G, Hulya Yukseloglu E, Cavus Yonar F, Erkan I (2021) Assessment of 13 single
nucleotide polymorphisms loci for identification in forensic sciences for Turkish population. Int
J Biol Chem 14:56–63
Belmont JW, Boudreau A, Leal SM, Hardenbol P, Pasternak S, Wheeler DA et al (2005) A
haplotype map of the human genome. Nature 437:1299–1320
Bogenhagen D, Clayton DA (1974) The number of mitochondrial deoxyribonucleic acid genomes
in mouse L and human HeLa cells. Quantitative isolation of mitochondrial deoxyribonucleic
acid. J Biol Chem 249:7991–7995
Breslin K, Wills B, Ralf A, Ventayol Garcia M, Kukla-Bartoszek M, Pospiech E et al (2019)
HIrisPlex-S system for eye, hair, and skin color prediction from DNA: massively parallel
sequencing solutions for two common forensically used platforms. Forensic Sci Int Genet 43:
102152
Brookes AJ (1999) The essence of SNPs. Gene 234:177–186
Buetow KH, Edmonson MN, Cassidy AB (1999) Reliable identification of large numbers of
candidate SNPs from public EST data. Nat Genet 21:323–325
Cargill M, Altshuler D, Ireland J, Sklar P, Ardlie K, Patil N et al (1999) Characterization of single-
nucleotide polymorphisms in coding regions of human genes [published erratum appears in Nat
Genet 1999 Nov;23(3):373]. Nat Genet 22:231–238
Chen TJ, Boles RG, Wong LJ (1999) Detection of mitochondrial DNA mutations by temporal
temperature gradient gel electrophoresis. Clin Chem 45:1162–1167
Cotton RG, Rodrigues NR, Campbell RD (1988) Reactivity of cytosine and thymine in single-base-
pair mismatches with hydroxylamine and osmium tetroxide and its application to the study of
mutations. Proc Natl Acad Sci U S A 85:4397–4401
21 Single Nucleotide Polymorphism as Evolutionary Evidence of Individuality 301

Dario P, Ribeiro T, Dias D, Corte-Real F, Geada H (2011) Complex casework using single
nucleotide polymorphisms. Forensic Sci Int Genet Suppl Ser 3:379–380
Darwin C (1859) On the origin of species by means of natural selection, or preservation of favoured
races in the struggle for life. John Murray, London; 1809-1882
Fiatal S, Ádány R (2018) Application of single-nucleotide polymorphism-related risk estimates in
identification of increased genetic susceptibility to cardiovascular diseases: a literature review.
Front Public Heal 5:5
Fischer SG, Lerman LS (1983) DNA fragments differing by single base-pair substitutions are
separated in denaturing gradient gels: correspondence with melting theory. Proc Natl Acad Sci
U S A 80:1579–1583
Gao Y, He Z, He X, Zhang H, Weng J, Yang X et al (2019) Dual-color emissive AIEgen for specific
and label-free double-stranded DNA recognition and single-nucleotide polymorphisms detec-
tion. J Am Chem Soc 141:20097–20106
Glazier AM, Nadeau JH, Aitman TJ (2002) Genetics: finding genes that underline complex traits.
Science 298(80):2345–2349
Gunter LE, Kochert G, Giannasi DE (1994) Phylogenetic relationships of the Juglandaceae. Plant
Syst Evol 192:11–29
Hayatsu H, Atsumi G, Nawamura T, Kanamitsu S, Negishi K, Maeda M (1991) Permanganate
oxidation of nucleic acid components: a reinvestigation. Nucleic Acids Symp Ser 25:77–78
Higasa K, Kukita Y, Baba S, Hayashi K (2002) Software for machine-independent quantitative
interpretation of SSCP in capillary array electrophoresis (QUISCA). BioTechniques 33:1342–
1348
Hillier LDW, Marth GT, Quinlan AR, Dooling D, Fewell G, Barnett D et al (2008) Whole-genome
sequencing and variant discovery in C. elegans. Nat Methods 5:183–188
Huchard E, Cowlishaw G, Raymond M, Weill M, Knapp LA (2006) Molecular study of Mhc-DRB
in wild chacma baboons reveals high variability and evidence for trans-species inheritance.
Immunogenetics 58:805–816
Inazuka M, Tahira T, Hayashi K (1996) One-tube post-PCR fluorescent labeling of DNA
fragments. Genome Res 6:551–557
International HapMap Consortium. International HapMap consortium. The International HapMap
Project Nature 2003; 426: 789–796
Ito M, Tran Le S, Chaudhari D, Higashimoto T, Maslim A, Boles RG (2001) Screening for
mitochondrial DNA heteroplasmy in children at risk for mitochondrial disease. Mitochondrion
1:269–278
Kikuta E, Murata M, Katsube N, Koike T, Kimura E (1999) Novel recognition of thymine base in
double-stranded DNA by zinc(II)- macrocyclic tetraamine complexes appended with aromatic
groups. J Am Chem Soc 121:5426–5436
Kikuta E, Aoki S, Kimura E (2002) New potent agents binding to a poly(dT) sequence in double-
stranded DNA: Bis(Zn2+-cyclen) and tris(Zn2+-cyclen) complexes. J Biol Inorg Chem 7:
473–482
Kinoshita E, Kinoshita E, Koike T. Chapter 10 Zn (II)– Cyclen polyacrylamide gel electrophoresis
for SNP. 2009
Kinoshita-Kikuta E, Kinoshita E, Koike T (2002) Erratum: a novel procedure for simple and
efficient genotyping of single nucleotide polymorphisms by using the Zn2+-cyclen complex
(nucleic acids research (2002) vol. 30 (e126)). Nucleic Acids Res 30:5593
Kruglyak L, Nickerson DA (2001) Variation is the spice of life. Nat Genet 27:234–236
Kukita Y, Tahira T, Sommer SS, Hayashi K (1997) SSCP analysis of long DNA fragments in low
pH gel. Hum Mutat 10:400–407
Kukita Y, Higasa K, Baba S, Nakamura M, Manago S, Suzuki A et al (2002) A single-strand
conformation polymorphism method for the large-scale analysis of mutations/polymorphisms
using capillary electrophoresis. Electrophoresis 23:2259–2266
302 S. Misra et al.

Lander ES, Linton LM, Birren B, Nusbaum C, Zody MC, Baldwin J et al (2001) Erratum: initial
sequencing and analysis of the human genome: international human genome sequencing
consortium (nature (2001) 409 (860-921)). Nature 412:565–566
Liu W, Smith DI, Rechtzigel KJ, Thibodeau SN, James CD (1998) Denaturing high performance
liquid chromatography (DHPLC) used in the detection of germline and somatic mutations.
Nucleic Acids Res 26:1396–1400
Lohrer HD, Tangen U (2000) Investigations into the molecular effects of single nucleotide
polymorphism. Pathobiology 68:283–290
Margulies M, Egholm M, Altman WE, Attiya S, Bader JS, Bemben LA et al (2005) Genome
sequencing in microfabricated high-density picolitre reactors. Nature 437:376–380
Marth GT, Korf I, Yandell MD, Yeh RT, Gu Z, Zakeri H et al (1999) A general approach to single-
nucleotide polymorphism discovery. Nat Genet 23:452–456
Morin PA, Luikart G, Wayne RK (2004) SNPs in ecology, evolution and conservation. Trends Ecol
Evol 19:208–216
Myers RM, Maniatis T, Lerman LS (1987) Detection and localization of single base changes by
denaturing gradient gel electrophoresis. Methods Enzymol 155:501–527
Ning C, Li T, Wang K, Zhang F, Li T, Wu X et al (2020) Ancient genomes from Northern China
suggest links between subsistence changes and human migration. Nat Commun 11:1–9
Oldoni F, Kidd KK, Podini D (2019) Microhaplotypes in forensic genetics. Forensic Sci Int Genet
38:54–69
Orita M, Iwahana H, Kanazawa H, Hayashi K, Sekiya T (1989a) Detection of polymorphisms of
human DNA by gel electrophoresis as single-strand conformation polymorphisms. Proc Natl
Acad Sci U S A 86:2766–2770
Orita M, Suzuki Y, Sekiya T, Hayashi K (1989b) Rapid and sensitive detection of point mutations
and DNA polymorphisms using the polymerase chain reaction. Genomics 5:874–879
Ota M, Fukushima H, Kulski JK, Inoko H (2007) Single nucleotide polymorphism detection by
polymerase chain reaction-restriction fragment length polymorphism. Nat Protoc 2:2857–2864
Paris PL, Langenhan JM, Kool ET (1998) Probing DNA sequences in solution with a monomer-
excimer fluorescence color change. Nucleic Acids Res 26:3789–3793
Ratan A, Miller W, Guillory J, Stinson J, Seshagiri S, Schuster SC (2013) Comparison of
sequencing platforms for single nucleotide variant calls in a human sample. PLoS One 8:1–10
Robert F, Pelletier J (2018) Exploring the impact of single-nucleotide polymorphisms on transla-
tion. Front Genet 9:1–11
Sachidanandam R, Weissman D, Schmidt SC, Kakol JM, Stein LD, Marth G et al (2001) A map of
human genome sequence variation containing 1.42 million single nucleotide polymorphisms.
Nature 409:928–933
Sanger F, Nicklen S, Coulson AR (1977) DNA sequencing with chain-terminating inhibitors. Proc
Natl Acad Sci U S A 74:5463–5467
Schürch AC, Arredondo-Alonso S, Willems RJL, Goering RV (2018) Whole genome sequencing
options for bacterial strain typing and epidemiologic analysis based on single nucleotide
polymorphism versus gene-by-gene–based approaches. Clin Microbiol Infect 24:350–354
Sham P, Bader JS, Craig I, O’Donovan M, Owen M (2002) DNA pooling: a tool for large-scale
association studies. Nat Rev Genet 3:862–871
Sheffield VC, Cox DR, Lerman LS, Myers RM (1989) Attachment of a 40-base-pair G + C-rich
sequence (GC-clamp) to genomic DNA fragments by the polymerase chain reaction results in
improved detection of single-base changes. Proc Natl Acad Sci U S A 86:232–236
Shionoya M, Shirot M (1993) A New Ternary Zinc(II)Complex with [12]aneN4 (= 1, 4,
7, 10-tetraazacyclododecane) and AZT (= 3'-azido-3'-deoxythymidine). Highly selective rec-
ognition of thymidine and its related nucleosides by a zinc (II) macrocyclic tetraamine complex
with novel complementary associations. J Am Chem Soc 4:6730–6737
Theophilus BDM, Latham T, Grabowski GA, Smith FI (1989) Comparison of RNase a, a chemical
cleavage and GC-clamped denaturing gradient gel electrophoresis for the detection of mutations
in exon 9 of the human acid β-glucosidase gene. Nucleic Acids Res 17:7707–7722
21 Single Nucleotide Polymorphism as Evolutionary Evidence of Individuality 303

Tillmar A, Sturk-Andreaggi K, Daniels-Higginbotham J, Thomas JT, Marshall C (2021) The

FORCE panel: an all-in-one SNP marker set for confirming investigative genetic genealogy
leads and for general forensic applications. Genes (Basel) 12:12
Tully LA, Parsons TJ, Steighner RJ, Holland MM, Marino MA, Prenger VL (2000) A sensitive
denaturing gradient-gel electrophoresis assay reveals a high frequency of heteroplasmy in
hypervariable region 1 of the human mtDNA control region. Am J Hum Genet 67:432–443
Tyagi S, Kramer FR (1996) Molecular beacon probes that fluoresce on hybridiztion. Nature 14:
303–308
van Oorschot RAH, Ballantyne KN (2013) Capillary electrophoresis in forensic biology. In:
Encyclopedia of forensic sciences: second edition, 2nd edn. Elsevier Ltd, London
Varona M, Anderson JL (2019) Visual detection of single-nucleotide polymorphisms using molec-
ular beacon loop-mediated isothermal amplification with centrifuge-free DNA extraction. Anal
Chem 91:6991–6995
Wong L-JC, Chen T-J, Tan D-J (2004) Detection of mitochondrial DNA mutations using temporal
temperature gradient gel electrophoresis. Electrophoresis 25:2602–2610
Yamana K, Iwai T, Ohtani Y, Sato S, Nakamura M, Nakano H (2002) Bis-pyrene-labeled
oligonucleotides: sequence specificity of excimer and monomer fluorescence changes upon
hybridization with DNA. Bioconjug Chem 13:1266–1273
Insect DNA Testing
22
Moumita Sinha, Arjun Rao Isukapatla, Prashant Kumar,
Paromita Banerjee, and Neelam Ahirwar

Abstract

Insects are one of the most diverse and abundant groups of animals on Earth.
There are over a million known species of insects. Insects can be used as forensic
evidence in crime scene investigations. They can help determine the time and
location of death and the cause of death. Additionally, insect DNA can be used to
establish the time of death and the location of a crime scene. This could help
investigators narrow down the timeline of a crime or determine if a murder
occurred in a specific area. Insects may also be used to detect traces of drugs or
poisons at a crime scene. Insects could also be used in cases of mass disasters, to
help identify victims and determine the cause of death. Insects may not be the
most efficient or reliable way to obtain forensic evidence, but they could provide
valuable insight and help investigators solve crimes.

Keywords
Insects · Forensic · Identification · DNA · Postmortem

M. Sinha
Department of Forensic Science, Kalinga University, Raipur, Chhattisgarh, India
Department of Cardiology, AIIMS, Rishikesh, India
e-mail: [email protected]
A. R. Isukapatla
Department of Cardiology, AIIMS, Rishikesh, India
Faculty of Forensic Science, School of Life Sciences, Christ (Deemed to be University), Bengaluru,
Karnataka, India
e-mail: [email protected]
P. Kumar · P. Banerjee (✉) · N. Ahirwar
Department of Cardiology, AIIMS, Rishikesh, India
e-mail: [email protected]

# The Author(s), under exclusive license to Springer Nature Singapore Pte 305
Ltd. 2024
A. Puri et al. (eds.), Fundamentals of Forensic Biology,
https://doi.org/10.1007/978-981-99-3161-3_22
306 M. Sinha et al.

22.1 Introduction

Insects are any small, terrestrial arthropod (an invertebrate with an exoskeleton and
segmented body) that has six legs, three body sections (head, thorax, and abdomen),
and one pair of antennae. Insects can be found in almost every habitat on Earth, from
tropical rainforests to the coldest polar regions. There are over a million known
species of insects, making them the most diverse and abundant group of animals on
the planet.
Insects are one of the most diverse and abundant groups of animals on Earth.
They are found in nearly every habitat and can adapt to a wide variety of
environments. There are over a million known species of insects, and scientists
estimate that there may be as many as 30 million species that have yet to be
discovered. Insects can be divided into several types, including beetles, flies, bees
and wasps, ants, butterflies and moths, true bugs, grasshoppers, and crickets (Janzen
1976; May 1988).
Insects can be used as forensic evidence for detectives and scientists as they can
provide important information about a person’s time and place of death. Insects can
be found at a crime scene and can help determine the victim’s time of death. For
example, the presence of certain species of flies or beetles can indicate the time of
year or even the time of day of a death. Insects can also provide information about
the location of a crime scene, as different species of insects are found in different
climates and regions. The presence of insects can also indicate whether a body has
been moved, as different insect species will be attracted to different sites. Using
insects as evidence in a crime scene, investigation can help to provide valuable clues
and aid in the investigation process. They can help in crime scene investigations and
help to provide evidence that can be used in court. Insects are often used to determine
the time and location of death, as well as the cause of death. They can also be used to
determine the type of weapon used and the presence of drugs or poisons (Amendt
et al. 2004). Insects can also identify the presence of other materials such as fibers,
hair, and blood, which can help link suspects with a crime scene. In addition, the
presence of insects can provide valuable insight into the environment at the time of
the crime, which can be used to help reconstruct the events leading up to the crime.
Forensic entomology is the study of insects and their relationship to legal
determines the victim’s time of death leads to provide evidence in criminal cases
by studying the insects associated with a crime scene. This evidence can help
determine the time and place of death and reconstruct how a crime took place.
Forensic entomologists can also provide information about the presence of illicit
drugs or poisons in a victim’s body (LeBlanc and Logan 2010).
22 Insect DNA Testing 307

22.2 Insects of Forensic Importance

22.2.1 Necrophagous Insects

22.2.1.1 Blow Flies

These insects are often the first to arrive at a corpse and are important for determining
the time of death.
Blow flies are a type of fly that is typically known for their metallic blue or green
color. They are found on all continents except Antarctica and are especially preva-
lent in the summer months. Blow flies are usually found near garbage or decaying
animal matter, as they are attracted to the smell of it. They lay their eggs in or near
the decaying material, and their larvae feed on it. The larvae, also known as maggots,
can be used in forensic investigations to estimate the time of death of an animal or
person (Gary and Lance 2002).

22.2.2 Common Species of Blow Flies in Forensic Cases

The three most common species of blow flies used in forensic investigations are
Calliphora vicina, Calliphora vomitoria, and Lucilia sericata. These species of blow
flies typically lay their eggs on decaying material, such as carrion or corpses, making
them ideal for forensic investigations. They can provide information about the time
of death and other aspects of the crime scene. The eggs are easily identifiable and can
be used to identify the species of blowfly present. They can also be used to determine
the postmortem interval, or how long ago the death occurred (Fig. 22.1).

22.2.2.1 Carpet Beetles

These insects have been known to infest homes and are often used as evidence in
cases of arson and insurance fraud.
Carpet beetles are small insects that feed on carpets, fabrics, and other materials
found in homes. They can cause significant damage to furniture and clothing and are

Fig. 22.1 Blow Flies

308 M. Sinha et al.

considered a nuisance pest. Carpet beetles are round or oval in shape and vary in size
from 1/16 to 1/8 of an inch. They are usually black or brown in color, but can vary
from species to species. Some carpet beetles have colorful markings, such as
iridescent scales. Carpet beetles lay their eggs in dark, hidden areas, often near
fabrics or carpets. The larvae are typically yellow or white and covered in tiny hairs.
They feed on fabrics, carpets, and other materials and can cause significant damage if
left unchecked. Carpet beetles can be difficult to control, so it is important to identify
the source of the infestation and remove it. Chemical treatments may be necessary in
some cases.

22.2.3 Common Species of Carpet Beetles in Forensic Cases

The most common species of carpet beetles in forensic cases are the varied carpet
beetle (Anthrenus verbasci) and the black carpet beetle (Attagenus unicolor). The
varied carpet beetle feeds on animal products such as wool, fur, feathers, and animal
skins. The black carpet beetle feeds on plant material such as grains, cereals, and
other starchy items. Both of these species can infest homes, furniture, and carpets
and can be difficult to eradicate. In forensic cases, these species can be important
evidence for investigators as they can provide clues about the environment in which
the incident occurred (Fig. 22.2).

22.2.3.1 Flesh Flies

These insects are often used to determine the age of a corpse and can also be used to
help determine the cause of death.
Flesh flies are one of the few species of flies that can reproduce without mating.
Flesh flies are particularly attracted to rotting meat and are often found near
slaughterhouses, butcher shops, and other places where there is a lot of decaying
organic matter. Flesh flies are important pollinators of many plants and flowers.
Flesh flies are not known to transmit any human disease, although they can spread

Fig. 22.2 Carpet Beetles

22 Insect DNA Testing 309

the larvae of some parasites. Flesh flies are one of the few species that have been
observed to have parental care, in which the female guards her eggs until they hatch.
Flesh flies are also an important food source for many animals, including birds and
amphibians. Flesh flies are often used as model organisms for studying animal
behavior.

22.2.4 Common Species of Flesh Flies in Forensic Cases

Sarcophaga carnaria: This species is the largest and most common flesh fly in
forensic cases. It is mostly found in areas of high human activity, such as refuse
dumps, carcasses, and occasionally in homes.
Sarcophaga haemorrhoidalis: This species is typically found near human corpses
and is common in forensic cases.
Wohlfahrtia magnifica: This species is most commonly found near cadavers and
is also a common species in forensic cases.
Calliphora vomitoria: This species is found near dead animals, garbage, and
occasionally in homes. It is also a common species in forensic cases.
Calliphora vicina: This species is most commonly found in urban areas, in
garbage, and occasionally in homes. It is also a common species in forensic cases
(Fig. 22.3).

Fig. 22.3 Flesh Flies

310 M. Sinha et al.

22.2.5 Hematophagous Insects

22.2.5.1 Termites
These insects are important for determining whether a structure has been damaged
by water or other external forces.
Termites are small, winged insects that are found in most parts of the world. They
feed on wood and other materials that contain cellulose, such as paper and card-
board. Termites are considered pests because they can cause extensive damage to
buildings and furniture. They can also cause significant health issues since they can
spread diseases and allergens. To help prevent termite infestations, homeowners
should seal off any potential entry points, such as cracks in the foundation, and
inspect their property regularly for signs of termites (Gary and Lance 2002).

22.2.6 Common Species of Termites in Forensics Cases

• Eastern Subterranean Termites: These are the most common termites found in
forensic cases. They live in the soil and build mud tubes to travel to and from their
food sources.
• Formosan Subterranean Termites: Found primarily in the Southeastern United
States, this species is especially destructive, as they can cause significant damage
to homes and other structures.
• Drywood Termites: These termites are found in coastal areas and are able to
survive in dry wood.
• Dampwood Termites: These termites are usually found in damp wood and can
cause significant damage.
• Conehead Termites: These species is found mostly in Florida, and they can cause
damage to structures and trees (Fig. 22.4).

22.2.6.1 Sand Flies

Sand flies can be found in forensic cases, as they are attracted to human blood and
decomposing bodies. They can be found in areas where bodies have been dumped,
and they can also be found on corpses. Sand flies are also used to help determine time
of death, as the larvae can be used to study the rate of decomposition of a body.

Fig. 22.4 Termites

22 Insect DNA Testing 311

Fig. 22.5 Sand Flies

Additionally, sand flies can help identify the location of a crime scene since they feed
and breed in specific areas (Fig. 22.5).

22.2.6.2 Deer Flies

Deer flies have been used in forensic cases to help identify the presence of persons at
the scene of a crime. The presence of deer fly larvae in the clothing of a victim or
suspect can provide valuable evidence in criminal investigations. Deer fly larvae are
microscopic and can remain on clothing material for weeks or months after contact
with a person. For example, in cases involving homicides, investigators have used
deer fly larvae as evidence to determine when a victim was last alive or to show the
movement of a suspect. Deer fly larvae can also be used to trace the movement of a
suspect or victim in a particular area, as well as to provide evidence of the presence
of a particular individual at the scene of a crime (Gary and Lance 2002) (Fig. 22.6).

22.2.7 Common Methods Used in Forensic Entomology

22.2.7.1 Temperature Analysis

Temperature is one of the most important environmental factors influencing ento-
mological evidence in forensic cases. Temperature can affect the rate of insect
development, adult longevity, and insect species composition. Temperature can
also be used to estimate a body’s postmortem interval (PMI).

22.2.7.2 Insect Taxonomy

Taxonomic identification of insect specimens is an important part of forensic
entomology. Specimens can be identified to the family, genus, or species level.

22.2.7.3 Insect Colonization

The presence and abundance of insect species in a given area can be used to
determine the PMI of a body. Different species show up at different times after
death and can indicate the age of a corpse.
312 M. Sinha et al.

Fig. 22.6 Deer Fly

22.2.7.4 Maggot Morphology

The morphology of maggots can also be used to determine the PMI. Maggots of
different species can have different shapes and sizes and can be used to estimate the
age of a corpse.

22.2.7.5 Forensic Light Sources

Forensic light sources are used to detect evidence that may be invisible to the naked
eye, such as insects or insect parts. These light sources can range from simple
handheld devices to complex laboratory equipment.

22.2.8 Insect DNA for Human Identification in Forensic Cases

The use of insect DNA for human identification in forensic cases is a relatively new
and emerging field. Scientists have recently been able to use insect DNA to distin-
guish human remains, linking them to specific individuals. This can be done by
analyzing the DNA of an insect that has fed on the remains. Insects such as blowflies,
flesh flies, and other carrion-feeding insects are able to ingest human DNA and store
it in their gut for a period of time. By extracting and analyzing the insect DNA,
scientists can match it to the remains and thus identify the deceased. Insect DNA
identification methods are particularly useful for identifying remains that have been
exposed to the elements for a long period of time and are too decomposed or
damaged for other methods of identification such as fingerprints or dental records
to be used. Insect DNA can also be used to identify unidentified human remains,
22 Insect DNA Testing 313

helping to provide closure to families and law enforcement. Insect DNA identifica-
tion is still an emerging field and is currently limited in its accuracy and reliability, as
the insect DNA must be isolated from other sources of contamination and DNA from
the surrounding environment. As such, it is not yet a reliable method for human
identification and should be used in conjunction with other methods of identification
(Wells et al. 2008).

22.2.9 DNA-Based Approach Used for Insect DNA Testing in Human

Identification

One of the most common applications for insect evidence gathered during a death
investigation is calculating the postmortem interval (PMI). When based on the age of
a maggot (fly larva), this estimate can indicate the time since death. Because the age
of the larva is only relevant to PMI if all of the maggot’s development and feeding
occurred on the victim. This assumption is usually justified because the larva was
collected directly from or near a corpse that showed other signs of decomposition.
However, such a direct and certain association cannot always be made, and during
the course of any casework, a number of situations encountered in which an
alternative method of associating a maggot with a corpse would have been useful.

22.2.9.1 Polymerase Chain Reaction (PCR)

This method involves amplifying a specific section of DNA to produce multiple
copies of the target sequence, which can then be used for further analysis.
Polymerase chain reaction (PCR) is a powerful technique used to amplify small
amounts of DNA. It is a widely used tool in forensic science, as it can be used to
amplify even trace amounts of insect DNA found at a crime scene. This enables
investigators to narrow down the possible suspects by determining the species of
insect present. PCR can also be used to determine the age of an insect, as well as its
sex. In addition, PCR can be used to determine whether the insect was exposed to a
particular environmental factor, such as a chemical or pesticide. By amplifying the
insect DNA, it is possible to obtain enough material for further analysis, such as
DNA profiling.

22.2.9.2 Mitochondrial DNA Analysis in Insects and Humans

Insect mitochondrial DNA analysis can be used in forensic cases to help identify and
differentiate between different species of insects. By analyzing the mitochondrial
DNA of insects, researchers can determine the species, subspecies, and even age of
the insect. This can be used to help identify the insect species present at a crime
scene, allowing investigators to gain valuable insight into the crime or incident.
Additionally, insect mitochondrial DNA can be used to compare insect species
present at different crime scenes, helping to determine if a particular species of
insect was present at both locations. This can be used to help establish links between
different crimes, or to reconstruct the events that took place during a criminal act
(Wells et al. 2001).
314 M. Sinha et al.

In forensic cases, mitochondrial DNA analysis of insect gut can be used to

identify individuals or even species of insects. This method can help to determine
the origin of a particular insect, or determine the source of contamination in a
particular area. It can also be used to identify human remains that have been exposed
to insects, such as in cases involving outdoor crime scenes.
Analysis of mitochondrial DNA from insect gut can be used to identify
individuals or species of insects and to determine the age of an insect. This type of
analysis involves extracting DNA from the gut of an insect and then using polymer-
ase chain reaction (PCR) to amplify the mitochondrial DNA for further analysis.
Once the amplified DNA is sequenced, the sequences can be compared to known
sequences from other insects, or to a reference database. This can help to identify the
species of insect, as well as the geographic origin of the insect.
In addition to identifying the species of insect, analysis of mitochondrial DNA
from insect gut can also be used to identify human remains that have been exposed to
insects. This type of analysis involves extracting DNA from the gut of an insect and
then using PCR to amplify the mitochondrial DNA. The amplified DNA is then
compared to a reference database of human mitochondrial DNA sequences. If the
sequences match, then the insect can be used to identify a particular individual or
species (Samerjai et al. 2019).
Overall, analysis of mitochondrial DNA from insect gut can be a useful tool in
forensic cases. It can help to identify individuals or species of insects, as well as
human remains that have been exposed to insects.

22.2.9.3 Y-Chromosome Analysis

This method involves analyzing the DNA in the Y chromosome, which is passed
down from father to son. Human Y-DNA analysis from insect gut in forensic cases is
a relatively new method of DNA analysis that is being developed to help solve
crimes. This method involves extracting DNA from the gut of insects that have fed
on a human body, such as flies and beetles. The insects ingest human DNA as they
feed, and this can be used to identify the individual from whom the insect is fed. This
method has been used to identify victims of mass disasters, such as plane crashes, as
well as to identify an individual in a criminal case. While this method of analysis is
still in the early stages of development, it has the potential to provide an additional
source of information for forensic investigations (Luise et al. 2008).

22.2.9.4 Human STR Analysis from Insect Gut Materials

Short Tandem Repeats (STRs) are a type of genetic marker used to identify
individuals based on their DNA. STR analysis of human DNA from maggots fed
on decomposing bodies can be used to help identify the deceased individual by
comparing the STR profile of the maggot-derived DNA to the STR profile of the
potential victim. The STR analysis involves looking at the number of repeated
sequences of nucleotides present in the DNA, as well as the length of the repeats.
This information can be used to determine whether the maggot-derived DNA is a
match for the victim’s DNA and can be used to help identify the deceased individual
(Njau et al. 2016).
22 Insect DNA Testing 315

22.2.9.5 DNA Sequencing

This method involves analyzing the entire sequence of DNA in an organism, which
can then be used to identify the species. DNA sequencing techniques can be used to
analyze the gut DNA of insects. This involves extracting the DNA from the gut
tissue of the insect, amplifying the DNA using PCR and then sequencing the
amplified DNA. This can be used to identify the presence of specific genes or
sequences within the insect gut, as well as to identify particular species present in
the gut. This can help to understand the diet of the insect and to determine the
composition of the gut microbiota.
Also, DNA sequencing techniques are increasingly being used in insect gut DNA
analysis in forensics. Insects are often present at crime scenes and can provide
valuable evidence. By looking at the DNA in the gut of an insect, it is possible to
determine if the insect was in contact with a particular person, animal, or object. This
can help in identifying suspects and establishing links between different individuals
and items. DNA sequencing techniques are used to identify the insect species, as
well as to determine the presence of specific genetic markers. This can be used to
identify individuals and link them to a particular crime scene. Additionally, DNA
sequencing can be used to analyze the insect gut microbiome, which can provide
important clues about the environment and circumstances in which the crime took
place.

22.3 Conclusion

In forensic cases, insects can be used as vectors of DNA to aid in the identification of
victims or perpetrators. Insects are often found in and around crime scenes, as they
are attracted to the organic material present. Forensic entomologists can use these
insects to extract and analyze DNA from them such as mitochondrial DNA, which is
often used in forensic cases. The extracted DNA can then be compared to samples
from potential victims or suspects to aid in the identification process.
Further, insects can carry DNA from human remains to a laboratory, where the
DNA can be extracted and analyzed. This could help investigators quickly identify a
person’s identity or other important information about them. DNA can be used to
match individuals to a crime scene or to confirm a suspect’s identity. Additionally,
insect DNA can be used to establish the time of death and the location of a crime
scene. This could help investigators narrow down the timeline of a crime or
determine if a murder occurred in a specific area. Insects may also be used to detect
traces of drugs or poisons at a crime scene. Insects could also be used in cases of
mass disasters, to help identify victims and determine the cause of death. Insects may
not be the most efficient or reliable way to obtain forensic evidence, but they could
provide valuable insight and help investigators solve crimes.
316 M. Sinha et al.

References
Amendt J, Krettek R, Zehner R (2004) Forensic entomology. Naturwissenschaften 91:51–65
Gary M, Lance D (2002) Medical and veterinary entomology. Academic Press, London, pp 1–13;
ISBN 9780125104517
Janzen D (1976) Why are there so many species of insects? Proceedings of XV International
Congress of Entomology, Washington, DC, p 8494
LeBlanc HN, Logan JG (2010) Exploiting insect olfaction in forensic entomology. In: Amendt J,
Goff ML, Campobasso CP, Grassberger M (eds) Current concepts in forensic entomology.
Springer, Dordrecht, pp 205–221
Luise ED, Magni P, Staiti N, Spitaleri S, Romano C (2008) Genotyping of human nuclear DNA
recovered from the gut of fly larvae. Forensic Sci Int Genet Suppl Ser 1(1):591–592
May RM (1988) How many species are there on earth? Science 241:441–1449
Njau GD, Muge EK, Kinyanjui PW, COA O, Sophie M (2016) STR analysis of human DNA from
maggots fed on decomposing bodies: assessment of the time period for successful analysis.
Egyptian J For Sci 6(3):261–269
Samerjai C, Sukontason KL, Sontigun N, Sukontason K, Klong-Klaew T, Chareonviriyaphap T,
Kurahashi H, Klimpel S, Kochmann J, Saeung A, Somboon P, Wannasan A (2019) Mitochon-
drial DNA-based identification of forensically important flesh flies (Diptera: Sarcophagidae) in
Thailand. Insects 11(1):2
Wells JD, Introna F Jr, Di Vella G, Campobasso CP, Hayes J, Sperling FAH (2001) Human and
insect mitochondrial DNA analysis from maggots. J Forensic Sci 46(3):685–687
Wells JD, Stevens JR (2008) Application of DNA-based methods in forensic entomology. Annu
Rev Entomol 53:103–120
Animal DNA Testing
23
Tilak Ram Chandrakar and Ajay Biswas

Abstract

Animal DNA can play a key role in poaching, illegal trafficking, and crimes
involving animal products. DNA from nonhuman sources can be more prone to
DNA damage compared to human DNA. Animal DNA is often used in the field of
wildlife crime for their detection and identification. DNA profiling can be used to
identify animals. The Charge switch Technique and prep GEM Technique can be
used on insect specimens that have been preserved. The Puregene method,
DNAzol method, and DNeasy method can all be used to obtain DNA extract
from newly collected insects. Using the QiaQuick PCR purification kit, DNA
could be extracted from Copal. It is possible to analyze the DNA of Xylophagus
insects using the CTAB and modified CTAB-PVP methods. The extraction of
insect DNA within 24 h can now be accomplished using a new high molecular-
weight DNA extraction technique.

Keywords
Animal · DNA · Poaching · Wildlife · Crime · Nonhuman

T. R. Chandrakar (✉) · A. Biswas

Department of Forensic Science, Medi-Caps University, Indore, MP, India
e-mail: [email protected]; [email protected]

# The Author(s), under exclusive license to Springer Nature Singapore Pte 317
Ltd. 2024
A. Puri et al. (eds.), Fundamentals of Forensic Biology,
https://doi.org/10.1007/978-981-99-3161-3_23
318 T. R. Chandrakar and A. Biswas

23.1 Introduction

23.1.1 DNA Characteristics

Deoxyribonucleic acid (DNA) is often regarded as the preeminent biomolecule

present within cellular structures, and it create a compacted form within the
chromosomes of many living entities. Every eukaryote has two chromosomes,
which are linear DNA molecules (Pray 2008). The DNA for these chromosomes is
typically compacted into a denser form rather than existing frequently in a loose
state. Nucleosomes are bead-like structures made up of certain DNA-binding
proteins called histones. Because the DNA is kept coiled around these nucleosomes,
the length of the DNA string as a whole is reduced. The “beads-on-a-string”
configuration is then further wrapped into a configuration with a width of about
30 nm, which is appropriately referred to as the 30 nm fiber. This is how DNA is
created, and it lasts for the bulk of the lifespan of the cell (Travers and
Muskhelishvili 2015). DNA is also present in other nonhuman sources which
included the Plants, Bacteria’s, Fungi, Virus and many more. To decide how to
best proceed with its examination, the unique properties of DNA derived from
nonhuman sources must be taken into consideration. When compared to DNA
from a variety of other sources, DNA from one source can need a completely
different extraction or analysis technique from others merely based on the diverse
properties of nucleic acid present in a specific organism. The source of DNA could
be intra-organism having the genome ranges of 10–1 lakh Mb in length in which the
nuclear DNA analysis approach must be different for the Mitochondrial DNA
(mtDNA) to Nuclear DNA (nDNA) (Taanman and Kroon 2019). Thus, several
reports revel on properties of circular mtDNA and say it is more prone to DNA
damage compared to nDNA. The mtDNA molecules lack the histone protection that
sustained the DNA repair and are situated near the electron transport chain (ETC), which
continuously produces oxidizing by products known as reactive oxygen species (ROS).
As a result, in reaction to DNA-damaging chemicals, the mutation rate of mtDNA
has been found to be up to 15-fold higher than that of nDNA (Claus et al. 2011).

23.1.2 Animals DNA in Wildlife Crime

Wildlife crime is the unlawful seizing, trading, exploiting, possessing, or killing of

animals or plants in violation of local, state, federal, or international laws. Animals
play a crucial role in many people’s lives; therefore, it makes sense that their DNA
may have a big impact on the forensics field. Animals or animal products can play a
key role in a range of situations, including poaching, illegal trafficking, and crimes
involving animal products. Any DNA that could be extracted from the animal or
product in these cases would probably be able to considerably aid the investigation
because the animal or animal product is either the primary victim of the crime or is
particularly crucial to whatever that crime is. However, in other circumstances,
animals could still be involved in a situation that is largely unrelated. Animal
23 Animal DNA Testing 319

products, like hair or fur, can be used to connect a person to a place because of the
material’s special qualities (Butler 2023).

23.1.3 Poaching

Animal DNA is obviously often used in the field of wildlife crime for their detection
and identification. The crime related to poaching can be overcome while utilizing the
tool named as DNA profiling. Several cases are reported by various government and
nongovernment organizations about the cruelty against the wild animals for several
purposes around the world. The broadly affected animals are Tigers (Panthera
tigris), Elephants (Elephantidae), Rhinos (Rhinocerotidae), Bears (Ursidae),
Pangolins (Pholidota), Dear Species (Cervidae) etc. (Sahajpal et al. 2021). The
product obtained from the animal sources are been used as medicines that is
encouraged by Chinese traditional medicine, which solicitated the poachers’
activities. The DNA Profiling tool plays a crucial role to identify and minimize the
poaching issue of animals and can improve the conviction rate.

23.1.4 The Blocking of Illegal Trade Around the World Using

Molecular Techniques

Illegal trading or trafficking of animals is widely increased around the world.

Poachers targeted the easiest route to transport the animal remains in border areas
and by air routes. The case reported by Rodionov et al. (2021) explained the
poaching of western tur Capra caucasica, an endangered goat antelope native to
the Caucasus Mountains. The police authorities seized the samples and send it for
their analysis. The samples were analyzed using the genome-wide SNP genotyping
using DNA chips for species assignment and using the 14 STR (microsatellite)
genetic markers for confirming their identity. The avian species, specially the
Macau’s parrot bird, is threatened and illegally transported from Europeans countries
to others. Their eggs also found to be transported that is closely monitored for
suspected illegal trade (Coghlan et al. 2011). Another tool named as Mitochondrial
DNA (mtDNA) testing specially using the Cyt-B gene and Cytochrome C-Oxidase
genes helps to identify the origin of samples. The species of smuggled samples can
now be determined using sequencing technologies, allowing to fix the identity for
subsequent identification. The new rapid identification technology enables more
prompt enforcement of laws for prohibiting the trade in wildlife as well as criminal
prosecution of individuals responsible in poaching.

23.1.5 Fake Animal Product and Linking the Products

with Suspected

There are numerous case studies cited by certain agencies that show the fabrication
of animal products for financial gain; a report submitted by a Chinese police official
320 T. R. Chandrakar and A. Biswas

looking into 57 occurrences of alleged unlawful ivory trading that occurred since
2011. Only 513 of the 1714 items actually turned out to be synthetic, despite 27 of
them attempting to hide samples of real ivory by mixing them with imitation ivory
(Zhou 2014). According to Carvalho et al. (2015), the seafood industry also alters the
authentic seafood and sells fraudulent food, particularly fish, in numerous
restaurants. There have been numerous instances of fake animal products reported
throughout the world, but they can simply be prevented by using a promising
approach like the DNA barcoding technique. The linking evidence connects the
samples with the offenders, specially if suspect directly involves with animal
species. The sample that may be recovered are the shredded hair, fur, skin, and
dander as part of their natural growth cycles. The analysis of said samples can
provide a lead to investigate the wildlife crime in an appropriate direction.

23.1.6 Plants DNA and Its Forensic Application

Although plant DNA fingerprinting for forensic purposes is underdeveloped, it is an

essential and rapidly developing field that could provide valuable information. The
plant DNA is utilized in the cases about the illegal deforestation and harvesting of
important and protected plant species. In terms of an Indian continent, the plant
species are protected under the wildlife protection act 1972 and their unlawful
transportation violets the norms and becomes punishable offence (Sharma and raturi
2018). The identification of botanical material to a specific species may help with an
investigation and give significant evidence, depending on the crime. Such species-
assignment calls for the construction of a database of species-specific sequences at
one or more genetic loci, frequently on the chloroplast genome, as well as a
barcoding technique. As an alternative, botanical material may be matched to a
specific plant, clone, or population using DNA fingerprinting if the source species is
identified. Multilocus genotypes at highly variable loci, such as DNA
microsatellites, also known as simple sequence repeats (SSRs), short tandem repeats
(STRs), or variable number tandem repeats (VNTRs), could be used to do this. The
DNA database of sequence (DNA Barcodes) helps to build up the records of a
threatened and protected plant species that may be matched if any incidents or crime
comes in a light. Plant architecture and morphology can also be utilized to identify
the species from botanical evidence like stem, roots, leaves, or seeds. However,
identification only based on physical traits might be ambiguous or imprecise, which
requires a knowledgeable botanist having the huge experience in taxonomy infor-
mation, and the evidence must be largely undamaged. The minute evidence makes
the identification procedure more robust and difficult due to their shape, leaf
fragments, seeds, or pollen. The trace evidence like this may mislead the evidence
also if investigator is not aware with their properties and features. These evidences
are sometimes also found with the human or animal-related cases such as in
poisoning condition where a digested form of seed or leaves is also found into
their stomach that also makes the identification procedure more difficult. However,
DNA may be recovered from even the smallest plant pieces, and sequence
23 Animal DNA Testing 321

information gained from this material may be used to potentially use the evidence to
clearly identify the plant species and can be used to differentiate between the wild
protected species to non-protected and helps to provide a significant result to
minimize the crime related with the plant species.

23.1.7 Evidence Connections with the Suspect and Harmed Species

The value of plant samples as linking evidence in criminal cases has increased as a
result of advancements in research into plant DNA markers. Plant fragments includ-
ing pollen, seeds, and leaves may be discovered in close proximity to a suspect or
misplaced pieces of evidence. The suspect or the evidence can then be connected to
that specific crime scene via plant remains and DNA fingerprinting, which links the
plant material to the crime scene (Caccianiga et al. 2021).

23.1.8 Microbial DNA Testing; Prokaryotes and Their Genome

The genome of prokaryotes is made up of a single double-stranded DNA molecule

that is shaped like a loop or circle. A nucleoid is the area of the cell that houses this
genetic material. Additionally, some prokaryotes include tiny DNA loops called
plasmids that are not necessary for typical growth. These plasmids can be transferred
between bacteria, and occasionally the recipient bacteria receive advantageous
additional genes that they can add to their chromosomal DNA. One characteristic
that frequently spreads inside a bacterial colony via plasmid exchange is antibiotic
resistance. In comparison to prokaryotes, the genome of eukaryotes is made up of
several double-stranded linear DNA molecules organized into chromosomes. The
number of chromosomes in the cell nuclei varies depending on the kind of eukaryote
such as Human gametes (sperm or eggs); each has 23 paired chromosomes; some
animals have 37 paired chromosomes which vary according to each species. The
packaging of the prokaryotic genome is the primary difference which makes them
different from other organisms. The basal form of most prokaryotes is a single circle,
but by a process called supercoiling, the size is reduced. By changing the number of
turns in the double helix molecule, torsional stress is introduced to the entire
molecule. The molecule then turns and winds around itself to release this stress as
much as it can. Finally, this totally twisted molecule is joined to a nucleoid made of
proteins that concentrates the genome that controls the prokaryotic transcription
(Dorman and Dorman 2016). The bacterial genome’s content is distinct from the
eukaryotic genome that only 11% of the entire genome in prokaryotes is noncoding,
and their genomes are quite small in comparison to many multicellular and many
unicellular eukaryotes. In this queue the virus acts as an infectious microorganism
that is made up of a protein-coated segment of nucleic acid (either DNA or RNA). A
virus can’t multiply by itself; it has to infect cells in order to utilize the host cell’s
components to make copies of itself. The forensic investigation leads to reveal the
geographical identity of a prokaryotes organism and open up their sources for justice
purposes.
322 T. R. Chandrakar and A. Biswas

23.1.8.1 Viruses
Viruses are the tiniest microorganism found on earth. Virus is not widely considered
to be alive since they are found inside the host for their propagation of their lineage
through parasitism and are unable to survive outside of the host cells. Virus is
generally composed of the proteins and nucleic acids where few viruses also have
a lipid coating that contains glycoproteins. A virus’s DNA is held in a symmetrical
protein capsid, which makes up the virus’s structure. The region of the genome that
codes for these constituent proteins can be quite minimal due to the symmetric and
repetitive nature of the capsid. The double- or single-stranded DNA or RNA makes
up the nucleic acid inside the capsid. Most of the time, the host cell’s resources are
used to replicate this genome. The only contribution of the virus is the transfer of the
genome; all other requirements for energy, resources, and activities are met by
parasitizing the host cell. Additionally, viruses come in a wide variety of sizes and
shapes. Viruses can have a diameter of up to 400 nm and can take on a variety of
forms. Viral capsids specifically come in three distinct shapes: icosahedral, linear,
and complicated (Chaitanya 2019). Viruses can be divided into monopartite and
multipartite types as well. While multipartite viral genomes are divided into numer-
ous independent molecules, monopartite viral genomes have the entire genes inside
one single molecule.

23.1.8.2 Bacteria
Bacteria, viruses, and fungi are naturally present in the human body and can be
found in places including the vagina, skin, and gastrointestinal system. Due to their
astounding ubiquity, bacteria can be surprisingly valuable in forensic investigations.
In every living thing bacterium contains and plays an essential part of life. Some
bacteria are pathogenic, and as a result, they are frequently exploited as destructive
agents in bioterrorism. Still other bacteria are selective enough in their environment
to behave as distinguishing characteristics of particular organic molecules. Last but
not the least, the enormous diversity among bacterial groups enables distinct
communities of these organisms to be detected and potentially serve as fingerprint-
like indicators for a particular person. The earlier molecular methods that were used
for classifying the bacteria relied on factors including GC content, plasmid profiling,
and adaptability to genetic modification. Presently, nucleotide sequencing and
hybridization are two essential molecular applications that are widely used in the
detection and identification of bacteria. Methodologies used for the detection and
identification of microbes that are based on hybridization include the loop-mediated
isothermal amplification (LAMP), Southern, PCR, real-time PCR, microarray, and
universal tagging methods (Barghouthi 2011).

23.1.8.3 Fungi
The fungi (Mycota) are multicellular organisms having the mycelial structure that is
composed with the thin filaments or hyphae (2–10 m in diameter). The hyphae found
may be unbranched or branched, septate or nonseptate, and are frequently multinu-
cleate in shapes. Numerous fungi pose a threat to human interests. They have the
potential to harm humans either directly or indirectly through their toxins, such as
23 Animal DNA Testing 323

mycotoxins and mushroom poisoning. They may potentially spread illnesses to both
plants and animals. Fungus can be very useful sometimes in crime investigation or
during postmortem if pores are found and can make a link between suspect and
victim with a particular geographic area. Currently, the phenol chloroform isoamyl
alcohol (PCI) technique, the spin-column procedure using a Qiagen DNA extraction
kit, and the spin-column method using a Norgen DNA extraction kit are used to
isolate DNA from fungi (Kumar and Mugunthan 2018).

23.1.9 Insect DNA Identification Techniques

Insects are essential to the health of the forest environment because they consume
wood and help the food chain. In a general sense, the term “insect” usually refers to
well-known pests or disease vectors, such as bedbugs, houseflies, clothes moths,
beetles, mosquitoes, fleas, horseflies, etc. A lot of insects are helpful to humans
because they pollinate plants, make useful compounds, kill harmful insects, scav-
enge trash, and feed other animals. The genome is an insect’s complete set of DNA.
In insects, the nuclear genomes are made up of chromosomes, which contain DNA
and proteins. Within an insect, the nuclear genome contributes the most genetic data.
However, the cytoplasmic organelles known as mitochondria are also parts of the
genome. The DNA of several small insects with short storage times in 95% ethanol
has been discovered to be more successfully isolated by a method that is easier, more
dependable, cost-effective, and requires less equipment and chemicals; like nuclear
gene and cytochrome oxidase I gene (Microsatellites). Salting out and Chelex
Techniques are the other methods employed for isolating insect DNA. The
Chargeswitch Technique and prepGEM Technique can be used on insect specimens
that have been preserved. The Puregene method, DNAzol method, and DNeasy
method can all be used to obtain DNA extract from newly collected insects. Using
the QiaQuick PCR purification kit, DNA could be extracted from Copal. It is
possible to analyze the DNA of Xylophagus insects using the CTAB and modified
CTAB-PVP methods. The extraction of insect DNA within 24 h can now be
accomplished using a new high molecular weight DNA extraction technique (Asghar
et al. 2015).

References
Asghar U, Malik M, Anwar F, Javed A, Raza A (2015) DNA extraction from insects by using
different techniques: a review. Adv Entomol 3:132–138. https://doi.org/10.4236/ae.2015.34016
Barghouthi SA (2011) A universal method for the identification of bacteria based on general PCR
primers. Indian J Microbiol 51(4):430–444. https://doi.org/10.1007/s12088-011-0122-5
Butler J (2023) Recent advances in forensic biology and forensic DNA typing: INTERPOL review
2019–2022. Forensic Sci Int Synerg 6:100311. https://doi.org/10.1016/j.fsisyn.2022.100311
Caccianiga M, Caccia G, Mazzarelli D et al (2021) Common and much less common scenarios in
which botany is crucial for forensic pathologist and anthropologists: a series of eight case
studies. Int J Legal Med 135:1067–1077. https://doi.org/10.1007/s00414-020-02456-0
324 T. R. Chandrakar and A. Biswas

Carvalho DC, Palhares RM, Drummond MG, Frigo TB (2015) DNA barcoding identification of
commercialized seafood in south Brazil: A governmental regulatory forensic program. Food
Control 50:784–788. https://doi.org/10.1016/j.foodcont.2014.10.025
Chaitanya KV (2019) Structure and organization of virus genomes. In: Genome and genomics.
Springer Singapore, pp 1–30. https://doi.org/10.1007/978-981-15-0702-1_1
Claus D, Maiken LM, Keshav KS, Lene JR (2011) The importance of mitochondrial DNA in aging
and cancer. J Aging Res 2011:407536. https://doi.org/10.4061/2011/407536
Coghlan ML, White NE, Parkinson L, Haile J, Spencer PBS, Bunce M (2011) Egg forensics: An
appraisal of DNA sequencing to assist in species identification of illegally smuggled eggs.
Forensic Science International: Genetics 6(2):268–273. https://doi.org/10.1016/j.fsigen.2011.
06.006
Dorman CJ, Dorman MJ (2016) DNA supercoiling is a fundamental regulatory principle in the
control of bacterial gene expression. Biophys Rev 8(3):209–220. https://doi.org/10.1007/
s12551-016-0205-y
Kumar M, Mugunthan M (2018) Evaluation of three DNA extraction methods from fungal cultures.
Med J Armed Forces India 74(4):333–336. https://doi.org/10.1016/j.mjafi.2017.07.009
Pray L (2008) Discovery of DNA structure and function: Watson and Crick. Natur Educ 1(1):100
Rodionov A, Deniskova T, Dotsev A, Volkova V, Petrov S, Kharzinova V, Koshkina O,
Abdelmanova A, Solovieva A, Shakhin A et al (2021) Combination of multiple microsatellite
analysis and genome-wide SNP genotyping helps to solve wildlife crime: a case study of
poaching of a Caucasian tur (Capra caucasica) in Russian Mountain National Park. Animals
11:3416. https://doi.org/10.3390/ani11123416
Sahajpal V, Sudhanshu M, Deepika B (2021) Forensic Analysis in Wildlife Crime Cases: Micros-
copy. DNA Profiling and Isotope Analysis. https://doi.org/10.5772/intechopen.98252
Sharma R, Raturi A (2018) Wildlife PROTECTON in India: a LEGAL analysis. JCRT 6(2):1
Taanman J-W, Kroon A (2019) Mitochondrial DNA: structure, genetics, replication and defects.
https://doi.org/10.1016/B978-0-12-811752-1.00005-5
Travers A, Muskhelishvili G (2015) DNA structure and function. FEBS J 282:2279. https://doi.org/
10.1111/febs.13307
Zhou ZM (2014) Synthetic ivory fails to stop illegal trade. Nature 507:40. https://doi.org/10.1038/
507040a
Microbial DNA Testing
24
Paromita Banerjee and Prashant Kumar

Abstract

Microbiology is the study of microorganisms, which are tiny organisms that are
typically invisible to the naked eye. These include bacteria, viruses, fungi,
protozoa, and algae. It is a diverse and interdisciplinary field that encompasses
many different sub-disciplines, including bacteriology, virology, mycology, par-
asitology, and phycology.

Keywords
Skull · Scavenger · Excavation dimorphic

1. Introduction: In this section, we have provided an overview of the importance of

microbial DNA testing, its applications, and the various techniques used to
perform the tests.
2. Sample collection and preparation: Here, we have described the methods used
to collect and prepare samples for microbial DNA testing, such as swabbing,
plating, and centrifugation. We have also discussed the importance of proper
sample handling and storage to ensure the accuracy of the test results.
3. DNA extraction: This section covers the various techniques used to extract DNA
from microbial samples, such as boiling, lysis, and chemical methods. We also

P. Banerjee (✉)
Department of Cardiology, AIIMS, Rishikesh, India
P. Kumar
Department of Bioinformatics, Kalinga University, Raipur, Chhattisgarh, India
e-mail: [email protected]

# The Author(s), under exclusive license to Springer Nature Singapore Pte 325
Ltd. 2024
A. Puri et al. (eds.), Fundamentals of Forensic Biology,
https://doi.org/10.1007/978-981-99-3161-3_24
326 P. Banerjee and P. Kumar

discussed the pros and cons of each technique and the factors that influence the
efficiency of DNA extraction.
4. PCR-based methods: We provided an overview of PCR-based methods, such as
quantitative (qPCR) and multiplex PCR, and their applications in microbial DNA
testing. This section also covers the advantages and disadvantages of PCR-based
methods and the parameters that affect their performance.
5. DNA sequencing: This section describes the various DNA sequencing
techniques, such as Sanger sequencing and next-generation sequencing (NGS),
and their applications in microbial DNA testing. We also discussed the
advantages and disadvantages of different sequencing techniques and the factors
influencing sequencing accuracy.
6. Data analysis: Different software and bioinformatics tools have been
demonstrated to analyse the data generated by microbial DNA testing. We also
discussed the importance of data validation and quality control in ensuring the
accuracy of the results.
7. Applications: In this section, we described the various applications of microbial
DNA testing, such as pathogen detection, microbiome analysis, and genetic
diversity studies. The potential of microbial DNA testing in medicine, agriculture,
and biotechnology has also been discussed.
8. Conclusion: Summarise the key points discussed in the chapter and provide an
overview of the current state of microbial DNA testing and future directions for
research in this field.

Microbiology is the study of microorganisms, which are tiny organisms that are
typically invisible to the naked eye. These include bacteria, viruses, fungi, protozoa,
and algae. It is a diverse and interdisciplinary field that encompasses many different
sub-disciplines, including bacteriology, virology, mycology, parasitology, and
phycology.
Some of the key areas of research in microbiology include:

• Taxonomy and systematics: The classification and identification of

microorganisms, including the development of new techniques for identifying
microorganisms and understanding their evolutionary relationships.
• Microbial genetics and genomics: The study of the genetic makeup of
microorganisms and how they evolve, including the use of DNA sequencing
and other molecular techniques to study microorganisms.
• Microbial ecology: The study of how microorganisms interact with each other
and with their environment, including the impact of microorganisms on the
Earth’s ecosystem.
• Microbial physiology: The study of the role of microorganisms in human health
and disease, including the development of new diagnostic methods and therapies
for treating infectious diseases.
• Biotechnology: The application of microbial physiology in the production of
useful products such as antibiotics, enzymes, and vaccines.
24 Microbial DNA Testing 327

• Industrial microbiology: The application of microbiology in industrial processes

such as fermentation, waste treatment, and pollution control.

Overall, it plays a vital role in understanding the biology of microorganisms and

how they interact with the world around us. It also has many practical applications in
fields such as medicine, agriculture, and industry.
In today’s world, Recombinant DNA technology is a method for combining
genetic material from different sources to create new combinations of genes. This
technology can be used to manipulate the DNA of microbes, such as bacteria and
yeast, to produce useful products such as proteins, enzymes, and antibiotics. It can
also be used to create genetically modified organisms (GMOs) with specific
characteristics, such as resistance to disease or pests. This technology has a wide
range of applications in medicine, agriculture, and biotechnology. All of these
aspects come into light while we deal with microbial DNA testing. Because, in no
way or the other when researchers have to reach in a definite conclusion, they have to
undergo through a process of microbial testing. In the upcoming pages, we will get
to learn a lot regarding this topic of Microbial DNA testing.

24.1 Introduction

Microbial DNA testing is crucial because it identifies and characterises

microorganisms, providing insight into the causes of infections and other diseases.
Additionally, microbial DNA testing can track the spread of infectious diseases,
monitor the effectiveness of treatment, and determine the presence of antibiotic
resistance. It can also be used in environmental monitoring, food safety and quality
control, and biotechnology applications. Overall, it is a powerful tool that can help us
understand and combat microorganisms that can cause harm to human health and the
environment.
This has a wide range of applications, including:

1. Medical and clinical applications: Microbial DNA testing can be used to identify
the cause of infections, such as bacterial, viral, and fungal infections, and to
monitor the effectiveness of treatment. It can also be used to detect antibiotic
resistance in microorganisms.
2. Environmental monitoring: Used to monitor the presence of microorganisms in
water, soil, and air, which can help to identify sources of pollution or
contamination.
3. Food safety and quality control: Detects harmful microorganisms in food and
ensure that food products meet safety and quality standards.
4. Biotechnology: Identifies and characterises microorganisms used in the produc-
tion of fermented foods and beverages, as well as in the production of enzymes,
antibiotics, and other bioproducts.
5. Forensic applications: Identifies microorganisms in forensic samples, such as
blood or skin cells, which can help solve crimes.
328 P. Banerjee and P. Kumar

6. Research and discovery: Can even identify and study new microorganisms and
understand the diversity and evolution of microorganisms in different
environments.

Overall, microbial DNA testing plays a vital role in many areas of science and
technology, and it will likely continue to be used in new and innovative ways.
Several techniques can be used to perform microbial DNA testing, including:

1. Polymerase chain reaction (PCR): This widely used technique can amplify small
amounts of DNA. It can be used to detect and identify specific microorganisms in
a sample.
2. DNA sequencing: This technique can be used to determine the complete genetic
sequence of a microorganism. It can be used to identify microorganisms and to
study their genetic diversity and evolution.
3. Microarray: This technique uses a chip with a large number of DNA probes to
detect and identify multiple microorganisms in a sample at the same time.
4. Fluorescence in situ hybridisation (FISH): This technique uses fluorescently
labelled DNA probes to detect and identify specific microorganisms in a sample.
5. Mass spectrometry: This technique can identify microorganisms by analysing the
unique mass-to-charge ratios of their DNA or other biomolecules.
6. Next-generation sequencing (NGS): This technique can be used to sequence the
entire genome of a microorganism, allowing for high-throughput, rapid, and cost-
effective identification and characterisation of microorganisms.

The choice of technique will depend on the specific application, the type of
microorganism being tested, and the available resources and expertise.

24.2 Sample Collection and Preparation

Several methods can be used to collect and prepare samples for microbial DNA
testing, including:

1. Swabbing: This method involves using a swab to collect a sample from a surface
or an area of infection. The swab is then placed in a transport medium to preserve
the microorganisms for testing.
2. Biopsy: This method involves collecting a small tissue sample from an area of
infection or disease.
3. Blood culture: This method involves collecting a sample of blood, which is then
placed in a particular culture medium to grow any microorganisms present.
4. Faecal or urine sample.
5. Water or soil sample.

All of these samples along with the tissue sample is then placed in a transport
medium to preserve the microorganisms for testing.
24 Microbial DNA Testing 329

Once the sample is collected, it may need to be prepared before it can be tested.
This may include steps such as:

• Homogenising the sample to break up any clumps of microorganisms.

• Extracting the DNA from the microorganisms.
• Purifying the DNA to remove any contaminants that could interfere with the test
results.

The specific method of sample preparation will depend on the type of microor-
ganism being tested and the type of DNA testing that will be performed.
Proper sample handling and storage are crucial for ensuring the accuracy of test
results for microbial DNA testing. Improper handling and storage can lead to
contamination, degradation, or loss of the microorganisms in the sample, which
can result in inaccurate or unreliable test results.
Here are a few examples of how proper sample handling and storage can ensure
the accuracy of test results:

1. Sample collection: Samples should be collected using sterile techniques to avoid

contamination. Any swabs or other materials used to collect the sample should be
sterile, and the sample should be stored in a transport medium that will preserve
the microorganisms.
2. Sample transport: Samples should be transported to the lab as soon as possible
after collection to minimise the risk of contamination or loss of microorganisms.
They should also be stored at the appropriate temperature to preserve the
microorganisms.
3. Sample preparation: Sample preparation should be done under sterile conditions
to avoid contamination. The DNA should be extracted and purified as soon as
possible after the sample is collected to minimise the risk of degradation.
4. Sample storage: Once the sample is prepared, it should be stored at the appropri-
ate temperature to minimise the risk of degradation. Long-term storage should be
done in a - 80 °C freezer.
5. Sample testing: The sample should be tested as soon as possible after collection to
minimise the risk of degradation or loss of microorganisms.

Overall, proper sample handling and storage are essential for ensuring the
accuracy of test results for microbial DNA testing. It is important to follow standard
operating procedures (SOPs) to minimise the risk of contamination, degradation, or
loss of microorganisms in the sample.

24.3 DNA Extraction

Several techniques can be used to extract DNA from microbial samples for microbial
DNA testing, including:
330 P. Banerjee and P. Kumar

1. Phenol–chloroform extraction: This widely used technique combines phenol and

chloroform to separate DNA from other cellular components. The DNA is then
recovered from the aqueous layer after centrifugation.
2. Chelex extraction: This technique uses chelex beads, which contain a chelating
agent, to remove positively charged ions and other contaminants that can interfere
with DNA extraction.
3. Organic extraction: This technique uses organic solvents, such as ethanol or
isopropanol, to separate the DNA from other cellular components. The DNA is
then recovered by precipitation.
4. Silica-based extraction: This technique uses silica-based beads to bind the DNA,
which is then washed and eluted from the beads.
5. Magnetic bead-based extraction: This technique uses magnetic beads coated with
silica or other materials to bind the DNA, which is then washed and eluted from
the beads using a magnetic field.
6. Commercial kits: There are also a variety of commercial DNA extraction kits
available that can be used to extract DNA from microbial samples. These kits
typically combine the abovementioned methods; some are tailored to specific
microorganisms or samples.

The choice of technique will depend on the specific application, the type of
microorganism being tested, and the available resources and expertise. It is essential
to follow the protocols and standard operating procedures (SOPs) to ensure the
quality and integrity of the extracted DNA.
Each technique used to extract DNA from microbial samples for microbial DNA
testing has advantages and disadvantages. The choice of technique will depend on
the specific application, the type of microorganism being tested, and the available
resources and expertise.

1. Phenol–chloroform extraction: This widely used technique is relatively simple

and inexpensive. However, it can be time-consuming and may not be as efficient
at removing contaminants as other methods.
2. Chelex extraction: This technique is relatively quick and easy to perform and is
suitable for removing positively charged ions and other contaminants. However,
it may not be as efficient at extracting DNA from some types of microorganisms
as other methods.
3. Organic extraction: This technique is inexpensive and can extract DNA from
various microorganisms. However, it may not be as efficient at removing
contaminants as other methods.
4. Silica-based extraction: This technique is suitable for extracting DNA from
microorganisms that are difficult to lyse, and it is relatively quick and easy to
perform. However, it may not be as efficient at removing contaminants as other
methods.
5. Magnetic bead-based extraction: This technique is relatively quick and easy to
perform and is suitable for extracting DNA from various microorganisms. How-
ever, it can be more expensive than other methods.
24 Microbial DNA Testing 331

6. Commercial kits: These kits are pre-packaged and often tailored to specific types
of microorganisms or samples, making them convenient to use. However, they
can be more expensive than other methods and may provide less flexibility
regarding sample type or downstream applications.

Factors that can influence the efficiency of DNA extraction include the type of
microorganism being tested, the amount and quality of the sample, the presence of
inhibitors or contaminants, and the conditions used during the extraction process.
The pH, temperature, and incubation time can also affect extraction efficiency. It is
essential to follow the protocols and SOPs and to optimise the conditions of
extraction to ensure the quality and integrity of the extracted DNA.

24.4 PCR-Based Methods

PCR-based methods, such as quantitative (qPCR) and multiplex PCR, are widely
used in microbial DNA testing.

1. Quantitative PCR (qPCR): Widely used technique in microbial DNA testing. It is

a sensitive and specific method that can be used to detect and quantify small
amounts of DNA from microorganisms. In qPCR, specific primers are designed
to bind to specific regions of the target DNA. Then, the polymerase chain reaction
(PCR) process is used to amplify the DNA. The amount of amplified DNA is
measured using fluorescent dyes, which allows for quantifying the target DNA.
QPCR can detect and quantify specific microorganisms in a sample, such as
bacteria, viruses, and fungi. This makes it useful for the diagnosis of infections, as
well as for monitoring the effectiveness of treatment. qPCR can also be used to
track the spread of infectious diseases by detecting and quantifying the DNA of
specific microorganisms in a sample. QPCR can detect and quantify specific
microorganisms in various samples, including blood, urine, swab, and other
clinical and environmental samples such as water and soil. Overall, qPCR is a
powerful tool for microbial DNA testing that allows for the sensitive and specific
detection and quantification of microorganisms in a sample. It is widely used in
medical and clinical applications, environmental monitoring, food safety and
quality control, and biotechnology. qPCR is a sensitive and specific method
that can be used to detect and quantify small amounts of DNA. It involves
using primers that bind to specific regions of the target DNA and then amplifying
the DNA using the polymerase chain reaction (PCR) process. The amount of
amplified DNA is then measured using fluorescent dyes. qPCR can be used to
detect and quantify specific microorganisms in a sample, as well as to monitor the
effectiveness of treatment or track the spread of infectious diseases.
2. Multiplex PCR: A variation of PCR that allows for the simultaneous amplifica-
tion of multiple target DNA sequences. This technique is also widely used in
microbial DNA testing, as it detects multiple microorganisms in a single reaction.
Multiplex PCR is based on the same principle but uses multiple primers, each
332 P. Banerjee and P. Kumar

specific to a different target DNA sequence. Different sets of primers and

fluorescent dyes make detecting multiple microorganisms in a single reaction
possible. This can be useful for diagnosing infections, where multiple
microorganisms may be present, or for detecting outbreaks of infectious diseases,
where multiple microorganisms are responsible for spreading the disease. Multi-
plex PCR can detect and identify multiple microorganisms in various samples,
including blood, urine, swab, and other clinical and environmental samples such
as water and soil. One of the main advantages of multiplex PCR is its ability to
detect multiple microorganisms in a single reaction, which can be more efficient
and cost-effective than running multiple individual PCR reactions. However,
multiplex PCR can be more complex to design and optimise than traditional
PCR. The number of fluorescent dyes available limits the number of targets
amplified in a single reaction. Overall, multiplex PCR is a powerful tool for
microbial DNA testing that allows for the simultaneous detection of multiple
microorganisms in a single reaction. It can be used in various medical and clinical
applications, environmental monitoring, food safety and quality control, and
biotechnology. Multiplex PCR is a variation that allows for the simultaneous
amplification of multiple target DNA sequences. It involves using multiple
primers, each specific to a different target DNA sequence. This allows for the
detection of multiple microorganisms in a single reaction. Multiplex PCR can be
used to detect and identify multiple microorganisms in a sample at the same time,
which can be helpful in the diagnosis of infections or for the detection of
outbreaks of infectious diseases.

Both qPCR and multiplex PCR are sensitive and specific methods that can detect
and identify microorganisms in a sample. They can be used in various medical and
clinical applications, environmental monitoring, food safety and quality control, and
biotechnology. The choice of method will depend on the specific application, the
type of microorganism being tested, and the available resources and expertise.

24.5 DNA Sequencing

DNA sequencing determines the order of nucleotides in a DNA molecule. DNA

sequencing can be used in microbial DNA testing to identify and study
microorganisms.

1. Sanger sequencing: Sanger sequencing, also known as dideoxy sequencing, is a

chain termination method that uses specific nucleotides called
dideoxynucleotides (ddNTPs) to stop the synthesis of new DNA strands. This
method generates multiple DNA fragments of different lengths, which can be
separated by size using gel electrophoresis. The sequence of the DNA can then be
determined by reading the order of the nucleotides in the fragments. Sanger
sequencing is considered a standard gold method for DNA sequencing, but it is
relatively slow and costly compared to newer methods.
24 Microbial DNA Testing 333

2. Next-generation sequencing (NGS): Next-generation sequencing (NGS) is a

newer method that allows for high-throughput, rapid, and cost-effective sequenc-
ing of DNA. NGS technologies include Illumina, PacBio, and Nanopore. These
methods can sequence billions of DNA molecules simultaneously and can be
used to sequence the entire genome of a microorganism. NGS is a powerful tool
for microbial DNA testing, as it allows for the identification and characterisation
of microorganisms and the study of their genetic diversity and evolution.
3. Whole Genome Sequencing (WGS): WGS is a method of DNA sequencing that
aims to sequence the entire genome of an organism. This method allows for the
identification of all genetic information, including the presence of virulence
factors, antibiotic resistance genes, and other genetic markers important for
understanding the biology of the microorganism.

The choice of DNA sequencing technique will depend on the specific application,
the type of microorganism being tested, and the available resources and expertise.
Sanger sequencing is considered a standard gold method for DNA sequencing, but it
is relatively slow and costly. Next-generation sequencing (NGS) is a newer method
that allows for high-throughput, rapid, and cost-effective sequencing of DNA.
Whole genome sequencing (WGS) is the most comprehensive method for
identifying all genetic information.

24.6 Data Analysis

Several factors can influence the accuracy of DNA sequencing, including:

1. Quality of the DNA sample: The quality of the DNA sample can affect the
sequencing accuracy. High-quality DNA samples free from contaminants and
inhibitors will yield more accurate sequencing results than poor-quality samples.
2. Sample preparation: Sample preparation is a critical step affecting sequencing
accuracy. Proper extraction, purification, and quantification of the DNA sample
are essential to ensure the quality and integrity of the DNA.
3. Sequencing technology: The sequencing technology used can also influence
sequencing accuracy. Different sequencing technologies have different error
rates; some are more accurate than others.
4. Sequencing conditions: The conditions used during sequencing, such as the
temperature, pH, and reagent concentrations, can affect sequencing accuracy.
Optimal conditions should be determined for each sequencing technology and
followed to ensure sequencing accuracy.
5. Data analysis: The data analysis methods can also influence sequencing accuracy.
The choice of software and the parameters used can affect the accuracy of the
sequencing results.
6. Quality control: Quality control measures, such as repeat sequencing or reference
standards, can also be used to check the accuracy of sequencing.
334 P. Banerjee and P. Kumar

7. Mapping to reference genome: In the case of genome sequencing, the accuracy of

the results is also influenced by the quality of the reference genome used for
mapping.
8. Coverage: Sequencing coverage can also have an impact on the accuracy of the
sequencing results. Higher coverage means a higher chance of detecting rare
variants or mutations.

Overall, the accuracy of DNA sequencing can be influenced by various factors,

including the quality of the DNA sample, the sequencing technology used, the
sequencing conditions, data analysis methods, and quality control measures. By
taking these factors into account and following standard operating procedures
(SOPs), the accuracy of DNA sequencing can be improved, and the results can be
more reliable.

24.7 Applications

Microbial DNA testing has a wide range of applications, including:

1. Medical and clinical applications: Microbial DNA testing can diagnose and
monitor infectious diseases, such as bacterial and viral infections. It can also be
used to monitor the effectiveness of treatment, track the spread of infections, and
detect outbreaks of infectious diseases.
2. Environmental monitoring: It monitors the presence and abundance of
microorganisms in the environment, such as in water and soil. This can be useful
for monitoring the quality of water resources, detecting pollution, and assessing
the impact of human activities on the environment.
3. Food safety and quality control: This technique can detect and identify
microorganisms in food and agricultural products. This can be used to ensure
food products’ safety and quality and track the source of foodborne illness.
4. Biotechnology: Identifies and studies microorganisms that have potential
applications in biotechnology, such as biofuels and other chemicals.
5. Pharmaceuticals: Microbial DNA testing can identify and study microorganisms
used to produce drugs and other pharmaceuticals.
6. Forensics: Used in forensic investigations to identify and track the source of
microorganisms in forensic samples.
7. Biomedical research: Microbial DNA testing can be used in biomedical research
to study genetics and biology of microorganisms and their interactions with other
organisms and their environment.

Overall, microbial DNA testing is a powerful tool that can be used in many
applications, including medical and clinical applications, environmental monitoring,
food safety and quality control, and biotechnology.
Microbial DNA testing can be used for various applications, including pathogen
detection, microbiome analysis, and genetic diversity studies.
24 Microbial DNA Testing 335

1. Pathogen detection: Microbial DNA testing can identify specific pathogens, such
as bacteria, viruses, and fungi. This is commonly used in medical and clinical
applications to diagnose and monitor infectious diseases, as well as to track the
spread of infections and detect outbreaks of infectious diseases.
2. Microbiome analysis: Microbial DNA testing can study the diversity and compo-
sition of microorganisms in a specific environment or sample, such as the human
gut microbiome. This can be used to understand the role of the microbiome in
health and disease, as well as to develop new therapies and diagnostic tools.
3. Genetic diversity studies: Microbial DNA testing can study the genetic diversity
of microorganisms, such as bacteria and fungi. This can be used to understand the
evolution and spread of microorganisms and identify genetic markers that are
important for understanding the biology of the microorganism.

Overall, microbial DNA testing is a powerful tool that can be used for various
applications, including pathogen detection, microbiome analysis, and genetic diver-
sity studies. It allows for the sensitive and specific detection and identification of
microorganisms and the study of their genetics and biology.
Microbial DNA testing has the potential to play a significant role in the field of
medicine. Some of the ways that it can be used include:

1. Diagnosis of infectious diseases: Microbial DNA testing can detect and identify
specific pathogens, such as bacteria, viruses, and fungi. This can be used to
diagnose infectious diseases and monitor the effectiveness of treatment.
2. Tracking the spread of infections: Microbial DNA testing can be used to track the
spread of infectious diseases by detecting and identifying specific
microorganisms in a sample. This can be used to identify outbreaks of infectious
diseases and to monitor their progression.
3. Monitoring antibiotic resistance: Microbial DNA testing can detect and identify
antibiotic resistance genes in microorganisms. This can be used to monitor the
spread of antibiotic resistance and to guide the selection of antibiotics for
treatment.
4. Personalised medicine: Microbial DNA testing can be used to study the diversity
and composition of the microbiome, which can be used to understand the role of
the microbiome in health and disease. This can be used to develop new therapies
and diagnostic tools and to guide personalised medicine.
5. Biomedical research: Microbial DNA testing can be used to study genetics and
biology of microorganisms and their interactions with other organisms and their
environment. This can be used to understand the underlying causes of infectious
diseases and to develop new therapies and diagnostic tools.

Overall, microbial DNA testing has the potential to play a significant role in the
field of medicine by allowing for the sensitive and specific detection and identifica-
tion of microorganisms, as well as the study of their genetics and biology. This can
be used to diagnose and monitor infectious diseases, track the spread of infections,
and develop new therapies and diagnostic tools.
336 P. Banerjee and P. Kumar

Microbial DNA testing has the potential to play a significant role in the field of
agriculture. Some of the ways that it can be used include:

1. Soil and plant health: Microbial DNA testing can be used to study the diversity
and composition of microorganisms in soil and on plants. This can be used to
understand the role of the microbiome in soil health and plant growth and to
develop new strategies for improving crop yields and reducing chemical
fertilisers and pesticides.
2. Food safety and quality control: Microbial DNA testing can detect and identify
microorganisms in food and agricultural products. This can be used to ensure
food products’ safety and quality and track the source of foodborne illness.
3. Biocontrol and biopesticides: Microbial DNA testing can identify and study
microorganisms with potential applications in biocontrol and biopesticides.
This can be used to develop new strategies for controlling crops’ pests and
diseases without using chemical pesticides.
4. Production of biofuels and other chemicals: Microbial DNA testing can identify
and study microorganisms that have potential applications in producing biofuels
and other chemicals. This can be used to develop new strategies for producing
biofuels and other chemicals from renewable sources.

Overall, microbial DNA testing can play a significant role in agriculture by

allowing for studying the diversity and composition of microorganisms in the soil,
plants, and food products. This can be used to understand the role of the microbiome
in soil health, plant growth, and food safety and to develop new strategies for
improving crop yields, controlling pests, and producing biofuels and other chemicals
from renewable sources.
Microbial DNA testing has the potential to play a significant role in the field of
biotechnology. Some of the ways that it can be used include:

1. Microbial strain identification and characterisation: Microbial DNA testing can

identify and study microorganisms that have potential applications in biotechnol-
ogy. This can be used to identify and characterise novel microorganisms and
study the genetics and biology of known microorganisms.
2. Metagenomics: Microbial DNA testing can be used to study the diversity and
composition of microbial communities in different environments, such as soil,
water, and air. This can be used to identify novel microorganisms and genes that
have potential applications in biotechnology.
3. Bioprocess development: Microbial DNA testing can identify and study
microorganisms that have potential applications in producing biofuels, chemicals,
and other bioproducts. This can be used to develop new strategies for producing
bioproducts from renewable sources and to improve the efficiency and cost-
effectiveness of bioprocesses.
4. Bioremediation: Microbial DNA testing can identify and study microorganisms
that have potential applications in bioremediation, using microorganisms to
degrade or remove environmental pollutants.
24 Microbial DNA Testing 337

5. Synthetic biology: Microbial DNA testing can identify and study microorganisms
that have potential applications in synthetic biology. This can be used to develop
new strategies for engineering microorganisms to produce bioproducts, biofuels,
and other chemicals.

Overall, microbial DNA testing can play a significant role in biotechnology by

allowing for the identification and characterisation of microorganisms that have
potential applications in biotechnology. This can be used to study the genetics and
biology of microorganisms and develop new strategies for producing bioproducts,
biofuels, and other chemicals from renewable sources, improving bioprocess.
Microbial DNA testing has the potential to revolutionise the field of biotechnol-
ogy by providing a powerful tool for identifying and characterising microorganisms.
This technology can be used to identify specific microbes in a sample, determine the
genetic makeup of a microbe, and track changes in the genetic makeup of a microbe
over time. In addition, microbial DNA testing can be used to identify the presence of
pathogens and to monitor the effectiveness of treatments for infectious diseases.
Overall, microbial DNA testing is a highly versatile and valuable tool for advancing
our understanding of microorganisms and their roles in various biological systems.

24.8 Conclusion

Microbial DNA testing is a method used to identify and quantify the presence of
microorganisms in a sample. This can include bacteria, viruses, fungi, and parasites.
The test typically involves extracting DNA from the sample, amplifying specific
DNA regions using polymerase chain reaction (PCR), and then detecting and
identifying the microorganisms present using gel electrophoresis, sequencing, or
array-based methods.
Microbial DNA testing can be used for a variety of applications, including:

• Diagnosis of infectious diseases: Microbial DNA testing can quickly and accu-
rately diagnose various infectious diseases, including bacterial and viral
infections.
• Environmental monitoring: Microbial DNA testing can be used to monitor the
presence of microorganisms in the environment, such as in water or air samples.
• Food safety: Microbial DNA testing can be used to detect the presence of harmful
microorganisms in food, such as E. coli and Salmonella.
• Pharmaceuticals and medical devices: Microbial DNA testing can be used to test
for the presence of microorganisms in pharmaceuticals and medical devices, such
as implants, to ensure their safety and purity.
• Microbial forensics: Microbial DNA testing can be used to identify the source of a
microbe or a disease outbreak by comparing the DNA of microbes from different
sources.
338 P. Banerjee and P. Kumar

Overall, microbial DNA testing is a powerful tool for identifying and quantifying
the presence of microorganisms in a wide range of samples and provides a more
rapid and accurate diagnosis of infectious diseases than traditional culture-based
methods.
Microbial DNA testing is a rapidly growing field that involves identifying and
characterising microorganisms using DNA-based methods. This can include
techniques such as polymerase chain reaction (PCR) and DNA sequencing. These
methods have been used in various applications, including medical diagnostics, food
safety testing, and environmental monitoring. In the medical field, microbial DNA
testing is used to identify and track infectious diseases, including tuberculosis,
gonorrhoea, and some forms of cancer. In the food industry, it is used to detect
harmful bacteria and other microorganisms in food products. In the environmental
field, it is used to monitor and track the presence of microorganisms in water, soil,
and air. Overall, microbial DNA testing is a powerful tool helping to improve our
understanding of the microbial world and its impact on human health and the
environment.
There are several potential areas for future research in microbial DNA testing.
One area of interest is the development of more rapid and accurate diagnostic
methods for identifying and characterising microorganisms. This could include
using portable, point-of-care devices for testing and developing new DNA sequenc-
ing technologies that can provide more detailed information about the genetic
makeup of microorganisms.
Another area of research is microbial DNA testing for tracking and understanding
the spread of infectious diseases. This could include developing new methods for
identifying and tracking outbreaks of infectious diseases in real time, as well as using
microbial DNA testing to understand the evolution and transmission of pathogens.
In addition, research in metagenomics and metatranscriptomics is expected to
grow and be widely used. Metagenomics allows the study of the genetic diversity of
microorganisms in a specific environment, while metatranscriptomics allows the
study of the functional diversity of microbial communities.
Another direction of research is microbial DNA testing in precision medicine,
which would allow for the personalised diagnosis and treatment of patients based on
their unique microbial profiles.
Finally, research on applying artificial intelligence (AI) and machine learning
(ML) in microbial DNA testing is expected to grow. These techniques will be used to
analyse large datasets, improve diagnostic accuracy, and speed up identifying and
characterising microorganisms.
Overall, the future of microbial DNA testing is expected to be characterised by
developing more sophisticated and efficient methods for identifying and
characterising microorganisms and applying these methods to a wide range of fields,
including medicine, agriculture, and environmental monitoring.
DNA Phenotyping
25
Astha, Tanya Chauhan, Shreya Arora, and Rutwik Shedge

Abstract

The genesis of DNA biology has been a fundamental point in advancing the
knowledge of living beings and their functioning. DNA is the blueprint of life and
determines the functional and physical traits of an individual. In recent times,
DNA has emerged as an indispensable part of research and applications around
the world. Scholars around the world have used the knowledge from DNA to
solve mysteries of evolution, heredity, health, and identity. DNA research has
found an important role in the field of human identification. DNA-based identifi-
cation is based on the fact that each individual has about 0.01% of DNA unique to
them which can be analysed for identification purposes. The major benefit of
DNA-based identification has been to the field of forensic science. Forensic
Science employs a range of scientific theories and techniques in the aid of justice.
DNA fingerprinting found an important and indispensable role in the field of
forensic science (Gill et al. 1985). The role of DNA analysis in the advancement
of the criminal justice system is commendable with its applications aiding in
faster and more accurate interpretation of evidence, identification and prosecution
of criminals in legal cases, and helping resolve disputed paternity cases.
DNA-based techniques are used in many aspects of forensic investigation, the

Astha
LNJN National Institute of Criminology and Forensic Science, Delhi, India
T. Chauhan (✉)
Department of Forensic Science, National Forensic Science University Delhi Campus (LNJN
NICFS), New Delhi, Delhi, India
S. Arora
CTM IRTE, Faridabad, Haryana, India
R. Shedge
Depatment of Forensic Science, NFSU, Agartala, Tripura, India

# The Author(s), under exclusive license to Springer Nature Singapore Pte 339
Ltd. 2024
A. Puri et al. (eds.), Fundamentals of Forensic Biology,
https://doi.org/10.1007/978-981-99-3161-3_25
340 Astha et al.

science began with incorporating the technique of DNA fingerprinting by Sir

Alec Jeffrey for individual identification and later expanded to paternity determi-
nation and ancestry determination and in recent research involving tissue identi-
fication and DNA-based phenotyping.

Keywords

Forensic DNA phenotyping · EVC · Single nucleotide polymorphism · SNaPshot

technology

25.1 Definitions

Forensic DNA Phenotyping: Prediction of appearance of an unknown donor of a

biological sample through their DNA.
Externally Visible Characteristics (EVC): Features such as the eye colour, skin
colour, hair colour, etc., that define the appearance of a human being.
Human Genome Project: Project aimed at sequencing the entire human DNA.
SNaPshot technology: Phenotypic model that uses information from SNP anal-
ysis of a DNA sample to predict ancestry and physical traits.

25.2 Introduction to DNA

Humans have 23 pairs of chromosomes, out of which 22 pairs are called autosomal
chromosomes and the rest are sex chromosomes that determine the sex of the
individual. The sex chromosomes are X and Y, an individual with XX chromosome
will be biologically female and one with XY will be biologically male. The
chromosomes are the basis of inheritance in humans; they are inherited equally
from both parent, which means that each individual’s half set of chromosomes is
inherited from each of their parents. The chromosomes exist in pair (except XY) and
so does the genes present in them. The alternate forms of genes are referred as alleles
and each allele is present on either of the two homologous chromosomes. The alleles
define the genotype or genetic composition of the individual, which establish the
phenotype or physical composition of the individual. The complete genotype of an
individual constitutes their genetic profile.
DNA are packaged into Deoxyribonucleic Acid (DNA) that is responsible for
heredity in individuals. Deoxyribonucleic Acid (DNA) is a type of nucleic acid,
composed of monomeric units called nucleotides. The nucleotides that are the major
constituent of DNA, they are composed of a nitrogenous base, a pentose sugar
(Deoxyribose), and a phosphate. The different nitrogenous bases include Adenine,
Thymine, Guanine, and Cytosine, represented by A, T, G, and C, respectively. They
are classified into Purines and Pyrimidines. The Purine bases of the DNA are
Adenine and Guanine, whereas the Pyrimidine bases are Cytosine and Thymine.
Out of the four bases, two of them, adenine and guanine, are purines, which are
25 DNA Phenotyping 341

double ring molecules, while the other two, cytosine and thymine, are pyrimidines,
which are single ring molecules. The nitrogenous bases exhibit complementary base
pairing characteristics, where adenosine molecules bind with thymine molecules
through a double hydrogen bond and the guanine molecules bind with cytosine
molecules through a triple hydrogen bond. The nitrogenous bases exist and arrange
themselves in a DNA molecule in accordance of the Chargaff’s rules, proposed by
Erwin Chargaff in the 1940s. They state that the number of guanine molecules is
equal to those of the cytosine molecules and similarly the numbers of adenine and
thymine molecules are same in a double-stranded DNA molecule. Thus, that the
ratio of Adenine to Thymine and Guanine to Cytosine molecules is 1 in a double-
stranded DNA molecule. These rules helped in establishing the double helix struc-
ture of the DNA. The sequence in which these bases occur governs the genetic
characteristics attained by an individual.
DNA stores the information for the sustaining and functioning of human body.
DNA exists in almost all the cells of the human body, the exception being the red
blood cells or the erythrocytes, which are enucleated cells. DNA is present in the
nuclei as well as the mitochondrion of a cell. It is distinguished as nuclear and
mitochondrial DNA, respectively. The DNA is a complex molecule with an intricate
structural organization and a wide range of roles to play in making life possible.
DNA was first isolated by Friedrich Miescher in 1869 from the pus cells found on
discarded surgical bandages. He named the substance ‘Nuclein’. Later, in 1889,
‘nuclein’ was renamed as ‘nucleic acid’ by Richard Altmann, who was one of
Miescher’s pupils. The role of DNA in inheritance was given by Frederick Griffith,
through the findings of his experiment conducted on the virulent and non-virulent
strains of pneumonia. He called DNA ‘The transformation molecule’. The transfor-
mation molecule was finally confirmed to be the deoxyribonucleic acid (DNA) by
the experimental findings of Oswald Avery. Phoebus Levene in 1929 discovered the
constituents of a DNA molecule; they were four nitrogenous bases, sugar, and a
phosphate molecule. He also gave idea about the order in which these molecules
were arranged. In the 1940s, Erwin Chargaff gave the Chargaff’s rule to explain the
correlation among the quantity of the four bases of DNA. The fact that DNA has a
helix shape was given by Rosalind Franklin and Maurice Wilkins. The famous and
widely accepted double helical structure of DNA was given by James Watson and
Francis Crick in 1953 which expanded the knowledge about the stability,
interactions and working of the DNA molecule.

25.3 What a DNA Can Reveal

The DNA material in chromosomes is composed of ‘coding’ and ‘non-coding’

regions. A gene generally ranges from a few thousands to ten thousands base
pairs. Eukaryotic DNA have a lot of repeated DNA sequence. These sequences
vary in size and are known by the length of the core repeat unit which can contain
several hundred to several thousand base pairs in the core repeat region. These
regions are known as satellite DNA. The core repeat unit for approximately medium
342 Astha et al.

Fig. 25.1 Schematic representation of VNTR and STR DNA markers. The region of DNA
surrounding a VNTR and STR is known as flanking region which helps us in designing the primers
for the foresaid DNA marker

length repeats is known as Variable Number Tandem Repeat (VNTR). It ranges for
approximately 10–100 base pairs in length. Variable Number Tandem Repeat also
known as minisatellite. The forensic DNA marker D1S80 is actually a mini-satellite
with 16 base pairs in a repeating unit (Jeffreys 2005).
The DNA regions where the repeat units vary for 2-base pairs in length are called
microsatellites, or short tandem repeat (STR). These STRs are now a preferred DNA
marker since they are easy to amplify and the variability in repeats in individuals is
quite high which makes it more effective for forensic biology to function. They
account for approximately 3–4% of the total human genome and occur on average
after every 10,000 nucleotides. The schematic representations of VNTR and STR
markers are shown in Fig. 25.1, and the differences between them are depicted in
Table 25.1.
A single base variation in sequence between individuals at a particular location in
the human genome is referred to as Single Nucleotide Polymorphism (SNP). They
are quite abundant in the human genome and are also being used for studying the
genetic diseases. There are millions of SNPs in each individual and can be further
25 DNA Phenotyping 343

Table 25.1 Difference between VNTR and STR demonstrating their use and feasibility in forensic
DNA analysis. Also, STR markers are much more compatible for amplification as compared to
VNTR markers
Variable Number Tandem Repeat (VNTR) Short Tandem Repeat (STR)
Also known as minisatellites Also known as microsatellites
It is a type of tandem repeat in which sequence It is a type of tandem repeat in which sequence
of 10–60 base pairs are repeated a variable of 2–6 base pairs are repeated a variable no. of
no. of times at a particular locus times at a particular locus
It may consist of 10–1500 repeats in a unit It may consist of 5–200 repeats in a unit
It forms an array of 0.5–1.6 kb It forms an array of 10–1000 base pairs

Table 25.2 Comparison between STR and SNP markers. Though the frequency of SNP markers
in human genome is quite high but the polymorphism is better in STRs than SNPs. Also, the
detection is much convenient in case of STR marker analysis
Short Tandem Repeat (STR) Single Nucleotide Polymorphism (SNPs)
Their frequency in human genome is Their frequency in human genome is
approximately 1 in 15 kb approximately 1 in 1 kb
They are highly informative regarding the They are 25–30% low informative as compared to
informatics of genetic characteristics STR regarding the informatics of genetic
characteristics
There are generally more than 5 alleles per There are generally 2 alleles per marker
marker
They can be detected using gel/capillary- They can only be detected using sequence analysis
based electrophoresis

used in forensics for individualization. Restriction Fragment Length Polymorphism

is the technique in which sequence detectable by variation in the length of fragments
produced by specific restriction enzymes, Variable Number of Tandem Repeats. The
chromosomes exist in pair (except sex chromosomes in case of XY) and so the genes
as well as the genetic markers exist in pair, each of which is inherited from each of
their parent and hence can be used to trace and identify blood relations. The
differences between STR and SNP markers are shown in Table 25.2.
.

25.3.1 Externally Visible Characteristics Influenced by DNA

Pigmentation governs the externally visible characteristics in individuals. It is

controlled by the quantity and type of melanin produced by melanosomes in
melanocytes. Melanin exists in two forms eumelanin and pheomelanin and the
ratio of their quantity determines the colouration to the eye, iris, and hair. High
eumelanin content contributes to darker hair, eye, and skin colour, whereas high
pheomelanin content leads to blonde or red hair and lighter skin tone. The
melanocortin 1 receptor influences the pigmentation process and is controlled by
the MC1R gene. The melanocortin 1 receptor, when activated, promotes the
344 Astha et al.

Table 25.3 Genetic markers for externally visible characteristics (Marano and Fridman 2019)

synthesis of eumelanin; an inactivated or blocked receptor promotes pheomelanin

synthesis.
Externally visible characteristics (EVCs) such as eye colour, skin colour, hair
colour, height, male pattern baldness, height, and facial features can be predicted
from DNA markers. EVCs are outcome of distinct phenotype expressed in
individuals as an outcome of insertion and/or deletion and single nucleotide poly-
morphism in the DNA (Marano and Fridman 2019). MC1R gene polymorphism
produces the array of pigmentation variation that exists in the population. Other
pigmentation-governing genes are ASIP, MATP, SLC24A5, TYR, TYRP1, and
OCA2 (Tully 2007). Similarly, variants of the following were attributed to different
phenotypic characters such as SLC24A4 for eye and hair colour (Sulem et al. 2007),
KITLG (Sulem et al. 2007), ASIP (red colour) (Sulem et al. 2008), TPCN2 (Sulem
et al. 2008) for hair colour, TYR (Sulem et al. 2007), HERC2 (Kayser et al. 2008) for
colour of eye, ASIP (Sulem et al. 2008), and TYR and 6p25.3 (Sulem et al. 2007) for
the presence of freckles. Some of the EVCs and their associated genes/chromosomes
are shown in Table 25.3.
There have been population-specific studies to identify genes responsible for
different phenotypes in the population. Genes for pigmentation of hair like HCL3
(Eiberg and Mohr 1996) for brown coloured hairs and BEY2 and GEY for brown
and green eye colour in the population of Denmark (Eiberg and Mohr 1996) and the
polymorphism in SLC24A5, TYR, and SLC45A2 for skin colour in the South Asian
population (Stokowski et al. 2008). Male pattern baldness is another externally
visible character with significant value for identification. The trait can be predicted
through DNA-based phenotyping of AR, EDA2R, EBF1, TARDBP, and HDAC9
genes (Marcińska et al. 2015). The pattern of hairs whether straight or curled can be
predicted through markers such as FGFR2 and EDAR genes for straight and thick
hairs in the Asian population (Fujimoto et al. 2007, 2009) and TCHH gene for
straight hair in European population (Medland et al. 2009). There are also
25 DNA Phenotyping 345

recognized markers for height estimation identified as IHH, HHIP, PTCH1,

EFEMP1, ADAMTSL3, ACAN, CDK6, HMGA2, and DLEU7 (Weedon et al.
2008) among others.
Forensic DNA phenotyping systems are single nucleotide polymorphism-based
multiplex assay capable of simultaneous analysis of multiple markers. They devel-
oped as the outcome of identification of genetic marker for phenotypic characters
and allowed prediction of different visible traits. IrisPlex DNA test system predicted
the blue and brown eye colour from DNA samples using 6 SNP-based markers
(Walsh et al. 2010). HIris-Plex was an advanced version of phenotype prediction
models, and predicted 24 eye colour and hair colour from DNA samples (Walsh et al.
2013). HIris-Plex-S DNA test system added the application of predicting skin colour
to the previous HIris-Plex system. The HIris-Plex-S DNA system worked with novel
assay of 41 SNP markers and can help predict 17 phenotypes of skin colour
(Chaitanya et al. 2018).
In the current times, advancements in technology have allowed for affordable
sequencing of genome and identify single nucleotide polymorphisms within it. This
trend has allowed for public and private platforms to perform genome-wide analysis
for a multitude of individuals and organism for diverse purposes. Parabon labs in the
United States studied the genomic data of subjects with known phenotypes to build a
phenotype prediction model. The model was used to deduce the physical appearance
of an individual based on the genomic data. The Snapshot DNA Phenotyping
System is another phenotypic model that uses information from SNP analysis of a
DNA sample to predict ancestry and physical traits, such as skin colour, hair colour,
eye colour, freckling, and even face morphology.
Indian SNP data was organized by Centre for Cellular and Molecular Biology.
Their study was based on the knowledge that India has a diverse human genetic pool
with 4635 anthropologically well-defined populations and maintaining endogamy
for the thousands of years. Indian populations are the admixture of 2 ancestral
populations; Ancestral North Indians (ANI) with genetic affinities with Middle
Easterns, West-Eurasians, and Europeans and the Ancestral South Indians (ASI),
which is not related to any group outside Indian subcontinent. They performed
genome-wide association study (GWAS) with existing reference panels, which
include African, European, and East Asian HapMap population samples; South-
Asians of 1000 genome project; Indian population samples (Indo-Europeans and
Dravidians); and combined HapMap and Indian population samples.
Human genetic variation studies in Indian populations were performed by The
Centre for DNA Fingerprinting and Diagnostics (CDFD). They studied genetic
diversity among the Indian populations and utilize them for improving the current
human DNA profiling technology for forensic human identification (HID). They
designed a panel comprising of 70 SNPs on the autosomes with desired features for
HID application for Indian populations and also on genotype–phenotype correlation
studies on the association of DNA-based markers with characteristics like skin
colour, body-mass index (BMI), and height.
The technique has also found its application in fields of archaeology and anthro-
pology where the phenotyping analyses of ancient remains have generated
346 Astha et al.

information about the appearances, ancestry, and behavioural characteristics of early

populations. Such was a case of the famous ‘Cheddar man’ fossil recovered from a
cave in England whose physical appearance and possible lactose intolerance was
deduced using DNA-based phenotyping.

25.3.2 Characterization of Cell-Lines and Monitoring Transplants

Human cell line authentication is carried which enables the discovery of cross-
contamination between the cell lines and can also be served as universal standard.
These types of analysis are called cell culture forensics.
To monitor the donor cells after the transplant helps in checking the success rate
of the transplantation. This is done by checking the STR profile of the graft. In
various cases, chimerism is observed where a mixed profile is generated.

25.3.3 Mapping Genetic Diseases and Detection of Cancer Tumours

A genetic scan is performed to detect a disease and mapping is done using approxi-
mately 400 STR markers that covers the whole human genome. They study the
association of the marker with the respective disease in contrast with the patient’s
population. Through linkage analysis, a correlation can be further analysed between
the gene marker and the diseased gene of interest. For example, a genetic disease
known as Meckel–Gruber syndrome is reported to be located near D8S1179 marker.
As we study the genetic maps, we can also know gene deletion and addition.
There are many types of cancer that can be caused due to gene deletions, i.e. loss of
heterozygosity. In this, approximately nine STR markers are used on the tissue
extracted for cancer biopsy to confirm the cause of cancer in an individual.

25.3.4 Human Genome Project

The Human Genome Project that began in 1990 and went on till 2003 was an
ambitious project, which caved way to numerous major scientific discoveries. The
major goal of the project was to determine the sequence of nucleotides that make up
the human DNA and eventually map the genes to further study the structural and
functional importance. The project showed that among the entire human genome,
only 2% of the human genome is the protein coding region and the rest 98% is
the noncoding DNA region. The protein coding region as the name implies refers to
the DNA that codes for the proteins. These regions have certain locations where the
DNA sequence varies among individuals; this concept helped establish the science
of individualization based on the DNA sequence. The human genome project holds
the benefits in many fields including molecular biology, biotechnology, and bioin-
formatics and even to human evolution. It helps in understanding various diseases
caused by bacteria, viruses, and even autoimmune disorders. The Human Genome
25 DNA Phenotyping 347

Project further revealed that 99.9% of the DNA is identical among individuals. The
remaining fraction of DNA exhibited ‘DNA Polymorphism’; this term was used to
define the sites where differences in the DNA sequence of two individuals exist. The
sequencing of the entire human genome helped to identify and understand the
polymorphism of DNA sequences. This difference acts as genetic markers, and is
the basis of identification and individualization through DNA Profiling or DNA
fingerprinting based on DNA evidence. There are various kinds of polymorphism
that exist in the human genome, such as the Single Nucleotide Polymorphism, Short
Tandem Repeats, and Variable Number of Tandem Repeats (Collins et al. 1998).

25.4 Technology Used in DNA Phenotyping

In order to analyse the DNA extracted using various protocols, the DNA needs to be
quantified and qualitied. There are various techniques which can be used for the
analysis.
RFLP or Restriction Fragment Length Polymorphism was the first technique
developed for identifying the variation in the genetic makeup of individuals. This
technique was based on the variation of the DNA sequence at a specific location
recognized by certain restriction enzymes. The restriction enzymes have unique
characteristics of identifying target site in a DNA sequence and producing cuts at
these sites and leading to fragmentation of the DNA molecule. These restriction
enzymes exhibit high specificity for their target site and if there is variation in the
DNA sequence, the restriction enzyme would not act at that site. This would lead to a
variation in the fragment length produced by the enzyme. The restriction enzyme
selected for the process have specific target sites and produces fragments of known
length, and any variation in the resulting fragment indicates towards variation in the
sequence. The variation of the resultant fragments is detected by performing electro-
phoresis or hybridization.
In order to distinguish various molecules from one to another, a step for separa-
tion is followed to pull the different sizes of DNA fragments apart. The separation is
performed using the electrophoresis which is either conducted on slab gels or
capillary environment. In slab gel electrophoresis, a slab consisting of solid matrix
with a series of pores/holes inside a buffer solution through which the DNA
molecules pass when the electricity is provided. The gels formed can be further of
different types including Agarose Gels in which agarose is used to form a pore-like
structure on a flattened plate. The pore size is approximately 200 nm. They are easily
prepared using liquid agarose and Polyacrylamide Gels which have much smaller
pore size than agarose. In this, gels are formed due to cross linking of acrylamide and
bisacrylamide.
Capillary Electrophoresis is relatively a new outlook to this family. In this, the
steps like injection, separation, and detection can be fully automated. Here, the
movement of molecules are based on the size only but are detected because of
fluorescence molecule attached. The modern-day instrument, Genetic analyser, is
based on this technique only.
348 Astha et al.

RFLP technique does not perform well with degraded samples or when the DNA
extracted is in limited amount. To overcome this drawback, a better technique was
introduced, i.e. Amplified Fragment Length Polymorphism. In this technique, the
loci which is smaller than 1Kb was targeted using restriction enzymes amplified
using Polymerase Chain Reaction (PCR). These amplified fragments are separated
using Polyacrylamide Gel Electrophoresis (PAGE) and detected with the help of
silver staining technique. The advances made in the science of DNA analysis has
made the methods and the results more dependable and proficient and increased their
validity as evidence in the court of law.

25.4.1 DNA Databases

The recent advances in technology have played an eminent role in establishing DNA
databases, which are being used worldwide to store the genetic information of
individuals by law enforcement agencies for faster identification of individuals in
criminal investigation. In the year 1995, the UK established the one of the world’s
National databases for DNA matching and information termed NDNAD in which
DNA data from England and Wales were uploaded and accessed. Though Northern
Ireland and Scotland have their own database but they do contribute in
NDNAD (Johnson et al. 2003). The major DNA database CODIS is maintained by
FBI, USA, in 1998, where it stores the genetic information based on STR or short
tandem repeats of an individual to aid in identification and comparison. They
selected 13 STR loci that were selected for the data generation. There are various
other countries including Austria, Germany, Netherlands, and various others that
introduced their own databases by the end of 1998. Also, the criteria for the entry in
database as well as removal criteria depends on Country’s database rules and
regulation (Francisco Corte-Real 2004).
CODIS has three hierarchical levels, the Local DNA Index System (LDIS) which
is maintained by the crime laboratories functioning in police departments and local
agencies (Fig. 25.2). All the data generated by LDIS is further transmitted and stored
at State DNA Index System (SDIS) and National DNA Index System (NDIS) which
is operated by the state laboratories. SDIS also acts as a bridge between LDIS and
NDIS.
.

25.5 Forensic Applications of DNA

The uniqueness of the DNA sequence of an individual is the basis of the role DNA
play in forensic investigation. No two individual exhibits the same DNA profile;
recent scientific research has identified criteria of variation among the DNA
sequence of identical twins. The variation in the DNA sequences of individuals
has helped forensic scientists link or dismiss individuals as the source of given
biological evidence in question. Since its origin, DNA evidences have been utilized
25 DNA Phenotyping 349

Fig. 25.2 Schematic diagram of hierarchical set-up of CODIS. It explains the maintaining body of
this database while LDIS are the level which contribute to the database

to solve many old crimes as well as help establish the innocence of previously
convicted individuals.
Forensic Analysis aims to help the investigation by revealing the facts based on
the evidences. Identification and Individualization of evidences are two key concepts
of forensic analysis. Edmund Locard gave the “Locard Transfer Theory” or
“Locard’s Exchange Principle” to explain the exchange or transfer of traces from
one object to another during a contact between the two. This principle formed the
basis of comparing evidences in forensic investigation. The evidences are analysed
and compared with the reference samples by the forensic scientist to establish an
association between them, concluding whether they are similar or originated from
the same source or not. The science of DNA Analysis is a combination of various
disciplines of science such as Molecular Biology, Genetics, Statistics, and Biochem-
istry. The science of genetics explains the concepts for use of DNA in paternity
issues through heredity of traits by individuals from their biological parents. DNA
analysis is successful because DNA is a comparatively more stable for longer
durations of time, than many of the genetic markers analysed in forensic analysis.
DNA Analysis is now an important entity in the criminal justice system, where it
helps in the delivery of justice.
DNA evidence is one of the major biological evidence in crime investigation. The
matching of DNA profiles is performed to establish the presence of a person at a
scene of crime. They help link individuals to crimes or to establish their innocence.
DNA Profiling is also used to establish relatedness, such as paternity, maternity,
siblings, etc., among individuals in dispute owing to the fact that DNA sequence
follow a defined inheritance pattern, i.e. both the parents equally contribute half of
their chromosome to their progeny which on analysis helps establish the biological
350 Astha et al.

link between them. DNA also has role in determining bio-geographical ancestry
using Ancestry informative markers (Phillips 2015) and single nucleotide polymor-
phism. Externally visible characteristics can be identified using prediction of pheno-
typic characteristics through established DNA markers.
DNA for forensic analysis can be obtained from a number of biological sources.
DNA is present in almost all types of body cells, thus most of them serve as sources
of DNA for analysis. Biological sources of DNA involve the biological fluids, such
as blood, semen, saliva, etc., and the stains generated by these fluids. Biological
materials such as Bone, Tooth, Nail, Tissue, etc., are also used to extract DNA.
Many surfaces or objects remain in direct contact with the human body. Many
objects or surfaces have the cells of the body transferred to them via the contact
made with individuals. These cells may remain attached to these objects or surfaces,
from where these cells can be utilized to extraction of DNA. Certain objects acquire
the cells of an individual and when they come in contact with them, the cells adhere
to them and thus these objects or surfaces serve as evidentiary material for the
extraction of DNA. Many of these sources are commonly encountered at various
scenes of crime, and help provide DNA-based evidence for investigation. One of the
most common and frequently encountered biological evidence at the scene of crime
is Blood. They are found at crime scenes ranging from homicide, assault, robbery,
kidnapping, etc., and are also collected by doctors and medico-legal examiners from
victims and suspects to serve as reference for analysis in investigation. In blood, the
White Blood Cells or Leucocytes are the source of nuclear DNA, the red blood cells
of blood lack nuclei, i.e. they are enucleated to facilitate their role in transport of
oxygen. In forensic science, DNA plays a significant role in individualization. The
development of DNA Profiling by Alec Jeffreys in 1984 began the incorporation of
DNA profiling in forensic science. DNA fingerprinting helped solve immigration
cases (Jeffreys et al. 1985) in its wake and found its first forensic application in the
Enderby murder case, Leicestershire (Wong et al. 1987) where it helped to prove
innocence of a previously accused individual and finding the true culprit. The
method of DNA profiling advanced to using Short Tandem Repeats (STR) for
profiling, used for the first time in 1990 with the war crime investigation for
identification of skeletal remains of a war criminal (Jeffreys et al. 1992).
Tetranucleotide Short tandem repeats developed as an improvement to the system
giving better profiles for analysis (Edwards et al. 1991). Genetic profiles are con-
ventionally generated from DNA isolated from sources such as old and new
biological stains (Blood, Semen, Saliva, and Vaginal Secretions), Cigarette buds,
Hair samples, Bones, etc. A significant development came in 1997 with the
innovation of extraction of DNA from touched object began, allowing the extraction
of DNA from numerous surfaces in contact with the body (van Oorschot and Jones
1997). The minute quantities of biological sample left at a crime scene are used to
generate a DNA profile that can be compared to a database or to a reference sample
from suspect or victim. The first DNA-based database was developed by Michael
Howard for the United Kingdom in 1995 to store DNA profiles of criminals.
A DNA profile is representative of unique region in the non-coding part of an
individual’s genome such as short tandem repeats or STRs which are nucleotide
25 DNA Phenotyping 351

repeats present at specific locations or loci and the numbers of repeats varies among
individuals. Human identification based on the genetic profiling obtained from
studying polymorphism is one of the standards accepted worldwide. STRs are a
type of length polymorphism and approximately one million of them has been
identified in the human genome (Marcińska et al. 2015). The profiling recruits
about 13 of these STR markers and the profile provide the numbers of repeats at
each of these locations for the tested sample. These STR loci are approved by the
international scientific community for DNA profiling for forensic purposes. The
markers are highly variable and the set number of tested loci provides a profile with a
probability high enough to reduce the possibility of same profile for two individuals
unless they are identical twins.

25.5.1 Future of Forensics: DNA-Based Phenotyping

“DNA fingerprinting” technique is commonly used by forensic scientists to identify

individuals to help in the investigation process. The DNA profiling technique is a
very popular and commonly practiced technique; however, despite its success rate,
every year many crimes go unsolved due to lack of reference samples for comparison
and identification and lack of other forensic evidences.
To overcome the limits of DNA profiling and to get better profiling, there was a
need to explore more of the data that DNA contains about an individual. This led to
the use of DNA-based phenotyping techniques for better profiling. DNA
phenotyping involves the analysis of the DNA markers of an individual to predict
their externally visible characteristics or phenotypic characteristics to generate a
profile for identification. The analysis does not provide a certain result but predict the
phenotypic characteristics of an individual to a degree of probabilistic likelihood
(Samuel and Prainsack 2019). The analysis provides prediction of visible
characteristics like eye colour, hair colour, hair type, skin tone, and facial
characteristics (Walsh et al. 2017). The phenotype expressed by an individual
depends on the genotype and the epigenetic influence on the genetic material of an
individual. More than one gene can contribute to the expression of a phenotype and
the role of epigenetic impact on the expression makes prediction a complex process.
Many of the genes contributing to the visual characteristics of an individual have
been identified by scientists. The knowledge of the genes or the set of genes
contributing to the resulting phenotype are now a potential knowledge bank for
forensic scientists for the future of individual identification. Prediction models based
on the identified markers and their expression profiles are developed based on
molecular, statistical, and computational analysis.

25.5.2 Case Studies

In 2001, a sexual assault case in USA was investigated using DNA phenotyping to
predict the physical characteristics of the culprit in the absence of match with the
352 Astha et al.

database. The phenotypic analysis predicted the hair, eye, and skin colour of the
culprit, which was later used for profiling in the neighbouring area. The search led to
identification of an individual which was later confirmed through matching of STR
profile of the biological evidence from the scene with the culprit. In 2017, an 8-year-
old murder case in United states was resolved with arrest of the culprit through
ancestry details provided by DNA phenotyping that contradicted the earlier profile
the police assumed of the culprit.
A 41-year-old cold case got a lead through DNA phenotyping of a recovered skull
in New Castle County, Delaware, by providing ancestry details and physical
characteristics of the victim. A 1994 cold case of sexual assault and murder from
Montgomery County, Maryland, was resolved using DNA-based phenotyping to
apprehend the culprit in 2018. The culprit was wanted for similar offence in a similar
older case as well.

25.5.3 Legal and Ethical Aspects

DNA profile for individual identification is based on STR profiling from the
non-coding region of the DNA and this provides no personal information. However,
the biggest concern for DNA phenotyping is the invasion of privacy due to the
analysis outcome. There are arguments about the amount of information that become
available to law enforcement officials if phenotyping is allowed. The collection and
retention of samples for the use in forensic DNA has led to the quite rapid develop-
ment and its associated law practices. Medical history among other personal infor-
mation becomes susceptible to be extracted without consent if phenotyping is carried
out in an unregulated way. Racial stereotyping also remains an issue at the interna-
tional level where extradition of ancestry and phenotypic characteristics would add
to the problem of racial profiling (Koops and Schellekens 2007). The discrimination
concern was the reason Germany was reluctant in adopting DNA phenotyping in
their investigation process. The issues include a surge for racial disparities. In
France, a long debate regarding the “DNA fingerprints” was raised where they stated
the major ethical issues with this technique to identify individuals as potential
criminals and the risk of private investigation in cases like paternity or with insur-
ance companies. This is the reason why in 1994 the French Parliament adopted one
of strict laws and recommendation of usage of such databases is only permitted to
accredited laboratories. This has reduced the difficulty in implementation of DNA
fingerprinting for the criminal justice system (Machado and Silva 2019).
The concerns regarding DNA phenotyping are worth addressing while adopting
the process in investigation process of law enforcement bodies. The process should
aim at protecting the privacy and dignity of general public. Ensuring these criteria
would help acceptance of the process in investigation and overcome the concern of
utilization of the technique for targeting and discrimination towards individuals or
groups. In France, a strict procedure is followed for all the genetic tests which comes
under bioethics laws (1994) of the respective country in which the physician has to
obtain consent from the individual before the test is actually carried out.
25 DNA Phenotyping 353

25.5.4 Limitations

DNA phenotyping does not provide a conclusive result as DNA profiling. In DNA
phenotyping approaches, the analysis is affected by the complexity of fact that many
physical traits are manifested as quantitative traits which are governed by a number
of factors and coupled with variation arising due to environmental and lifestyle-
based factors. The analysis involves complex mathematical models and statistical
analysis to give results of high accuracy. The genomic data of the Indian population
is limited and the genetic makeup of the diverse populations is very much unex-
plored. There is a need for extensive genomic data on various populations to
generate a model with sufficient accuracy to provide dependable results. The cur-
rently available models have their data obtained from European populations and thus
the results may not be appropriate for Indian population studies. The IrisPlex system,
popular for phenotyping of eye colour from DNA samples of the European popula-
tion, did not demonstrate the same accuracy in samples from Asian populations,
suggesting that more studies should be performed on more distinct population
samples.

Multiple Choice Questions

1. Genes that exist as an alternate expression at a particular locus are known as

(a) Loci.
(b) Antigen.
(c) Allele.
(d) Phenotype.
Answer (c)
2. Which locus is used for determining male as well as female gender in DNA
fingerprinting?
(a) DYS 19.
(b) DYS 393.
(c) Amelogenin.
(d) Y-plex ladder.
Answer (c)
3. Short fragments of DNA that are labelled with radioactive tags are known as
(a) Probes.
(b) Primers.
(c) STRs.
(d) VNTRs.
Answer (a)
4. VNTR is a type of
(a) Length Polymorphism.
(b) Sequence Polymorphism.
(c) Both of the above.
(d) None of the above.
Answer (a)
354 Astha et al.

5. The rate of migration of DNA within an agarose gel in the gel electrophoresis
procedure is primarily based on
(a) The volume of the DNA sample loaded.
(b) The size of the DNA fragment.
(c) The number of DNA fragments.
(d) The negative charge of the DNA.
Answer (b)
6. STR DNA analysis can help us in determining which of the following?
(a) Age of an individual.
(b) Race of an individual.
(c) Sex of an individual.
(d) Height of an individual.
Answer (c)
7. RFLP determines which of the following?
(a) Power of discrimination (PD)
(b) Variation in the length of a defined fragment of DNA.
(c) Hundreds of variations at each locus.
(d) Age of bloodstain.
(e) Choose the most appropriate answer from the options given below:
(f) d, a, and c only.
(g) b, d, and c only.
(h) a, b and c only.
(i) a, d, and b only.
Answer (c)

References
Chaitanya L, Breslin K, Zuniga S, Wirken L, Pośpiech E, Kukla-Bartoszek M et al (2018) The
HIrisPlex-S system for eye, hair and skin colour prediction from DNA: introduction and forensic
developmental validation. Forensic Sci Int Genet 35:123. https://doi.org/10.1016/j.fsigen.2018.
04.004
Collins FS, Patrinos A, Jordan E, Chakravarti A, Gesteland R, Walters L, Members of the DOE and
NIH Planning Groups (1998) New goals for the US human genome project: 1998-2003. Science
282(5389):682–689
Corte-Real F (2004) Forensic DNA databases. Forensic Sci Int 146:S143–S144
Edwards A, Civitello A, Hammond HA, Caskey CT (1991) DNA typing and genetic mapping with
trimeric and tetrameric tandem repeats. Am J Hum Genet 49(4):746–756. https://pubmed.ncbi.
nlm.nih.gov/1897522
Eiberg H, Mohr J (1996) Assignment of genes coding for Brown eye colour (BEY2) and Brown hair
colour (HCL3) on chromosome 15q. Eur J Hum Genet 4(4):237–241. https://doi.org/10.1159/
000472205
Fujimoto A, Kimura R, Ohashi J, Omi K, Yuliwulandari R, Batubara L et al (2007) A scan for
genetic determinants of human hair morphology: EDAR is associated with Asian hair thickness.
Hum Mol Genet 17(6):835–843. https://doi.org/10.1093/hmg/ddm355
Fujimoto A, Nishida N, Kimura R, Miyagawa T, Yuliwulandari R, Batubara L et al (2009) FGFR2
is associated with hair thickness in Asian populations. J Hum Genet 54(8):461–465. https://doi.
org/10.1038/jhg.2009.61
25 DNA Phenotyping 355

Gill P, Jeffreys AJ, Werrett DJ (1985) Forensic application of DNA ‘fingerprints’. Nature
318(6046):577–579. https://doi.org/10.1038/318577a0
Jeffreys A (2005) Genetic fingerprinting. Nat Med 11:1035–1039. https://doi.org/10.1038/
nm1005-1035
Jeffreys AJ, Allen MJ, Hagelberg E, Sonnberg A (1992) Identification of the skeletal remains of
josef mengele by DNA analysis. Forensic Sci Int 56(1):65–76. https://doi.org/10.1016/0379-
0738(92)90148-P
Jeffreys AJ, Brookfield JFY, Semeonoff R (1985) Positive identification of an immigration test-case
using human DNA fingerprints. Nature 317(6040):818–819. https://doi.org/10.1038/317818a0
Johnson P, Williams R, Martin P (2003) Genetics and forensics: making the national DNA
database. Sci Stud (Helsinki, Finland) 16(2):22
Kayser M, Liu F, Janssens ACJW, Rivadeneira F, Lao O, van Duijn K et al (2008) Three genome-
wide association studies and a linkage analysis identify HERC2 as a human iris color gene. Am J
Hum Genet 82(2):411–423. https://doi.org/10.1016/j.ajhg.2007.10.003
Koops BJ, Schellekens M (2007) Forensic DNA phenotyping: regulatory issues. Colum Sci Tech L
Rev 9:158
Machado H, Silva S (2019) What influences public views on forensic DNA testing in the criminal
field? A scoping review of quantitative evidence. Hum Genomics 13(1):1–13
Marano L, Fridman C (2019) DNA phenotyping: current application in forensic science. Res Rep
Forensic Med Sci 9:1–8. https://doi.org/10.2147/RRFMS.S164090
Marcińska M, Pośpiech E, Abidi S, Andersen JD, van den Berge M, Carracedo Á et al (2015)
Evaluation of DNA variants associated with androgenetic alopecia and their potential to predict
male pattern baldness. PLoS One 10(5):e0127852. https://doi.org/10.1371/journal.pone.
0127852
Medland SE, Nyholt DR, Painter JN, McEvoy BP, McRae AF, Zhu G et al (2009) Common
variants in the Trichohyalin gene are associated with straight hair in Europeans. Am J Hum
Genet 85(5):750–755. https://doi.org/10.1016/j.ajhg.2009.10.009
Phillips C (2015) Forensic genetic analysis of bio-geographical ancestry. Forensic Sci Int Genet 18:
49. https://doi.org/10.1016/j.fsigen.2015.05.012
Samuel G, Prainsack B (2019) Forensic DNA phenotyping in Europe: views “on the ground” from
those who have a professional stake in the technology. New Genet Soc 38(2):119–141. https://
doi.org/10.1080/14636778.2018.1549984
Stokowski R, Pant P, Dadd T, Fereday A, Hinds D, Jarman C, Cox D (2008) A Genomewide
association study of skin pigmentation in a south Asian population. Am J Hum Genet 81:1119–
1132. https://doi.org/10.1086/522235
Sulem P, Gudbjartsson DF, Stacey SN, Helgason A, Rafnar T, Jakobsdottir M, Stefansson K (2008)
Two newly identified genetic determinants of pigmentation in Europeans. Nat Genet 40(7):
835–837. https://doi.org/10.1038/ng.160
Sulem P, Gudbjartsson DF, Stacey SN, Helgason A, Rafnar T, Magnusson KP, Stefansson K (2007)
Genetic determinants of hair, eye and skin pigmentation in Europeans. Nat Genet 39(12):
1443–1452. https://doi.org/10.1038/ng.2007.13
Tully G (2007) Genotype versus phenotype: human pigmentation. Forensic Sci Int Genet 1(2):
105–110. https://doi.org/10.1016/j.fsigen.2007.01.005
van Oorschot RAH, Jones MK (1997) DNA fingerprints from fingerprints. Nature 387(6635):767.
https://doi.org/10.1038/42838
Walsh S, Chaitanya L, Breslin K, Muralidharan C, Bronikowska A, Pospiech E, Kayser M (2017)
Global skin colour prediction from DNA. Hum Genet 136(7):847–863. https://doi.org/10.1007/
s00439-017-1808-5
Walsh S, Lindenbergh A, Zuniga S, Sijen T, Knijff P, Kayser M, Ballantyne K (2010) Develop-
mental validation of the IrisPlex system: determination of blue and brown iris colour for forensic
intelligence. Forensic Sci Int Genet 5:464–471. https://doi.org/10.1016/j.fsigen.2010.09.008
356 Astha et al.

Walsh S, Liu F, Wollstein A, Kovatsi L, Ralf A, Kosiniak-Kamysz A, Kayser M (2013) The

HIrisPlex system for simultaneous prediction of hair and eye colour from DNA. Forensic Sci Int
Genet 7(1):98–115. https://doi.org/10.1016/j.fsigen.2012.07.005
Weedon MN, Lango H, Lindgren CM, Wallace C, Evans DM, Mangino M, Consortium, C. G. E. M
(2008) Genome-wide association analysis identifies 20 loci that influence adult height. Nat
Genet 40(5):575–583. https://doi.org/10.1038/ng.121
Wong Z, Wilson V, Patel I, Povey S, Jeffreys AJ (1987) Characterization of a panel of highly
variable minisatellites cloned from human DNA. Ann Hum Genet 51(4):269–288. https://doi.
org/10.1111/j.1469-1809.1987.tb01062.x
Forensic Anthropology
26
Rutwik Shedge, Kam Salem Guite, Varsha Warrier, Tanuj Kanchan,
and Kewal Krishan

Abstract

Forensic Anthropology is the application of the science of anatomy, physical

anthropology, archaeology, and taphonomy to aid the law enforcement agencies
in recovery, examination, and identification of skeletal remains. It involves
determination of whether the material recovered at a scene of crime is
osteological, determination of species of origin, minimum number of contributors
of the skeletal remains, determination of ancestry of the individual, their sex, their
age, their stature, and any individualistic features that can assist in positive
identification of the remains.

Keywords

Forensic anthropology · Human identification · Osteobiography · Sex

determination · Age estimation · Stature estimation · Facial reconstruction · Skull-
photo superimposition

26.1 Definitions

Anthropology: Study of humans.

R. Shedge (✉)
School of Forensic Science, National Forensic Sciences University, Gandhinagar, Gujarat, India
K. S. Guite · V. Warrier · T. Kanchan
Department of Forensic Medicine and Toxicology, All India Institute of Medical Sciences, Jodhpur,
India
K. Krishan
Department of Anthropology, Panjab University, Chandigarh, India

# The Author(s), under exclusive license to Springer Nature Singapore Pte 357
Ltd. 2024
A. Puri et al. (eds.), Fundamentals of Forensic Biology,
https://doi.org/10.1007/978-981-99-3161-3_26
358 R. Shedge et al.

Forensic anthropology: Application of the science of physical anthropology,

archaeology, human osteology, and anatomy to aid law enforcement agencies in
human identification.
Osteobiography: Human identification by means of determining ethnicity, and
sex, and estimating age, and stature.
Forensic facial reconstruction: Process of constructing the face of an unknown
individual based on the underlying skeletal structure of their skull.

26.1.1 Introduction

The word ‘anthropology’ is a derivative of the new Latin word ‘anthropologia’

which meant ‘the study of humanity’, which in turn has its roots in the Greek word
‘anthropos’ which meant ‘human being’. The science of Forensic Anthropology
deals with the recovery, examination, and identification of human skeletal remains.
Forensic Anthropology is a multidisciplinary science that involves establishing
the identity of an unknown individual (Krogman 1962). A forensic anthropologist
needs to have thorough knowledge of a variety of subjects such as the human
anatomy, osteology, physical anthropology, bioarchaeology, and taphonomy. More-
over, some basic expertise in zoology, entomology, and forensic medicine is neces-
sary for excelling in this science.
A forensic anthropologist deals with generating the biological profile of an
unknown individual, which also known as the person’s osteobiography (Saul
1972). This involves finding out the individual’s ancestry, sex, age at death, and
their living stature. The general process of generating an individual’s biological
profile is detailed thoroughly in this chapter.

26.2 Locating and Recovering Skeletal Remains at a Scene

of Incidence

Examination of skeletal remains begins with recovery of skeletal remains. Usually,

skeletal remains buried in shallow graves are found accidently, or through the means
of an eyewitness or an informant who can lead the police to the general area where
the remains are buried (İşcan and Steyn 2013). In such cases, surface indicators of
skeletal remains may be present, but they are of transient nature and can easily get
destroyed or lost due to vagaries of nature and activity of scavengers. Multiple
methods, from rudimentary observation to sophisticated techniques, exist for locat-
ing graves and skeletal remains (İşcan and Steyn 2013).
Usually, the surface changes of soil and its vegetation cover are assessed to find
graves. When a perpetrator hides their victim’s body by burial, they fill the grave of
the victim with soil. Initially, the level of grave soil is equal with its surrounding.
However, in the first few months after burial, there occurs a primary depression in
the grave due to compaction of soil and decomposition of the victim’s body. Since
the largest volume to collapse during decomposition is the thorax, there may be
26 Forensic Anthropology 359

observation of a secondary depression. The extent of both the depressions depends

upon the type of soil, extent of water in the soil, depth of the grave, etc. (Krogman
1962).
Often, excess amount of soil may be dumped over the cadaver to hide it, and will
result in the formation of a mound or pile of soil. There may be a colour difference in
the resultant pile of soil and the surrounding soil due to intermixing of the soil from
the grave and that on the surface. This colour change may be appreciable for a
limited time.
Another indicator of the presence of a grave is the general vegetation cover of the
land. Initially, when the body is buried, the surface of the grave may be completely
devoid of any vegetation, or be covered with uprooted plants from the neighbouring
areas (Adovasio and Dirkmaat 1996). As the time passes, newer plants will start
growing from the grave. The first plants to appear will be weeds, and can often be
distinguished from the plants present in the surrounding areas. In case of shallow
grave, the growth of newer plants is prolific on the account of the nutrients present in
the grave soil due to decomposition of the cadaver.
Scavenger activity can aid the law enforcement agencies in finding buried
cadavers. Animals usually scavenge shallow graves, and the presence of seemingly
random holes or disturbed soil beds can indicate the presence of a grave. Similarly,
the animals could also disturb personal belongings or bones of the cadaver and bring
them to the surface. Presence of these bone fragments or scraps of clothing can
indicate the presence of a buried body (Haglund et al. 2001).
Apart from accidental recovery, gross observations, and standard crime scene
search methods, sophisticated tools can also be used to find a grave. One of the most
basic tools that a searcher may utilise is the metal detector. However, metal detectors
are non-specific, and will find buried metal objects irrespective of whether they are
linked to a cadaver or not. Due to advent of remote sensing technologies, scientists
now have in their arsenal techniques such as ground penetrating radar, GPS, thermal
scans, magnetometry, infrared and aerial photography, etc., that can be used for
searching of graves (İşcan and Steyn 2013).
Once the site where the cadaver is identified, the extremely vital task of recovery
of skeletal remains begins. As with crime scene investigation, securing the general
area of the grave is of great importance. Barricading tape, ropes, wooden planks, etc.,
are utilised to cordon off a wide area around the grave. Only essential personnel are
allowed to enter the barricaded area. Depending upon the landform of the area, extra
precautions should be taken. For instance, if the grave is located near a flowing water
body, additional searchers must be sent along the path of water flow to search for any
skeletal evidences. In case the grave is near a slope, the searchers should look for
skeletal evidences at the end of the slope, as bones such as skull may roll down the
slope and get deposited elsewhere. During the recovery of skeletal remains, exhaus-
tive and thorough documentation should be done. Clear and precise notes should be
made, and everything should be photographed while upholding the highest
standards. Mapping of evidence and sketching their location on the scene is also
advised. The process of recovery should be conducted in a manner that preserves the
360 R. Shedge et al.

integrity of the skeletal remains, and none of the osteological evidences should get
damaged.
Vegetation should be cleared from the surface of the grave with gardening tools.
The plants removed from the grave should be treated as botanical evidences and thus
preserved as such. The entire surface of the grave and some of its vicinity should be
marked with a grid pattern. This can be done using thin ropes. The process of
excavation should involve careful removal of horizontal layers of soil matrix from
each of the grid squares. The removal should follow the natural strata of the soil, and
excavation layers should not exceed 15 cm. This can be done using a gardening
trowel until the actual evidences start appearing. Upon discovering any evidence,
prompt documentation by means of note making and photography should be done
(Krogman 1962). Different coloured flags may be used to mark different types of
evidences. Red flags may be used to show skeletal material, yellow flags may be
used to show any plastic evidences, and blue flags may be used to show metal
objects. Once sufficiently photographed, the surface of the evidence should be
cleaned using a brush and photographed again. The entire process of cleaning,
marking, and documenting is repeated for all the evidences. None of the evidences
should be removed from the grave until the excavation process is completed. While
taking photographs of the skeletal remains within the grave, an arrow pointing
towards the cardinal direction north should be placed within the grave, along with
a clearly visible scale. The soil removed from the grave during excavation should be
sieved to find fragmented and small bones. Once the grave along with its skeletal
remains is photographed, then the bones and other evidences are removed one by
one. The bones are placed in a tarpaulin sheet spread near the grave. After comple-
tion of recovery, the tarpaulin sheet is wrapped up and moved to a vehicle for
transport to the mortuary. In case the remains are only partially skeletonised, it may
be necessary to remove the entire body in one piece. In this case, similar procedure as
above is followed, with a tarpaulin sheet or a body bag is placed near the grave, and
the entire body is transferred to it. All the evidences are sent to the mortuary for a
detailed post-mortem examination and generation of a biological profile.

26.3 Developing Biological Profile from Skeletal Remains

Human identification is one of the most important tasks that a Forensic Anthropolo-
gist performs. Identification itself can be dubbed as either absolute identification or
partial identification. Absolute identification, also known as ‘complete’ identifica-
tion is when the identity of the deceased is established without any doubt or with
certainty. Methods of absolute identification include dactylography and DNA
profiling. Partial identification, also known as ‘incomplete’ identification is when
the identity of an unknown individual cannot be established with absolute certainty,
but can eliminate or narrow down a group of probable identities. Methods of partial
identification include determination of ethnicity and sex, estimation of age and
stature, ABO blood grouping, serum protein polymorphisms, enzyme typing, etc.
26 Forensic Anthropology 361

Case study: Skeletal remains of an individual were found near a river bank. Upon
its examination by Forensic Medicine experts and Forensic Anthropologists, it was
found that the skeleton belonged to a Caucasian female of age 16–18 years. Few of
the teeth of the deceased were preserved by the Anthropologists for DNA profiling.
The police used the information furnished by the anthropologists and compared it
with the details of individuals who had gone missing in the general vicinity in the
past few years. Police could thus ‘eliminate’ all the missing males, and
non-Caucasian females younger than 16 years and older than 18 years from their
search. Upon narrowing down to 2 possible victims, the DNA profile generated from
the teeth of the cadaver was compared to the DNA profiles of the possible victims’
parents, and ‘absolute’ identification of the deceased was done.
Human identification of the dead is of grave importance in both civil and criminal
cases.

Identification of human remains is done through a process of generation of the

cadaver’s biological profile, also known as ‘Osteobiography’. Osteobiography in
simpler terms is the biography of bones, and deals with answering questions such as
what ethnicity did the victim belong to, what their sex was, how old were they when
they died, what was their living stature, and whether there were any unique,
individualistic features in their skeleton, that can be used for absolute identification
of the victim. Determination of sex, and estimation of age and stature are considered
to be the ‘Big 3’ of human identification.
362 R. Shedge et al.

26.3.1 Determination of Ethnicity

Determination of ethnicity/ancestry of an individual (previously referred to as race)

is an important part of the osteobiography of the individual. Broadly speaking, there
are three major global ethnicities that a person can belong to: Caucasoids (European
descent), Mongoloids (Asian descent), and Negroids (African descent). Apart from
these, there exist multiple contemporary ethnic groups such as the Andamanoids,
Australoids, Incans, etc. (Blue et al. 2021). Determination of ethnicity is based on
individualistic features that can be appreciated externally on both recently dead
individuals and skeletal remains.
In recently dead individuals, indication of their ethnicity can be given by their
complexion, nature of hair, eyes, clothes, etc. (Table 26.1). The colour of skin of a
Caucasoid may range from fair (European descent) to wheatish or brown (Indian
descent) (Ubelaker 2006). Mongoloids have a yellowish complexion, while the
complexion of Negroids ranges from brown to black. Mongoloids, Negroids, and
Indian Caucasoids have eyes whose colour ranges from brown to black. European
Caucasoids may exhibit green, grey, or blue eye colour. The hair of Caucasoids is
usually wavy with a circular or oval cross section, and has even pigmentation.
Mongoloids usually have coarse and straight hair with circular cross section and
dark medulla, while Negroids have woolly or kinky hair which is densely pigmented
and oval in cross section (Ubelaker 2018).

Table 26.1 Differences in complexion, eye colour and hair of the three major ethnicities
Feature Caucasoids Mongoloids Negroids
Complexion Fair (Europeans) to Yellowish Brown to black
brown (Indians)
Eye colour Brown, and black to Brown, and black Brown, and black
blue, green, or grey
(Europeans)
Hair Wavy, evenly Straight, coarse, solid and Woolly/kinky, densely
pigmented, circular/ dark medulla, circular pigmented, oval cross
oval cross section cross section section
26 Forensic Anthropology 363

In putrefied bodies and skeletal remains, the aforementioned features may not
give a clear indication of an individual’s ethnicity, and hence other means are
utilised. Broadly, methods of ancestry determination from skeletal remains can be
classified into two groups: anthropometric methods and non-metric methods.
Anthropometric methods involve measurement of certain skeletal features that are
polymorphic in individuals of different ethnicities (Black and Ferguson 2011). On
the other hand, non-metric methods rely upon observation rather than measurement
of certain polymorphic features.
Anthropometric methods include calculation of different indices of the sull and
long bones. One of the most used indices to determine the ancestry of an unknown
individual is the cephalic index.

Maximum width of the skull

Cephalic Index = × 100
Maximum length of the skull

Negroids have a long and narrow skull, exhibit a cephalic index of less than
75, and are considered to be dolichocephalic (Greek origin: dolicho = long;
cephalic = head) (Akinbami 2014). Mongoloids have a short and wide sull, exhibit
a cephalic index of more than 80, and are considered to be brachycephalic (Greek
origin: brachy = short; cephalic = head) (Ngeow and Aljunid 2009). Caucasoids
have a round sull, exhibit a cephalic index that ranges between 75 and 80, and are
considered to be mesocephalic or mesaticephalic (Buretic-Tomljanovic et al. 2007).
Other indices that can be used to determine ethnicity are nasal index, brachial index,
crural index, humerofemoral index, and intermembral index (Table 26.2).
Non-metric methods for determination of ethnicity involve observation of skele-
tal features such as shape of forehead, shape of orbits, shape of nasal aperture,
inferior nasal margin, zygomatic projection, nasal spine projection, shape of palate,
etc. The aforementioned features are described in detail in Table 26.3.

26.3.1.1 Determination of Ethnicity from Dentition

The three major ethnicities have a few unique dental features that can be used in
generation of an unknown individual’s biological profile. Caucasoid individuals may
have an extra cusp on the mesiopalatal line of maxillary first molars. This additional
cusp is called the Cusp of Carabelli, and is observed only in Caucasoids (Bhavyaa
et al. 2021). Mongoloids may exhibit marked depressions in the lingual or palatal
side of their incisors, giving the teeth a shovel-shaped appearance and hence the
name – shovel-shaped incisors (Suzuki and Sakai 1964). While there is no unique
dental feature in Negroids, they do show higher prevalence of supernumerary teeth
(number of teeth greater than 32).
It is essential to understand that most forensic and biological anthropologists
agree that there are no distinct human races, and humans cannot be classified as such
based on their overt skeletal features. However, there exist a few similarities in the
skeletal framework of individuals from the same geographical location or origin.
While once upon a time the differences between individuals of two distant geo-
graphical locations may have been describable, centuries of population
 364

Table 26.2 Indices to determine ancestry

Index Caucasoid Mongoloid Negroid
nasal breadth Leptorhinae Mesorhinae Chamaerhinae
Nasal index = nasal height × 100
<47 47–51 >51
length of radius <75 >80 75–80
Brachial index = length of humerus × 100
Length of Tibia 83.3 86.2 83.6
Crural Index = Length of Femur × 100
of Humerus <72 >72 –
Humero - femoral index = Length Length of Femur × 100
of HumerusþLength of Radius >70 <70 –
Intermembral index = LengthLength of FemurþLength of Tibia × 100
R. Shedge et al.
26 Forensic Anthropology 365

Table 26.3 Ancestry determination using skeletal features

Feature Caucasoid Negroid Mongoloid
Forehead Elevated or raised Small and short Inclined
Orbital opening Angular Square/rectangular Rounded/circular
Palate shape Parabolic Hyperbolic Round
Nasal aperture Narrow and long Broad and square shaped Rounded
Nasal spine projection Prominent Small/not prominent Slightly prominent
Zygomatic projection Intermediate Small/not prominent Prominent
Nasal sill Sharp Guttered Intermediate

intermingling have diluted these polymorphic features (Krogman 1962). Hence,

determination of race, ancestry, or ethnicity is an inexact science, and must be
treated so by a Forensic Anthropologist while dealing with skeletal remains.

26.3.2 Determination of Sex

One of the important parts of developing an individual’s biological profile is

determination of their sex. The scientific basis for determination of sex of an
unknown individual using their bones is the presence of certain anatomical and
morphological areas that are dimorphic in males and females (Kanchan and Rastogi
2009). Wilton Marion Krogman estimated the accuracy of sex determination based
upon what skeletal material is present (Krogman 1962). According to him, forensic
anthropologists can determine the sex of an unknown individual with 100% accu-
racy if the entire skeleton is present. If only the pelvis and the skull are recovered, the
accuracy of sex determination falls to 98%. If only the pelvis of the individual is
recovered, anthropologists can determine the sex with 95% accuracy, and with 90%
accuracy if only the skull is recovered. If only long bones of an individual are
recovered, an anthropologist can determine whether the individual was a male or a
female with 80% accuracy (Tables 26.4, 26.5, 26.6, 26.7 26.8 and 26.9), (Fig. 26.1,
26.2, 26.3, 26.4, 26.5, 26.6, and 26.7).

26.3.3 Estimation of Age

Estimation of biological age of an individual is a vital cog in the process of

osteobiography. Age at death estimation is crucial in both civil and criminal law.
Broadly, age of an individual can be estimated based on their skeletal maturity
(Shedge et al. 2020, 2021), dental maturity (Kanchan et al. 2021), and in later ages,
using morphological changes of their bones and teeth (Gustafson 1947).

26.3.3.1 Estimation of Age at Death Based on Skeletal Maturity

The bones of humans develop from a plethora of growth centres, also known as
ossification centres (Cunningham et al. 2016). These ossification centres are not only
366 R. Shedge et al.

Table 26.4 Determination of sex using pelvis (Krogman 1962)

Sl.
No. Criterion Males Females
1 General appearance Larger, thicker, tougher Smaller, thinner,
delicate
2 Muscle markings More prominent Less prominent
3 General shape Deep funnel shaped Flat bowl shaped
4 Iliac fossa Deep Shallow
5 Iliac crest Curves are less marked Curves are well marked
6 Preauricular sulcus Not prominent (sometimes Prominent and well
invisible) defined
7 Acetabulum Large, directed laterally Smaller, directed
anterolaterally
8 Obturator foramen Large, oval Small, triangular
9 Average width of greater 46.5 mm 51.5 mm
sciatic notch
10 Sciatic notch index 145 166
11 Ischial spine Inverted Everted
12 Ischial tuberosity Inverted Everted
13 Chilotic line Sacral part prominent Pelvic part prominent
14 Chilotic line index >100 <100
15 Body of pubis Narrow, triangular Wide, quadrangular
16 Symphysis pubis Higher, narrower Lower, wider
17 Pelvic brim Heart shaped Circular/elliptical
18 Pelvic outlet Smaller Larger
19 Subpubic angle 70–750, V-shaped 90–1000, U-shaped
20 Coccyx Inverted Everted

Table 26.5 Determination of sex using sacrum (Krogman 1962)

Criterion Males Females
Size and shape Longer and narrower Shorter and wider
Curvature Even Uneven
Sacral promontory Well-marked Less marked
Body of first sacral vertebra Larger Smaller
Inner curvature Uniformly curved Abruptly curved at the last
2 segments
Sacro – Iliac articulation Extend up to 21/2–3 Extend up to 2–21/2 segments
segments
Sacral index 105 115
Kimura’s base-wing index (alar 65 80
index)
Corpobasal index 45 40
26 Forensic Anthropology 367

Table 26.6 Determination of sex using skull (Krogman 1962)

Criterion Males Females
General appearance Larger, more muscle markings Smaller, less muscle markings
Architecture Rugged Smooth
Cranial capacity 1500–1550 cm3 1350–1400 cm3
Walls Thicker Thinner
Glabella More prominent Less prominent
Frontonasal junction Distinct angulation Smooth curve
Orbits: Size Smaller Larger
Orbits: Margins Rounded Sharp
Orbits: Shape Square Round
Supraorbital ridge Prominent Less prominent
Zygomatic arch Prominent Less prominent
Nasal aperture Higher and narrower Lower and wider
Parietal eminences Small Large
Occipital protuberance Prominent Less prominent
Occipital condyles Larger Smaller
Mastoid process Large and blunt Small and sharp
Digastric groove Deeper Shallower
Palate Larger, broader, U-shaped Smaller, narrower, parabolic
Foramen magnum Larger and oblong Smaller and rounder
Teeth Larger Smaller

Table 26.7 Determination of sex using mandible (Albalawi et al. 2019)

Criterion Males Females
General appearance Larger, thicker Smaller, thinner
Chin (symphysis menti) Square or U-shaped Pointed or V-shaped
Angle of body of ramus Less obtuse (<125°) More obtuse (>125°)
Appearance of angle Everted Inverted
Condyles Larger Smaller

Table 26.8 Determination of sex using sternum (Hunnargi et al. 2008)

Criterion Males Females
Sternal breadth Larger Smaller
Length of mesosternum >95 mm <80 mm
Ashley’s rule Total length > 149 mm Total length < 149 mm
Hyrtl’s law Body >2X manubrium Body <2X manubrium
Sternal index 46.2 54.3
368 R. Shedge et al.

Table 26.9 Determination of sex using femur (Purkait and Chandra 2004)
Criterion Males Females
General appearance Heavier, stronger, with Lighter, less prominent
prominent muscle markings muscle markings
Head Larger Smaller
Vertical diameter of head >46 mm <42 mm
Angle of neck with shaft/ 125° <125°
caputcollum-diaphyseal angle
Bicondylar width >78 mm <72 mm
Angle of shaft with condyles 80° 75°

Fig. 26.1 Anterior view of the male and female pelvic bones

Fig. 26.2 Male and female sacra

26 Forensic Anthropology 369

FEMALE MALE

Fig. 26.3 Human skull (normal frontalis)

FEMALE MALE

Fig. 26.4 Human skull (normal lateralis)

involved in the formation of long bones, but also the short, flat, and irregular bones
of the human skeleton. While it is a known fact that adult humans have 206 bones, a
lesser-known fact is that the human foetus at the age of 11 weeks, has 806 ossification
centres, and at birth it has about 450 ossification centres (Krogman 1962). Between
11th week to the final instance of epiphyseal union, 600 odd centres of bone growth
coalesce in a fairly defined sequence.
370 R. Shedge et al.

Fig. 26.5 Human mandible (lateral view)

Fig. 26.6 Human mandible (inferior view)

Prenatal Ossification
The age of a foetus can be determined based on the appearance of ossification centres
during the intrauterine life (IUL) (Krogman 1962). A few of the important centres of
ossification are outlined below in Table 26.10.

Postnatal Ossification
After birth, the primary centres of ossification grow and coalesce with secondary
centres to form bones of the human body. The union of secondary ossification
centres of the long bones (present in the epiphysis) with the primary ossification
centre (diaphysis) is termed as epiphyseal fusion, and is mostly used in case of age
estimation of skeletal remains (Krogman 1962). The appearance of ossification
centres and their fusion for different bones are outlined in the following table
(Table 26.11).
26 Forensic Anthropology 371

Fig. 26.7 Human sternum (illustrator to modify this image)

26.3.3.2 Estimation of Age Using Cranial Suture Closure

The skull of an infant is made up of 6 separate bones: the frontal bone, the occipital
bone, a pair of parietal bones, and a pair of temporal bones. These bones are
connected together by means of robust fibrous tissues known as sutures. As an
individual grows older, these sutures start fusing, which is termed as closure or
obliteration of sutures (Shedge and Kanchan 2019; Fan et al. 2020; Ruengdit et al.
2020). Different sutures of the human skull get obliterated at different time intervals,
and this can allow forensic anthropologists to predict the age of death of an individ-
ual. The closure of cranial sutures begins endocranially first (5–7 years before
ectocranial suture). The time ranges at which the different cranial sutures close are
detailed in the Figure 26.8.
372 R. Shedge et al.

40-50 20-
30

2-
0 M
-6

4
et
50 al 50-60 op

C or
gitt ic
Sa

ona
l
40

40-50
30-

s
ou
80

m
50-60
ua
Sq
50-60
La
m
bd 60-70
oi
d

40-50

Fig. 26.8 Cranial sutures and their time of obliteration

Basi-occiput and basi-sphenoid sutures (not shown in the figure) get obliterated at
the age of 18–20 years.

26.3.3.3 Estimation of Age Using the Pubic Symphysis

A symphyseal cartilage separates the left and the right pubic bones in the pelvic
girdle. The surface of the pubic bones in this region undergoes certain morphological
changes that can be used to estimate an individual’s age (Warrier et al. 2021). the
morphological changes of the pubic symphysis as well as the age at which they are
observed, are detailed below (Table 26.12).

26.3.3.4 Estimation of Age Using the Mandible

As the age of an individual increases, their mandible starts exhibiting certain
morphological changes (Aggrawal). These changes are detailed below
(Table 26.13).
26 Forensic Anthropology 373

Table 26.10 Prenatal Ossification centre Appearance

ossification centres and
Occipital bone Weeks 8–10
their time of appearance
Temporal bone Weeks 7–8
Parietal bone Weeks 7–8
Frontal bone Weeks 6–7
Maxilla Week 6
Mandible Week 6
Clavicle 5–6 weeks of IUL
Centra of C4-S2 Month 3
Centra of C2–3 & S3–4 Month 4
Shaft of humerus Week 6
Shaft of radius Week 7
Shaft of ulna Week 7
Shaft of femur Week 7–8
Shaft of tibia Week 7–8
Shaft of fibula Week 8
Ilium Month 2–3
Ischium Month 4–5
Pubis Month 6–8
Centra of C2–3 & S3–4 Month 4

26.3.3.5 Estimation of Age Using Dentition

Teeth are one of the most reliable features of the human body that can be used to
estimate the age of an unknown individual. Teeth follow a predictable and fixed
pattern of development and eruption that is used for estimation of age. Humans have
two sets of dentitions. The first set of teeth that erupt is known as the primary
dentition or the deciduous teeth. These teeth start erupting at the age of 6 months,
and the entire set appears by the age of 2.5 years. The total primary dentition includes
20 teeth, with the dental formula being 2102 (2 incisors, 1 canine, 0 premolar,
2 molars). Falling off of deciduous teeth precedes eruption of secondary teeth.
Secondary teeth, also known as permanent teeth, first erupt at the age of 6 years.
The dental formula of secondary teeth is 2123 (2 incisors, 1 canine, 2 premolars, and
3 molars). The sequence and time or eruption of deciduous and permanent teeth are
detailed below (Table 26.14 and 26.15).
The third molar is an anomalous tooth, which may erupt anywhere between
17 and 25 years, or may never erupt at all.

26.3.3.6 Gustafson’s Method

After the age of 25 when all the teeth have erupted, one cannot estimate the age of an
individual based on the presence of teeth. However, age can be based on the
attritional changes of the teeth. One of the methods that utilises this is the
Gustafson’s method (Gustafson 1947). This method focuses on 6 changes in the
teeth: degree of attrition (wear and tear of the occlusal surface of the tooth), degree of
374 R. Shedge et al.

Table 26.11 Postnatal centres of ossification and their times of appearance and fusion
Bone Appearance Fusion
Clavicle
Medial end 11–19 years 18–25 years
Lateral end Puberty 19–20 years
Sternum
Manubrium 5 months With S1: >60 years
Sternebra 1 (S1) 5–6 months With S2: 25 years
Sternebra 2 (S2) 7–8 months With S3: 20 years
Sternebra 3 (S3) 7–8 months With S4: 15 years
Sternebra 4 (S4) 1 year With xiphoid process: >40 years
Xiphoid process 3–6 years With mesosternum: >40 years
Scapula
Coracoid Around 1 year 15–17 years
Sub coracoid 8–10 years 14–17 years
Acromion 14–16 years 18–25 years
Shoulder joint
Head of humerus 1 year All three unite at the age of 5–6 years to form the
Greater tubercle 3 years conjoint epiphysis of the shoulder
Lesser tubercle 5 years
Conjoint epiphysis 5–6 years 18–19 years
Elbow joint
Capitulum 1 year All three unite at the age of 14–16 years to form the
Trochlea 9–11 years conjoint epiphysis of the elbow
Lateral epicondyle 11 years
of humerus
Conjoint epiphysis 14–16 years 16–17 years
of elbow
Medial epicondyle 6–7 years 16–17 years
of humerus
Head of radius 5 years 16–17 years
Upper end of ulna 9 years 16–17 years
Wrist joint
Distal end of 2 years 17–18 years
radius
Distal end of ulna 5–6 years 17–18 years
Base of first 5–7 years 15–17 years
metacarpal
Pelvis
Iliac crest 14 years 20–21 years
Triradiate 13 years 15 years
cartilage
Ischiopubic ramus – 7–8 years
Ischial tuberosity 16 years 20–21 years
Head of femur 1 year 17–18 years
Greater trochanter 4 years 17–18 years
(continued)
26 Forensic Anthropology 375

Table 26.11 (continued)

Bone Appearance Fusion
Lesser trochanter 14 years 17–18 years
Knee joint
Lower end of 9th month of IUL 18–19 years
femur
Upper end of tibia 10th month of 18–19 years
IUL – At term
Upper end of 4 years 18–19 years
fibula
Ankle joint
Lower end of tibia 1–2 years 16–17 years
Lower end of 1–2 years 16–17 years
fibula
Calcaneus 6–8 years 14–16 years

Table 26.12 Age-based pubic symphyseal changes

Age Description
18–19 years Surface of the pubic symphysis is uneven, and shows the presence of horizontal
ridges which are separated by well-marked grooves
20–21 years Grooves between the horizontal ridges start getting filled near the dorsal end
22–24 years Dorsal margin gets more defined
25–40 years Lower extremity starts becoming clearer, ridges start disappearing, bony/ossific
nodule forms at upper extremity, outer margins get clearly defined
40–50 years Surface becomes oval and smooth, margin has narrow beaded rim
50+ years Symphyseal face becomes eroded, and shows erratic ossification. As the age
increase, disfigurement increases too.

Table 26.13 Age estimation using the mandible

Feature Infants Adults Elderly
Body Shallow, thin Thick and long Shallow
Coronoid Higher than Lower than condyloid Higher than condyloid
process condyloid process process process, with the neck of
condyloid process bent
backwards
Sigmoid Deep Deeper Shallow
notch
Angle of 140° 110°–120° 140°
ramus
Ramus Short, oblique Straight Posteriorly inclined
Mental Midway between Midway between upper Near the alveolar margin.
foramen upper and lower and lower margin, under
margin and is socket of second
directed forwards premolar
Mental Not well developed Well developed Moderately developed.
protuberance
376 R. Shedge et al.

Table 26.14 Eruption of Tooth Eruption Number of teeth

primary dentition in
Central incisor (lower) 6–8 months 2
humans
Central incisor (upper) 7–9 months 4
Lateral incisor (upper) 8–10 months 6
Lateral incisor (lower) 10–12 months 8
First molar 12–14 months 12
Canine 17–19 months 16
Second molar 20–30 months 20

Table 26.15 Eruption of Tooth Eruption Number of teeth

secondary teeth in humans
First molar 6–7 years 21–24
Central incisor 6–9 years 24
Lateral incisor 7–9 years 24
1st premolar 9–11 years 24
Second premolar 10–12 years 24
Canine 11–13 years 24
Second molar 12–14 years 25–28
Third molar 17–25 years 29–32

periodontosis (retraction of gums from the neck and neighbouring regions of the
tooth), degree of secondary dentin deposition (deposition of dentin in the pulp cavity
of the tooth), cementum apposition (deposition of newer layers of cementum around
existing one), root transparency (increase in transparency of the roots), and root
resorption (absorption of roots’ apex into the gum). These 6 changes are scored from
0 to 3, with 0 indicating no change, and 3 indicating massive change. Root transpar-
ency is considered to be the best parameter among these 6 for estimation of age.
Central incisors are found to be the best single indicator of age using the Gustafson’s
criteria. A combination of canines and first molars predicts the age using Gustafson’s
criteria better than the central incisor.

26.3.4 Estimation of Stature

Stature refers to an individual’s height, and is one of the most crucial parts of human
identification. On an average, an individual loses 0.6 mm of stature per year after the
age of 30 years on account of degenerative changes of the body (Krogman 1962).
Additionally, the stature of an individual is observed to be the maximum when lying
flat on their back (2–3 cm more than while standing). After death, due to primary
relaxation, the stature of an individual increases by 2–4 cm. However, once putre-
faction sets in, the spinal column shortens and causes the overall stature to decrease
by a cm.
26 Forensic Anthropology 377

26.3.4.1 Anatomical Method of Estimating Stature

Whenever the entire skeleton, or the cranium, vertebral column, hip bones, and at
least one complete lower limb are recovered, stature of the individual can be
estimated by the anatomical or the Fully method (Fully 1956). It involves arrange-
ment of the skeleton/bones in an anatomical position and recording of following
measurements:

1. Maximum height of the skull.

2. Distance between corpus of C2 and L5.
3. Length of anterior first sacral segment.
4. Physiological length of femur.
5. Maximum length of tibia.
6. Articulate height of talus and calcaneus.

As these measurements do not take into consideration the presence of soft tissues
in between the bones, soft tissue correction factors are used. After all the
measurements are recorded, soft tissue correction factors are added to the total,
and the resultant value is attributed as stature of the individual.

26.3.4.2 Mathematical Methods of Estimating Stature

In cases where only a few bones such as the long bones are recovered, anatomical
method of stature estimation cannot be applied. In such cases, forensic
anthropologists use mathematical methods for stature estimation. These mathemati-
cal methods have a simple premise: the length of any long bone of the human body is
proportional to the length of the body itself. Mathematical methods are of two types:
use of multiplication factors to estimate stature, and use of population specific linear
regression models to estimate stature.
Multiplication factors (MF) entail use of a number that can simply be multiplied
to the corresponding bone length to get the stature of an individual (Aggrawal). For
example, if the length of humerus of an unknown cadaver is 35 cm, and the
multiplication factor for humerus is 5.3, the estimated stature of the individual is
calculated to be 35 × 5.3 = 185.5 cm. the multiplication factors for different long
bones of the human body are as follows:

Bone Humerus Radius Ulna Femur Tibia/Fibula

MF 5.3 6.9 6.3 3.7 4.48

Linear regression models entail estimation of a person’s stature based upon their
bone length. Linear regression analysis is more accurate and has less error rate than
multiplication factors. Linear regression models for any particular population group
are first generated by conducting extensive research in that population group.
Lengths of different long bones of individuals belonging to the particular population
are recorded and regression analysis is conducted on the collected data. This leads to
generation of a regression model which looks like: Y = AX + B, where Y is the
378 R. Shedge et al.

stature of the person (independent variable), X is the length of the bone (dependent
variable), A is the slope of the regression line, and B is the y-intercept.

26.3.4.3 Estimation of Stature Using Fragmented Bones

Often times, the skeletal remains recovered consist of broken pieces or fragments of
long bones. Estimation of stature using such fragmented bones is vital, and involves
use of linear regression analysis (İşcan and Steyn 2013). In such cases, regression
analysis is done twice; first, the dependent variable is considered to be the bone
fragment and length of the bone is estimated, and then the estimated value of the long
bone is considered to be the dependent variable and stature of the individual is
calculated.

26.3.5 Individualisation of the Skeletal Remains

Determination of race and sex, and estimation of age and stature are used in partial or
incomplete identification of the skeletal remains. However, complete identification
of an individual requires a few extra steps. The most commonly employed method
involves isolation of DNA from either the bone marrow of long bones or from the
dental pulp, followed by STR analysis (Li 2021). This allows forensic
anthropologists to generate a DNA profile of the unknown individual, which may
later on be compared with antemortem data of the suspected deceased, or their
parents. Another method of individualisation is finding any surgical implants in
the victim’s bones, or presence of any dental work. Any surgical implants such as
rods, bolts, replaced nee/hip may have serial number that can be retrospectively
verified with a database to find out who the victim is. Even with dentition, evidences
of dental work may be compared with antemortem records to find out the identity of
the victim.

26.4 Restoration of Facial Details from the Skull

On a daily basis, humans are able to discriminate people they know from complete
strangers using a variety of features such as their voice, touch, feel, etc. However,
one of the biggest discriminating features, that humans rely upon the most, is the
face. In case of skeletal remains, identification of the deceased can rarely be done
based on identifying their facial features. However, since there is an undeniable
relationship between the face and its underlying skull, Forensic Anthropologists
have devised methods in which positive identification of a victim can be done based
on reconstruction of their facial features, or by comparing photographs of the
suspected victim’s antemortem photo and the photo of the deceased’s skull. These
two major methods of identification, forensic facial reconstruction and skull-photo
superimposition, are discussed in this chapter.
26 Forensic Anthropology 379

26.4.1 Forensic Facial Reconstruction

Forensic facial reconstruction, also known as forensic facial approximation is the

process of constructing the face of an unknown individual based on the underlying
skeletal structure of their skull. It involves careful layering and shaping of soft tissue
over the skull to achieve an approximation of how the individual looed when alive.
Forensic facial reconstruction is an amalgamation of art and science. Expertise in
human anatomy There are three major approaches of forensic facial reconstruction:

26.4.1.1 Anthropometrical/Tissue Depth/American Method

The anthropometrical method of forensic facial reconstruction involves use of tissue
depth measurements of a particular population group and was developed by
Krogman in 1946 (Gupta et al. 2015). Measurement of soft tissue thickness is
recorded at 21 distinct anatomical landmarks, and these measurements are used in
forensic case work. The tissue depth measurement is done by means of needles,
X-rays, ultrasound, or MRI. The 21 landmarks include 10 midline points and
11 bilateral points as mentioned below.

Midline landmarks Bilateral landmarks

Supraglabella Frontal eminence
Glabella Supraorbital
Nasion Suborbital
End of nasals Lateral orbit
Mid philtrum Zygoma
Upper lip border Inferior malar
Lower lip border Supra M2
Lip-chin fold Occlusal line
Mental tubercle Sub M2
Gnathion Gonion
Supraglenoid

When working on an unknown skull, pegs are placed on the aforementioned

21 landmarks. These pegs are of varying lengths, with their length corresponding to
the tissue thickness data acquired in previous studies. The spaces in between the pegs
are covered with clay. The clay is moulded while taking into consideration the
380 R. Shedge et al.

natural curvature and surface characteristics of the skull. Additional clay is moulded
until the surface of the previously attached pegs becomes invisible. The finished
skull is then photographed and compared with the antemortem photos of the
suspected victim.

26.4.1.2 Anatomical/Russian Method

The anatomical method of forensic facial reconstruction involves layering of
muscles, glands, and cartilages bit by bit on the unknown skull (Gupta et al.
2015). This method was developed by Mikhail Gerasimov in 1971, and requires
an acute and thorough knowledge of the facial anatomy and biomechanics. All the
different facial muscles, glands, and cartilages are shaped separately and then
layered upon the bare skull. The different soft tissues that are constructed out of
clay are: Temporalis muscle, masseter muscle, zygomaticus muscle, orbicularis oris,
parotid gland, buccal fatty pad, and the fat pad of chin. The anatomical method is
slower than the anthropometrical method, and is rarely used in the modern day
and age.

26.4.1.3 Combination/British/Manchester Method

The combination method, as the name suggests, involves aspects of both the
anatomical and the anthropometrical methods (Gupta et al. 2015). The skull is first
placed in the Frankfurt-horizontal plane using a tubular Craniophore, and pegs are
either attached to the different craniofacial landmarks, or are drilled into the skull. As
in the anthropometrical method, each peg length represents the average tissue
thickness/depth at the particular landmark. The different soft tissues mentioned in
the anatomical method section are constructed out of clay, and moulded onto the
skull at their points of origin or insertion.

26.4.1.4 Computerised 3D Forensic Facial Reconstruction

With the advent of 3D scanning technology in forensic science, the mode of
operation with respect to facial reconstruction has shifted from manual to a
computerised approach. These modern 3D scanners can scan the entirety of the
skull in a matter of minutes, and using a computer, facial approximation of the
unknown skull can be done by an individual with anthropological and computer
modelling skills (Shedge and Kanchan 2021).

26.4.2 Skull Photo Superimposition

Skull photo superimposition is a human identification method that involves compar-

ison of the skull of an individual with an antemortem photo of a missing individual
(Ubelaker et al. 2019). The antemortem photos of the suspected victim can be readily
acquired from the victim’s family, but they will rarely be to the scale and in a full-
frontal orientation. The challenge thus lies in manipulating the skull in such a
manner, that any photograph taken of the skull will be in the same alignment and
perspective as the antemortem photos, and can thus be superimposed with the
26 Forensic Anthropology 381

antemortem photo to observe whether the skull belongs to the individual in the
photo.
The entire process of the skull-photo superimposition begins with identifying
measurable objects in the antemortem photo to establish scale. For example, if the
antemortem photo that the family of the suspected victim gave to the investigators
consists of the victim wearing a floral shirt, the family of the suspected victim may be
asked to provide the same shirt to the investigators. The investigators can measure
the dimensions of the flower patterns present on the shirt that are visible in the photo,
and find out the magnification needed to enlarge the photo, so that the face of the
suspected victim can be made life-sized. Once the extent of magnification required is
found out, the original photo is magnified and printed as a positive transparency.
Simultaneously, the skull has to be oriented in the perspective identical to the
suspected victim’s face in the antemortem photograph. This orientation is achieved
by means of a Craniophore attached to a pulse-driven motor. Once identical orienta-
tion is achieved, a photograph of the skull is taken and printed onto a positive
transparency.
Both the positive transparencies are then placed above each other (superimposed)
and it is observed that whether both of them align together or not. While comparing,
the anthropologist conducting the entire process should be well versed with the
positional relationship of the skull and the face. A few of such relationships are as
follows:

26.4.2.1 Positional Relationship Concerning the Eyes

The lower border of eyebrows is generally located on the supraorbital margin, the
palpebral fissure falls approximately on the lower third of the orbital height, vertical
level of the inner canthus corresponds approximately to 10 mm below the dacryon,
and outer canthus corresponds approximately to 11 mm below the point at which the
zygomaticofrontal suture crosses the orbital margin.

26.4.2.2 Positional Relationship Concerning the Nose

Height of the nasion-subnasale (external nose) corresponds to the height of nasion-
subspinale (nasal aperture of the skull), the ala-to-ala measurement of the nose is
greater than the width of the nasal aperture by 5 mm in caucasoids, 8 mm in negroids,
and 6.5 mm in mongoloids.

26.4.2.3 Positional Relationship Concerning the Lips

Oral slit appears to coincide with the line formed by the bite, central point of the oral
slit (stomion) falls 1–2 mm higher than the upper central incisal surface, and Oral
angle (cheilion) generally lies on the junction of the canine and the first premolar.

Multiple Choice Questions

1. Cusp of Carabelli is a feature observed in the dentition of which population

groups?
382 R. Shedge et al.

(a) Caucasoids.
(b) Mongoloids.
(c) Negroids.
(d) Australoids.
Answer: (a)
2. Which of the following is the first deciduous tooth to erupt?
(a) First molar.
(b) Lower central incisor.
(c) Upper central incisor.
(d) Upper lateral incisor.
Answer: (b)
3. Which of the following teeth is the best for use in Gustafson’s method of dental
age estimation.
(a) First molar.
(b) Central incisor.
(c) Lateral incisor.
(d) Second molar.
Answer: (b)
4. According to Krogman, what is the accuracy with which the sex of an unknown
individual be estimated using only their pelvic bones.
(a) 80%
(b) 90%
(c) 95%
(d) 98%
Answer: (c)
5. Orbital margins of the female sex are ________.
(a) Blunt.
(b) Curved.
(c) Rounded.
(d) Sharp.
Answer: (d).

References
Adovasio J, Dirkmaat D (1996) The role of archaeology in the recovery and interpretation of human
remains from an outdoor forensic setting. In: Haglund W, Sorg M (eds) Forensic taphonomy.
CRC, Boca Raton, FL
Akinbami BO (2014) Measurement of cephalic indices in older children and adolescents of a
Nigerian population. Biomed Res Int 2014:527473. https://doi.org/10.1155/2014/527473
Albalawi A, Alam M, Vundavalli S et al (2019) Mandible: an indicator for sex determination—a
three-dimensional cone-beam computed tomography study. Contemp Clin Dent 10:69. https://
doi.org/10.4103/ccd.ccd_313_18
Bhavyaa R, Sujitha P, Muthu MS et al (2021) Prevalence of the cusp of Carabelli: a systematic
review and meta-analysis. Ann Hum Biol 48:572–584. https://doi.org/10.1080/03014460.2022.
2032339
Black SM, Ferguson E (eds) (2011) Forensic anthropology: 2000 to 2010. CRC, Boca Raton, FL
26 Forensic Anthropology 383

Blue MNM, Tinsley GM, Ryan ED, Smith-Ryan AE (2021) Validity of body-composition methods
across racial and ethnic populations. Adv Nutr 12:1854–1862. https://doi.org/10.1093/
advances/nmab016
Buretic-Tomljanovic A, Giacometti J, Ostojic S, Kapovic M (2007) Sex-specific differences of
craniofacial traits in Croatia: the impact of environment in a small geographic area. Ann Hum
Biol 34:296–314. https://doi.org/10.1080/03014460701211017
Cunningham C, Scheuer L, Black SM (2016) Developmental juvenile osteology, 2nd edn. Aca-
demic, Amsterdam
Fan F, Tu M, Li R et al (2020) Age estimation by multidetector computed tomography of cranial
sutures in Chinese male adults. Am J Phys Anthropol 171:550–558. https://doi.org/10.1002/
ajpa.23998
Fully G (1956) Une nouvelle methode de determination de la taille. Ann Méd Lég Criminol Police
Sci Toxicol 35:266–273
Gupta S, Gupta V, Vij H et al (2015) Forensic facial reconstruction: the final frontier. J Clin Diagn
Res JCDR 9:ZE26–ZE28. https://doi.org/10.7860/JCDR/2015/14621.6568
Gustafson G (1947) Microscopic examination of teeth as a means of identification in forensic
medicine. J Am Dent Assoc 35:720–724. https://doi.org/10.14219/jada.archive.1947.0323
Haglund W, Connor M, Scott D (2001) The archaeology of contemporary mass graves. Hist
Archaeol 35:57–69. https://doi.org/10.1007/BF03374527
Hunnargi SA, Menezes RG, Kanchan T et al (2008) Sexual dimorphism of the human sternum in a
Maharashtrian population of India: a morphometric analysis. Leg Med Tokyo Jpn 10:6–10.
https://doi.org/10.1016/j.legalmed.2007.05.011
İşcan MY, Steyn M (2013) The human skeleton in forensic medicine, 3rd edn. Charles C Thomas
Publisher, LTD, Springfield, IL
Kanchan T, Chugh V, Chugh A et al (2021) Age estimation using third molar maturation based on
Demirjian’s criteria. Leg Med Tokyo Jpn 53:101959. https://doi.org/10.1016/j.legalmed.2021.
101959
Kanchan T, Rastogi P (2009) Sex determination from hand dimensions of north and south Indians. J
Forensic Sci 54:546–550. https://doi.org/10.1111/j.1556-4029.2009.01018.x
Krogman WM (1962) The human skeleton in forensic medicine. Am J Phys Anthropol 20:227–229
Li R (2021) Forensic biology: identification and DNA analysis of biological evidence. CRC, Boca
Raton, FL
Ngeow WC, Aljunid ST (2009) Craniofacial anthropometric norms of Malaysian Indians. Indian J
Dent Res 20:313–319. https://doi.org/10.4103/0970-9290.57372
Purkait R, Chandra H (2004) A study of sexual variation in Indian femur. Forensic Sci Int 146:25–
33. https://doi.org/10.1016/j.forsciint.2004.04.002
Ruengdit S, Troy Case D, Mahakkanukrauh P (2020) Cranial suture closure as an age indicator: a
review. Forensic Sci Int 307:110111. https://doi.org/10.1016/j.forsciint.2019.110111
Saul FP (1972) The human skeletal remains of altar de Sacrificios. An osteobiographic analysis. Pap
Peabody Mus Archaeol Ethnol Harv Univ Camb Mass 63:3–123
Shedge R, Kanchan T (2019) Cranial sutures and age estimation—a few reflections. J Forensic
Legal Med 61:144. https://doi.org/10.1016/j.jflm.2018.11.005
Shedge R, Kanchan T (2021) Forensic anthropology: an overview of the various avenues in human
identification. J Indian Acad Forensic Med 43:300–301. https://doi.org/10.5958/0974-0848.
2021.00077.4
Shedge R, Kanchan T, Garg PK et al (2020) Computed tomographic analysis of medial clavicular
epiphyseal fusion for age estimation in Indian population. Legal Med 46:101735. https://doi.
org/10.1016/j.legalmed.2020.101735
Shedge R, Kanchan T, Kumar Garg P et al (2021) Age estimation from sternebral fusion in an
Indian population—a computed tomographic evaluation. Leg Med Tokyo Jpn 53:101951.
https://doi.org/10.1016/j.legalmed.2021.101951
Suzuki M, Sakai T (1964) Shovel-shaped incisors among the living polynesians. Am J Phys
Anthropol 22:65–71. https://doi.org/10.1002/ajpa.1330220117
384 R. Shedge et al.

Ubelaker D (2006) Introduction to forensic anthropology. In: Forensic anthropology and medicine:
complementary sciences from recovery to cause of death. Springer, Cham, pp 3–12
Ubelaker DH (2018) Recent advances in forensic anthropology. Forensic Sci Res 3:275–277.
https://doi.org/10.1080/20961790.2018.1466384
Ubelaker DH, Wu Y, Cordero QR (2019) Craniofacial photographic superimposition: new
developments. Forensic Sci Int Synergy 1:271–274. https://doi.org/10.1016/j.fsisyn.2019.
10.002
Warrier V, Kanchan T, Shedge R et al (2021) Computed tomographic age estimation from the pubic
symphysis using the Suchey-brooks method: a systematic review and meta-analysis. Forensic
Sci Int 325:110811. https://doi.org/10.1016/j.forsciint.2021.110811
Forensic Odontology
27
Rutwik Shedge, Anuj Bhardwaj, and Tanya Chauhan

Abstract

Teeth are used for cutting and crushing food. Animals also use their teeth for
catching their prey and to defend themselves. Teeth are the hardest parts of animal
body because of a layer of enamel on their surface. Odontology is the study of
teeth and different factors that affect the formation of teeth. Forensic odontology
is the application of various principles and knowledge of dentistry in the admin-
istration of law. Forensic odontology has major application in the identification
of dead where other methods of identification are not possible, such as in cases of
mass disasters, mutilated remains, and charred bodies. Other applications of
odontology are age estimation of living and dead, bite mark analysis on the
human body and foodstuff, and identification of victims of wild animal attacks.
Identification through dental evidence is established by comparing dental remains
with antemortem or post-mortem dental records. Therefore, dental evidence
depends upon the availability of data. Our teeth keep changing with time, so if
there is a large time difference between dental records and the dental evidence, it
may cause a problem in identification. Therefore, it is less definite than evidence
like fingerprints and DNA.

R. Shedge (✉)
School of Forensic Science, National Forensic Sciences University, Gandhinagar, Gujarat, India
A. Bhardwaj
CFSL Chandigarh, Chandigarh, India
T. Chauhan
Deparment of Forensic Science, National Forensic Sciences University, Delhi Campus, New Delhi,
Delhi, India

# The Author(s), under exclusive license to Springer Nature Singapore Pte 385
Ltd. 2024
A. Puri et al. (eds.), Fundamentals of Forensic Biology,
https://doi.org/10.1007/978-981-99-3161-3_27
386 R. Shedge et al.

Keywords

Odontology · Dentition · Enamel · Bite Mark · Age Estimation · Human

identification

27.1 Definitions

Forensic Odontology: Application of science of odontology and dentistry for

dissemination of justice.
Dentition: The number, condition, and arrangement of teeth in any individual.
Enamel: The hardest substance of the human body; thin outer covering of the
crown of a tooth.
Bite mark: Impression created on a pliable surface by biting on it.
Disaster Victim Identification: Identification of victims of any natural disaster
or a mass fatality.

27.2 Human Dentition

Dentition is number, arrangement, and shape of teeth in the mouth. It reflects the diet
and way of life of an animal species. Human dentition is adapted to omnivorous diet.
The human dentition is both heterodont and diphyodont (Wakamatsu et al. 2019).
Heterodont dentition is a type in which the teeth of the animal are divided into
discrete classes—incisors, canines, and molars. Diphyodont dentition is a type in
which two successive sets of teeth are developed in an animal’s life time. The first set
of human teeth are called primary teeth or milk teeth or deciduous teeth and are 20 in
number (Krogman 1962). They start erupting by 6 months and the eruption is
completed by approximately 2.5 years of age. The second set of teeth are called
permanent teeth or secondary teeth, and they replace primary teeth. The permanent
teeth are 32 in number and are called so because no other teeth will appear in an
individual’s life time after them. First molars are the first permanent teeth to erupt at
the age of 6 years, and the final teeth to erupt are the third molars, which may erupt
between the ages of 17 and 25 years. However, third molars, also known as the
wisdom teeth may not erupt at all in few individuals.

27.3 Type of Teeth

27.3.1 Anatomy of a Tooth

Each human tooth has two regions: a crown and roots. The crown is the portion of
the tooth above the gingiva (gum) and is covered with a thin layer of enamel, the
hardest substance of the human body (Gray and Lewis 2000). Enamel provides
protection to the tooth, and makes it resistant to the vagaries of nature. The root is the
27 Forensic Odontology 387

Fig. 27.1 Anatomy of Tooth

portion of the tooth underneath the gingiva that articulates with the alveolus through
periodontal ligament. The root is covered with a mineralized tissue called the
cementum. Underneath the crown’s enamel and the root’s cementum lies dentine.
Dentine is a highly calcified tissue and provides rigidity and shape to the tooth. The
innermost structure within the tooth is the dental pulp that receives blood vessels and
nerves through an opening of the tooth. The dental pulp gradually tapers towards the
apex of the tooth root and forms the root canal (Krogman 1962). The schematic
representation of a human tooth is shown in Fig. 27.1.

27.3.2 Classification of Teeth

Teeth can be classified on the basis of function they perform while eating food.
Based on this criterion, there are four types of teeth:

• Incisors: Chisel-shaped teeth present at the front of the jaw. They are used for
biting and slicing up the food.
388 R. Shedge et al.

Fig. 27.2 Types of human

teeth (The aforementioned
figure is a licensable stock
image. The illustrator should
use this image to create their
own graphical figure)

• Canines: These are the pointed teeth used for stabbing and holding the food. As
humans are omnivorous, their canines are shorter and blunter in comparison to
carnivorous animals.
• Premolars and Molars: They are present at the end of jaws. They have deep roots
and ridges called cusps. These teeth are used to crush or grind the food. Premolars
are slightly smaller and present in front of molars.

Figure 27.2 depicts each of the four human teeth.

27.3.3 Sides of a Tooth

There are 5 sides to each tooth (Krogman 1962). In Disaster Victim Identification
(DVI), these sides of teeth and any of their characteristic features such as the
presence of cavity or filling are of great importance. The different sides are:

• Buccal—towards cheek (used for posterior teeth such as premolars and molars).
• Labial—towards the lips (used for anterior teeth such as incisors and canines).
• Lingual—towards tongue (used for teeth of the mandible).
• Palatal—towards the palate (used for teeth of the maxilla).
• Mesial—towards mid line of body.
• Distal—away from mid line of body.
• Occlusal—chewing surface of tooth.

Figure 27.3 depicts the different sides of the human teeth.

27.3.4 Dental Formula

Arrangement of teeth is depicted using a dental formula. The dental formula shows
type and number of teeth on each side of the jaw as well as both the jaws. For
humans, the dental formula is 2 1 2 3 in case of permanent teeth and 2 1 0 2 in case of
27 Forensic Odontology 389

Fig. 27.3 The different sides of each tooth. The black arrows mark the occlusal surface which is
the chewing surface for each tooth. Red marking highlights the mesial surface of the second molar,
while the blue marking highlights the distal surface of the first molar

deciduous teeth. The first digit (2 for both the sets) states the number of incisors
present, the second digit (1 for both the sets) indicates the number of canines present,
the third digit (2 for permanent teeth and 0 for deciduous teeth) indicates the number
of premolars present, while the last digit (3 for permanent teeth and 2 for deciduous
teeth) indicates the number of molars present. There are no premolars or third molars
in case of temporary teeth.

27.4 Dental Notation Systems

Dental notation systems, or tooth numbering systems, as their name suggests, are
systems used to number each human tooth (Havale et al. 2015; Pemberton and
Ashley 2017). There are multiple dental notation systems that exist, however, only a
few are globally accepted.
390 R. Shedge et al.

27.4.1 Universal Dental Notation System

In the universal dental notation system, each of the permanent teeth are assigned a
unique number that ranges from 1 to 32. The count starts from the right maxillary
third molar to the left maxillary third molar, and then to the left mandibular third
molar and finally the right mandibular third molar (Fig. 27.4). In case of the
deciduous teeth, a unique letter is assigned to each tooth. The letter A is assigned
to the right maxillary second molar, and alphabetical order is followed until the left
maxillary second molar with the letter J. The left mandibular second molar is then
assigned the letter K, and the alphabetical order is followed again until the right
mandibular second molar which is assigned the letter T (Fig. 27.5).

27.4.2 FDI Dental Notation System

The Fédération Dentaire Internationale (FDI) or FDI World Dental Federation is the
world’s leading organization representing dentists and odontologists, and has its
own dental notation system that is globally used. In this system, the permanent
human dentition is divided into four quadrants, and each of the quadrants is assigned

Fig. 27.4 Universal dental notation system for permanent teeth

Fig. 27.5 Universal dental notation for deciduous teeth

27 Forensic Odontology 391

Fig. 27.6 The FDI Dental Notation for permanent teeth

Fig. 27.7 The FDI Dental Notation for deciduous teeth

a unique number: Right maxillary quadrant is given the number 1, left maxillary
quadrant 2, left mandibular quadrant 3, and right mandibular quadrant the number
4. Furthermore, each type of tooth is assigned its own number: central incisors are
1, lateral incisors are 2, canines are 3, first premolars are 4, second premolars are
5, first molars are 6, second molars are 7, and third molars are 8. Every tooth is thus
uniquely identified by a combination of two numbers–the quadrant in which they lie,
and their type. For example, the right maxillary third molar will be denoted as ‘18’,
while the left mandibular first premolar will be denoted as’35.’ The notation for all
the 32 permanent teeth is shown in Fig. 27.6.
In case of temporary teeth, similar style of notation is used, with all four quadrants
having assigned the numbers 5, 6, 7, and 8 in the same order as the permanent
dentition, and each type of tooth being assigned numbers as follows: central incisors
are 1, lateral incisors are 2, canines are 3, first molars are 4, and second molars are
5. The notation for all 20 deciduous teeth is shown in Fig. 27.7.
392 R. Shedge et al.

27.5 Human Identification

One of the most vital utility of teeth in forensics is their capability for individualiza-
tion of unknown human remains. Since teeth are covered by a layer of enamel, they
are heat and chemical resistant to an extent, and thus are mostly preserved even in
cases of charred remains and ancient remains (Bagdey et al. 2014; González-
Colmenares et al. 2020) b. Teeth provide reliable identification when other means
of identification may fail or not possible. Teeth play a vital role in identification of
dead bodies of mass disasters like fire, explosion, flood, earthquake, and plane crash
(Higgins and Austin 2013). Teeth also help in identification when dead bodies are
charred, dismembered, mutilated, or in advanced stage of decomposition (Buchner
1985). Identification of an unknown individual can be done by comparing the dental
remains with antemortem dental records. During comparison of dental remains with
antemortem records, individual characteristics such as filings, dental caps,
restorations, etc., of each tooth play an important role. The antemortem dental
records may be present in form of a textual record, an orthopantomogram, or even
in form of a dental cast (Fig. 27.8). A dental record may contain the following
details:

• Total number of teeth.

• Arrangement of teeth.
• Position of teeth.
• Width of each tooth in the arch.
• Gap between teeth.

Fig. 27.8 A dental cast

27 Forensic Odontology 393

• Number and type of filling done.

• Missing tooth position.
• Details of restoration procedures.

Even in cases where antemortem records are not available, an unknown individ-
ual may still be identified. Since the dental pulp within the tooth is extremely well
preserved, DNA can be isolated from it even after a considerable time has passed.
From the isolated DNA, multiple downstream analyses can be conducted to deter-
mine the ethnicity of the victim, their biological sex, their hair, eye, and skin colour
(externally visible characteristics), as well as their STR profile for comparison with
antemortem DNA samples, or profiles of the victim’s parents.

27.5.1 Determination of Ethnicity

Using teeth, a forensic odontologist can determine the ethnicity of an unknown

individual. The utility of teeth for determination of ethnicity of an unknown individ-
ual has been detailed in the previous chapter (Chap. 26).

27.5.2 Dental Age Estimation (DAE)

Teeth are one of the most reliable anatomical indicators of a person’s age. They
follow a predictable pattern of development and eruption that can be used to predict
an individual’s age.

27.5.2.1 DAE Using Eruption Sequence of Teeth

Since humans are diphyodonts, they have two sets of teeth—the first set being the
temporary or the deciduous one, and the second set being the permanent one. The
time of eruption of primary and secondary sets of teeth are detailed in Tables 27.1
and 27.2 respectively.
The third molar is an aberrant tooth, that may erupt any time between 17 and
25 years of age, or it may not erupt at all.

Table 27.1 Eruption of Tooth Eruption Number of teeth

primary dentition in
Central incisor (lower) 6–8 months 2
humans
Central incisor (upper) 7–9 months 4
Lateral incisor (upper) 8–10 months 6
Lateral incisor (lower) 10–12 months 8
First molar 12–14 months 12
Canine 17–19 months 16
Second molar 20–30 months 20
394 R. Shedge et al.

Table 27.2 Eruption of Tooth Eruption Number of teeth

secondary teeth in humans
First molar 6–7 years 21–24
Central incisor 6–9 years 24
Lateral incisor 7–9 years 24
1st premolar 9–11 years 24
Second premolar 10–12 years 24
Canine 11–13 years 24
Second molar 12–14 years 25–28
Third molar 17–25 years 29–32

27.5.2.2 DAE Using Development Stages of the Tooth

Grossly, one can observe a tooth once it starts erupting from the gingiva (gum).
However, eruption is one of the final stages in the development of teeth. Before the
tooth comes out of the gum, it undergoes a complex development due to interactions
between the oral cavity’s ectoderm and the ectomesenchyme of the neural crest,
which are responsible for production of enamel and other dental structures, respec-
tively. Typically, there are 5 stages of odontogenesis—development of the tooth.
The first stage is the bud stage in which the dental lamina develops into dental
epithelial cells. These cells evolve into the tooth germ which consists of all the soft
tissues necessary for the formation of tooth. The second stage is the cap stage in
which the dental cells start forming the outer layers of the tooth and form a cap
(enamel organ) that sits on the tooth bud. This cap will later form the cells required
for formation of enamel. The dental papilla which is the remaining part of the tooth
bud will then form dentine and the pulp. The bell stage is the third stage in which the
enamel organ grows into a bell shape and its cells differentiate into four groups—
inner enamel epithelium, outer enamel epithelium, stratum intermedium, and stellate
reticulum. The shape of the crown is formed during this stage. Crown and root
formation is the fourth stage of odontogenesis, in which the ameloblast cells and the
odontoblast cells form the enamel and the dentine, respectively, while the dental
papilla, the dental follicle, and Hertwig’s epithelial root sheath form the roots of the
tooth. The final stage is the eruption stage in which the tooth moves out into the oral
cavity.
These different stages of tooth development can be observed radiologically using
Orthopantomography, and since development for each tooth occurs at a predictable
time, age estimation can be done using it. Multiple researchers over the last 50 years
have come up with their own method of estimating an individual’s age based on the
tooth development (Nolla 1960; Haavikko 1970; Demirjian et al. 1973; Willems
et al. 2001; Cameriere et al. 2004, 2008; Acharya 2011; Kanchan et al. 2021).

27.5.2.3 DAE Using Morphological Changes of the Tooth

While development and eruption of teeth are great indicators of an individual’s age,
they are completed by the age of 25 years. Beyond that, age can be estimated from
the attritional changes of the teeth. Since the permanent teeth of humans are never
27 Forensic Odontology 395

replaced, they undergo certain morphological changes that can be used to estimate
age (Kaur et al. 2015; Sultana et al. 2021). One such method that studies the
morphological changes and provides models to estimate age is the Gustafson’s
method (Gustafson 1947). This method has been thoroughly described in the
previous chapter (Chap. 26).

27.6 Bite Mark Analysis

Bite marks are any impressions created on a pliable surface through the action of
biting. There are of great forensic relevance, and are often key evidences in cases of
assaults, sexual assault, child abuse, abuse of the elderly, animal abuse, and victims
of animal attack. They may even be found on a perpetrator of an assault, wherein the
victim tried to defend themselves by biting the perpetrator (Ma et al. 2020). Bite
marks can also be found on inanimate objects such as chewing gum, pieces of fruits,
leather, ends of pens or pencils, etc. (Rivera-Mendoza et al. 2018).

27.6.1 Morphology of a Typical Bite Mark

A typical human bite mark consists of a circular or an oval mark, that is bruised, and
a central region that is spared (Dorion 1982). The bite mark could have been made by
only the anterior teeth (central incisors, lateral incisors, and canines) or it could have
been made by more teeth. Depending upon the target substrate, both the jaws could
be involved in leaving a mark, or, in cases wherein the victim’s skin is partly covered
by a fabric, only one jaw, or half portions of both the jaws will leave an imprint.

27.6.2 Injuries Associated with Bite Marks

A bite mark on the human body can have multiple injuries associated with it
depending upon the bite force, nature of teeth, and the target area (Hollenback
2015). A bite mark may be characterised by abrasions which are injuries to the
superficial layers of the skin. These occur when the occlusal or incisal surfaces of the
teeth graze against the skin of the victim. Bruises may accompany bite marks as well.
A bruise is caused due to extravasation of blood underneath the skin, without any
break in the continuity of the skin. Bruised bite marks are accompanied with
swelling and discolouration of blood underneath the skin. If the force of the teeth
is too high, the skin may split underneath the force, and result in lacerations.
Lacerations are mostly seen in areas which have underlying bony structures (cheeks,
hands, etc.), and are marked by irregular edges, tissue tags, and bleeding. In certain
cases, partial or complete avulsion may be seen as well. Whenever excessive bite
force results in partial tearing out of a body part (mostly cartilaginous parts such as
ears and nose), the bite mark is said to be a partial avulsion bite mark. In case a part
396 R. Shedge et al.

of the cartilaginous tissue is completely detached from the body, such as ripping off
of an ear or nose, etc., the bite mark is said to be an avulsion bite mark.

27.6.3 Collection of Evidence

27.6.3.1 Collection of Evidence from the Victim

Bite marks first need to be documented using examination of quality photographs.
The camera is placed at a perpendicular perspective over the injury, and multiple
photos are taken with and without an ABFO scale (Wright 1998; Pretty and Sweet
2001). ABFO stands for the American Board of Forensic Odontologists, and its
ABFO No. 2 scale has become the standard for bitemark measurement and photog-
raphy. While taking the photos, different light perspectives and sources may be
used—reflected light, oblique light, IR light, UV light, etc. IR light is particularly
helpful in understanding the extent of injuries in case of a bruised bite mark.
If there is a lot of blood over the bite mark, it has to be collected with a double
swabbing method, air dried, and then kept in the swab’s container. If the bitemark is
devoid of blood, saliva may be directly collected using the double swabbing
technique. One end of the swab is dipped in normal saline, and brushed over the
bite mark. After the entire area is brushed, the other dry end of the sterile swab is
brushed over the same area.

27.6.3.2 Collection of Evidence from the Suspect

In case there is suspicion on an individual for having bit another individual,
evidences have to be collected from them. The first step in collection of evidences
from the suspect is conduction of an extraoral and intraoral examination. In the
extraoral examination, maximal opening of the mouth is measured, deviations in
closing or opening of mouth are recorded, and presence of any scars or facial surgery
are recorded. In the intraoral examination, number, nature, and condition of teeth are
recorded. Salivary swabs are taken as well. The next step is taking dental
impressions of the suspect. Impressions of both the casts are taken in using an
alginate impression material and these are later casted using dental stone. The final
stage in collection of evidence from suspect is the collection of sample bite. The
suspect should be asked to bite on multiple sample materials similar to the actual
case evidence, while trying to emulate the type of evidence bite mark (Naru 1997).

27.6.4 Examination of Bite Mark Evidence

The forensic odontologist should begin with examining the class characteristics of
the bite mark. This begins with first identifying the evidence as a bite mark. In typical
bite marks, this is comparatively easy as the impression of teeth may be found on the
substrate. In cases of lacerated or avulsed bite marks, the presence of saliva can be an
indicator that the injury is a bite mark. The bite mark is then classified according to
its type and measurements are taken—of each arch if both are present, of each tooth
27 Forensic Odontology 397

if individual impressions of teeth are present, distance between the teeth

impressions, etc. The bite mark is then compared with the suspect’s sample bite,
or the bite created using the casted teeth of the suspect. Comparison can either be
done side by side, or photographs can be superimposed either manually or by using
computer-generated overlays. Finally, the DNA from the saliva collected from the
bite mark is compared with the DNA of the suspect to ascertain whether the suspect
was indeed the perpetrator. In case there are any individualistic features such as
impressions of supernumerary teeth, or talon’s cusp, or rotated tooth, they are
compared with the suspect’s dentition.

Multiple Choice Questions

1. Which of the following teeth are responsible for slicing up food?

(a) Incisors.
(b) Canines.
(c) Premolars.
(d) Molars.
Answer: (a)
2. The first permanent tooth to erupt is the ________.
(a) Upper central incisor.
(b) Lower lateral incisor.
(c) First molar.
(d) First premolar.
Answer: (c)
3. According to the FDI Dental Notation, what number is assigned to the left
mandibular third molar?
(a) 18
(b) 28
(c) 38
(d) 45
Answer: (c)
4. Which scale is used to photograph bite marks?
(a) Tape measure.
(b) ABFO.
(c) 6-inch ruler.
(d) Vernier callipers.
Answer: (b)
5. The dental impression of a suspect is taken using which of the following
materials?
(a) Plaster of Paris.
(b) Plasticine.
(c) Clay.
(d) Plasticine.
Answer (d)
398 R. Shedge et al.

References
Acharya AB (2011) Age estimation in Indians using Demirjian’s 8-teeth method. J Forensic Sci 56:
124–127. https://doi.org/10.1111/j.1556-4029.2010.01566.x
Bagdey SP, Moharil RB, Dive AM et al (2014) Effect of various temperatures on restored and
unrestored teeth: a forensic study. J Forensic Dent Sci 6:62–66. https://doi.org/10.4103/
0975-1475.127777
Buchner A (1985) The identification of human remains. Int Dent J 35:307–311
Cameriere R, Ferrante L, Cingolani M (2004) Variations in pulp/tooth area ratio as an indicator
of age: a preliminary study. J Forensic Sci 49:317–319
Cameriere R, Ferrante L, De Angelis D et al (2008) The comparison between measurement of open
apices of third molars and Demirjian stages to test chronological age of over 18 year olds in
living subjects. Int J Legal Med 122:493–497. https://doi.org/10.1007/s00414-008-0279-6
Demirjian A, Goldstein H, Tanner JM (1973) A new system of dental age assessment. Hum Biol 45:
211–227
Dorion RB (1982) Bite mark evidence. J Can Dent Assoc 48:795–798
González-Colmenares G, Calvo-Díaz L, Nastul-Enríquez M et al (2020) Effect of high temperatures
on teeth fixed with an orthodontic bracket. An in vitro study. Forensic Sci Int 308:110182.
https://doi.org/10.1016/j.forsciint.2020.110182
Gray H, Lewis WH (2000) Anatomy of the human body. Bartleby.com, New York
Gustafson G (1947) Microscopic examination of teeth as a means of identification in forensic
medicine. J Am Dent Assoc 35:720–724. https://doi.org/10.14219/jada.archive.1947.0323
Haavikko K (1970) The formation and the alveolar and clinical eruption of the permanent teeth. An
orthopantomographic study. Suom Hammaslaak Toim 66:103–170
Havale R, Sheetal BS, Patil R et al (2015) Dental notation for primary teeth: a review and
suggestion of a novel system. Eur J Paediatr Dent 16:163–166
Higgins D, Austin JJ (2013) Teeth as a source of DNA for forensic identification of human remains:
a review. Sci Justice 53:433–441. https://doi.org/10.1016/j.scijus.2013.06.001
Hollenback JK (2015) Bite-mark analysis. J Calif Dent Assoc 43:486
Kanchan T, Chugh V, Chugh A et al (2021) Age estimation using third molar maturation based on
Demirjian’s criteria. Leg Med Tokyo Jpn 53:101959. https://doi.org/10.1016/j.legalmed.2021.
101959
Kaur P, Astekar M, Singh J et al (2015) Estimation of age based on tooth cementum annulations: a
comparative study using light, polarized, and phase contrast microscopy. J Forensic Dent Sci 7:
215–221. https://doi.org/10.4103/0975-1475.172441
Krogman WM (1962) The human skeleton in forensic medicine. Am J Phys Anthropol 20:227–229
Ma XF, Jin M, Sun H, Mi CB (2020) Application status and Prospect of bite mark evidence in
forensic odontology. Fa Yi Xue Za Zhi 36:369–373. https://doi.org/10.12116/j.issn.1004-5619.
2020.03.014
Naru AS (1997) Methods for the analysis of human bite Marks. Forensic Sci Rev 9:123–139
Nolla C (1960) The development of the permanent teeth. J Dent Child 27:254–266
Pemberton MN, Ashley M (2017) The use and understanding of dental notation systems in UK and
Irish dental hospitals. Br Dent J 223:429–434. https://doi.org/10.1038/sj.bdj.2017.731
Pretty IA, Sweet D (2001) Adherence of forensic odontologists to the ABFO bite mark guidelines
for suspect evidence collection. J Forensic Sci 46:1152–1158
Rivera-Mendoza F, Martín-de-Las-Heras S, Navarro-Cáceres P, Fonseca GM (2018) Bite mark
analysis in foodstuffs and inanimate objects and the underlying proofs for validity and judicial
acceptance. J Forensic Sci 63:449–459. https://doi.org/10.1111/1556-4029.13586
Sultana A, Zainab H, Jahagirdar P et al (2021) Age estimation with cemental incremental lines in
normal and periodontally diseased teeth using phase contrast microscope: an original research.
Egypt J Forensic Sci 11:39. https://doi.org/10.1186/s41935-021-00254-2
27 Forensic Odontology 399

Wakamatsu Y, Egawa S, Terashita Y et al (2019) Homeobox code model of heterodont tooth in

mammals revised. Sci Rep 9:12865. https://doi.org/10.1038/s41598-019-49116-x
Willems G, Van Olmen A, Spiessens B, Carels C (2001) Dental age estimation in Belgian children:
Demirjian’s technique revisited. J Forensic Sci 46:893–895
Wright FD (1998) Photography in bite mark and patterned injury documentation—Part 1. J
Forensic Sci 43:877–880
Forensic Botany
28
Neelam Arya

Abstract

The average person enjoys plants in a multiple ways in his day-to-day life. The
plants are everywhere in nature and the study of scientific techniques used for
plants to answer questions relevant to the legal system is termed forensic botany
and plants may occur as forensic evidence at a crime scene which have the
potential to provide links between crime scenes and individuals/suspect. In
conventional method of investigation, generally the botanical evidences are
overlooked as the agencies involved in criminal justice system are not much
aware about the specific potential use and advantages of plant evidence but the
subject knowledge may turn the routine observations into case-cracking
evidences. However, plant research continues in academic and private research
institutions continuously and new tools are being developed that can be eventu-
ally applied to forensic botanical evidence to aid in criminal investigation.
Consulting with an expert in plant systematics is an excellent place for the legal
investigator to start when trying to obtain line of investigation pertaining to
botanical evidences. Some experts work with only a single group of plants and
some work with many groups and have a good knowledge of the entire field of
botany.
However, Many plant materials cannot be identified and differentiated to the
species level by traditional morphological characteristics when botanical
specimens are degraded and lack physical features. The use of new techniques
based on DNA fingerprinting provide novel approaches to varietal identification
which offer advantages over traditional morphological comparisons. DNA is
unique to each organism, so knowing the order of the DNA allows scientists to
identify its species.

N. Arya (✉)
Forensic Science Laboratory, Madhuban, Haryana, India

# The Author(s), under exclusive license to Springer Nature Singapore Pte 401
Ltd. 2024
A. Puri et al. (eds.), Fundamentals of Forensic Biology,
https://doi.org/10.1007/978-981-99-3161-3_28
402 N. Arya

Botanical evidences includes pollens, spores, wood traces, etc. Wood can be
found at crime scenes in many forms: as a murder weapon, as material used to
hide a body, or as trace evidence from forced entry or vandalism. In the process,
wood fragments get attached or linked to the culprit or victims. These fragments
can often be identified and linked to standards from the crime scene. Due to ever
increasing refinement in the analysis of botanical evidences, the forensic botany is
emerging as very crucial approach in crime investigation.

Keywords
Species identification · Palynology · Botanical evidence · Plant DNA analysis ·
Forensic botany · Wood identification, pollens

28.1 Forensic Botany

Often the green background of the world is unseen and unnoticed, taken for granted,
Quietly absorbing carbon dioxide and providing oxygen and food. Plants are
everywhere in nature, essential for all human and animal existence, and may occur
as forensic evidence at a crime scene which have the potential to provide links
between crime scenes and individuals or other vital crime scene information,
because the components and construction of a plant’s body, and its ecological
requirements, are particular to the species. Forensic botany is emerging as a novel
approach in crime investigation and botanical samples can serve as key pieces of
trace evidence.
Forensic botany is the study of plants and how they can relate to law and legal
matters. Forensic botany is a subdiscipline of forensics that is still in its infancy. As
law enforcement officers are not much informed about the science of plants, there-
fore, important plant evidence is frequently overlooked. Although plant research
continues in academic and private research laboratories and new tools are being
developed that can be eventually applied to forensic botanical evidence to aid in
criminal investigation. It is now becoming a strong tool, as the law enforcement
agencies, forensic scientists, and prosecutors are becoming more familiar with the
applications of plant material to criminal and civil cases. The forensic aspects require
an understanding of what is necessary for botanical evidence to be accepted as
evidence in our judicial system. Forensics requires recognition of pertinent evidence
at a crime scene or associated with victim/suspect, appropriate collection, validation
of new forensic techniques, and admissibility criteria for courts. The methods and
protocol range from simple techniques like microscopy to more technical molecular
biology techniques like DNA sequencing.
The botanical evidence can place a person or object at a crime scene, verify or
refute an alibi, help in determining time since death, the time of a crime, and the
place where a crime occurred. In the absence of eyewitnesses who could testify the
dynamics of any crime/event, the crime scene investigation is fundamental to clarify
the hypothesis given by parties. During the scene analysis, if some traces of plant
28 Forensic Botany 403

material are found, then analysis of these traces allow to reconstruct the incident.
Even if this evidence, of course, is circumstantial, it can be useful in forensic cases,
together with the other evidences, to reconstruct the dynamics of incidents.

28.1.1 Basic Plant Biology

A plant may be defined as any member of the kingdom Plantae. Plants can be large or
small, flat or erect, flowering or nonflowering, green, or possessing other pigmenta-
tion. The plant biology deals with the anatomical and taxonomical classification of
plants and utilizes standard nomenclature techniques to derive the scientific names of
plants. Historically, the science of plant biology or botany has included all living
organisms except animals, but it is clear that there is a major division of life between
cells with a simple level of organization, the prokaryotes, and those with much more
complex cells, the eukaryotes. Among eukaryotes, three main multicellular
kingdoms are recognized: animals, plants, and fungi. The unifying characteristic
features that define plants as different from other eukaryotes are-

• They are photosynthetic and obtain all their nutrients from inorganic sources,
i.e. they are autotrophic.
• The photosynthetic pigment is chlorophyll, and in all plants except some algae,
there are two forms, a and b, contained within chloroplast.
• The cells have a cell wall made predominantly of the cellulose.
• Vegetative structure and physiology is similar throughout the seed plants and
there are many similarities with other vascular plants as well.

Consulting with an expert in plant systematics is an excellent place for the legal
investigator to start when trying to obtain line of investigation pertaining to botanical
evidences. Some experts work with only a single group of plants and some work
with many groups and have a good knowledge of the entire field of botany.

28.1.2 Use of Botanical Evidence

Plant evidence can step into the spotlight as star witnesses, but only if the plant
evidence interpreted by a trained botanist. Very few professionals involved with law
enforcement have a background or training in botany. Typically, legal investigators
should seek a forensic scientist/botanist with well-rounded training and experience
who possesses knowledge of the various specialties within the botanical field in
question. Not all forensic scientist/botanist have such training. As in many fields,
most professional botanist have specialized in one particular area, and have only
scant knowledge concerning the forensic possibilities within others (Fig. 28.1).
There are many kinds of botanists who can help with the interpretation of plant
evidence by the various specialties like, in plant anatomy, plant morphology,
404 N. Arya

Fig. 28.1 Botanical evidence

as private eye for investigators

ecology, physiology and genetics (DNA). Plants may be present as biological

evidence in many ways:

• Seeds caught and carried in a pant cuff,

• Plant leaves and stems entangled and carried in a vehicle’s undercarriage, wheel
wells, etc.
• Grass stains on garments after a sexual assault,
• Clump of leaves within victim’s palm,
• Presence of pollen grains on clothing,
• Traces of wooden log around the hit mark on any surface.

Thus, investigators would know the value of locating plant material on a suspect
or victim, and then establishing the origin from which that plant came. On a
microscopic level, this may be a reasonable outcome. A sample of leaves within
victim’s palm will catch the curious eye of an investigator. On the other hand, what
about botanical evidence at the microscopic level, such as grains of pollens.?
Sometimes the plants become associated with criminal activities; many homicides,
accidental deaths, and suicide occurred through the inappropriate and deliberate use
of plants to achieve harmful effects. But only if the investigator is aware of the
potential existence of that evidence, he will do all efforts to search for it and the
botanical evidence plays a key role in investigation. Finally, with limited or no
training in botany, crime scene personnel will likely not know whether or not the
plant material is indigenous to the area, relatively common or rare.

28.1.3 Pant Identification by DNA

Analysis of trace evidence by traditional forensic botany techniques have limitations

of reproducibility and standardization from degraded samples. The absence of an
28 Forensic Botany 405

Fig. 28.2 Plant DNA profiling: strong tool for plant identification

accurate identification system remains the major obstacle to the present inability, to
routinely and correctly identify trace botanical evidence. On the other hand, many
plant materials cannot be identified and differentiated to the species level by tradi-
tional morphological characteristics when botanical specimens are degraded and
lack physical features.
The use of new techniques based on DNA profiling/fingerprinting provide novel
approaches to varietal identification which offer advantages over traditional mor-
phological comparisons. By taking advantage of genetic code system, the more
sophisticated plant DNA fingerprinting and other biomolecular techniques are
being used to enhance the information gained from a plant evidence. DNA is unique
to each organism, so knowing the order of the DNA allows scientists to identify its
species. New DNA profiling/fingerprinting technology has decreased the time and
cost of identifying the specie of a given organism. The effectiveness of source
attribution of plant material will depend on, how unique and of a sample accurate
the species is to geographic area and its genetic history. If a plant is very rare, source
attribution may not be difficult; however, many plants require DNA testing to
confirm that the evidentiary sample originated from a source plant, if generated by
seed, or a source population if generated by clonal reproduction, which is a consid-
erable potential approach in investigation of crime, accident, and suicide
circumstances.
Plants have DNA, since they are living beings. The DNA in plant cells is found in
the nucleus, the mitochondria, and the chloroplasts. Although chloroplasts and
mitochondria contain some genetic material, the nucleus contains the majority of
DNA in plant cells. DNA is found in the same shape in the cells of all plants as in
animals (Fig. 28.2).
Some plant species are capable of self-fertilization, and some are nearly exclu-
sively self-fertilizers. This means that a plant can be both mother and father to its
offspring, a rare occurrence in animals. Plants are generally more capable of
406 N. Arya

surviving as polyploids. Polyploid organisms have more than two sets of homolo-
gous chromosomes. For example, humans have two sets of homologous
chromosomes, meaning that a typical human will have 2 copies each of 23 different
chromosomes, for a total of 46. There are various methods for plant DNA finger-
printing like-

• Restriction Fragment Length Polymorphisms (RFLPs).

• Randomly Amplified Polymorphic DNAs (RAPDs).
• Amplified Fragment Length Polymorphism (AFLP).
• Simple Sequence Repeats (SSRs).

DNA profiling involves the extraction of DNA from plant cells for quantification
and quality assessment. Different plant DNA extraction methods have been
standardized and used in several kinds of applications. In general, plant DNA
extraction and purification can be divided into six steps:

1. Tissue disruption/homogenization,
2. Cell lysis in DNA extraction buffer,
3. Separation of DNA from other cellular components,
4. DNA precipitation,
5. DNA washing,
6. DNA collection for downstream processing.

Although, it sounds biochemically simple, but the nature of the plant starting
material can present unique technical challenges that can be difficult to overcome for
even the experienced scientists. For DNA profiling of a plant variety, a set of
molecular markers and a method to detect them are required. Two different sets of
molecular markers detected with the same method will result in two different DNA
profiles for a particular variety. In contrast, two different methods to detect the
specific alleles of a given molecular marker set are expected to result in identical
DNA profiles.
The number of markers should be balanced with the accuracy of the genotype
required for the purpose, so the selection of marker and construction of a Species-
Specific Database should be considered by following some general criteria-

• Repeatability and possible sources of molecular markers derived from different

laboratories to score data.
• Molecular markers selected from newly generated sequence data.
• As far as possible, avoid the markers with null alleles.
• Good performing markers are preferred over complex marker profiles that are
sensitive to interpretation as the clear answers allows the easier harmonization.
• Co-dominant markers are generally preferred over dominant markers as they have
a higher discriminative power.
• The number of markers should be balanced with the accuracy of the genotype
required for the purpose.
28 Forensic Botany 407

• Performance of molecular markers and genotyping methods are evaluated in a

validation process and validated markers lead to harmonized results.
• Database construction should consider different levels of data processing and
store the end results.
• Standardization of the detection method and technology is not required as long as
the performance meets the quality criteria and the resulting DNA profiles are
consistent.

DNA has revolutionized the field of criminology and hugely improved the
functioning of the criminal justice system, as highly polymorphic DNA markers
become increasingly available for a wide range of plant species and there will be
increasing opportunities for applications to forensic investigations.

28.1.4 Forensic Palynology

Recently, several criminal and civil cases have depended on identification of plants
from their pollen. Suspects in violent crimes have been directly linked to a crime
scene by a specific pollen type which was unseen and unknown by them to be
present on their clothing. Palynology is a scientific discipline concerned with the
study of plant pollen, spores, and certain microscopic planktonic organisms. It is
known to be a highly valuable, accurate, and effective means of criminal investiga-
tion which has been used by a number of experienced scientists to provide evidence
in selected legislature. Spores and pollen grains have a number of morphological and
ultra structural features. Pollen from different flowering plant species can be useful
in criminal justice system as trace evidence. Palynology has been tested in court and
has provided evidence for contact between object and place, location of clandes-
tinely disposed human remains, and estimated times of body deposition, has
differentiated murder and rape sites from deposition sites, and has provided prove-
nance for objects and materials (Fig. 28.3).
Pollen and spores are produced in large numbers and dispersed over large areas
by wind and water; they are recoverable in statistically significant assemblages. The
structure of pollens and spores is extremely resistant to any external environments

Fig. 28.3 showing pollens and spores

408 N. Arya

more likely, heat and cold, washing, smudging, and degradation. Pollen grains may
remain preserved for many years. If due attention is given to this important aspect,
many cases can be solved easily. Pollen and spores provide important information
which prove very crucial in crime investigation like-.

– Determine the geographical origin of a specimen.

– Create ties between the crime scene and individuals.
– test alibis.
– Determine possession or trade of prohibited or endangered species.
– Determine the travel history of an item.
– Determine if a crime scene is a primary or secondary scene and to identify
unclaimed or unidentified bodies.
– Useful in linking the victim with the location where the crime occurred.

Pollen grains are produced in the anthers of flowers, differ in many ways, and can
be characterized using microscopic techniques. They should be collected carefully
because often these elements contain abundant pollen and spores. Samples can be
recovered from a wide range of sources-

– Dirt collected from the clothing of victim/suspect.

– Pockets/cuffs.
– Skin/finger nails of living and deceased persons.
– Hair.
– Nasal passage.
– Shoes.
– Vehicle tires.
– Air filters in cars.
– On objects/stones/bricks.

There are three methods for obtaining useful pollen grain images. These three
methods can be considered as semi-automated traditional methods used to detect the
pollen grains. The identification of palynomorphs depended on traditional methods,
such as scanning electron microscopy

• Transmitted-light microscopy (TLM),

• Wide field fluorescent method,
• Structured illumination (Apotome) method.

For example, the transfer of pollen to pristine shoes and to shoes that were
previously worn at other localities can be analyzed palynologically. With the
exception of one sample, the pollen found on the footwear had a characteristic
signature, supporting the view of a general distinctiveness of pollen from individual
sites and the concept of widespread palynological heterogeneity. Pollen can also
help forensic scientists validate an alibi. Several years ago, a man was found dead on
a hill. Eye witnesses helped police identify a suspect, but the suspect claimed that he
28 Forensic Botany 409

had never been to the area of the crime and had never worn the sweater that witnesses
reportedly saw him in; however, after swabbing the sweater, forensic scientist
identified pollen of a hill area plant that occurs near the location where the victim
was found dead. Although, this evidence is circumstantial, investigators were able to
use palynology to discredit the suspect’s alibi and show that it was very likely the
suspect had visited that hill area where the victim was found dead. Pollen obtained
from a suspect that matches that of a crime scene could basically suggest that the
person has visited that area at some point recently, not necessarily suggesting that
they have committed a crime.
As in any new application of reliable science or techniques, they may provide
some advantages and disadvantages in their application in forensic investigation. It
has become more accepted as a significant crime-solving tool. The advantages are
outweighing the disadvantages because of the mechanism of how pollens are spread
according to its small size and how it attaches to many objects, like surfaces, skin,
and folds of clothes. On the other hand, this field has disadvantages because it lacks
complete information, location, and techniques to collect the samples necessary to
conduct investigations. The limited number of trained specialists in this field or even
full-time available palynologist is also a problem, and there are no academic centers
or forensic facilities that care to train a scientific staff in specified field.

28.1.5 Wood Identification

From time to time, wood plays an important role in solving criminal cases. Compar-
ative wood anatomy and wood identification can play an important role in forensic
science. Wood identification can provide significant supporting evidence during
criminal investigations. However, it is still an underutilized field of investigation
with its most common application limited to identifying specific as well as suspected
wood traces. Wood samples vary in size and can range from trees and logs to pieces
as small as individual wood fibers. Botanists can easily identify trees, especially
when the leaves, flower, or fruits are present. Illegal logging and the illegal timber
trade are major problems domestically and internationally, threatening not just
individual species, but entire ecosystems. Using standard techniques, wood
technologists, foresters, and wood anatomists can generally identify logs, timber,
wood products, and pieces of wood bigger than a matchbox. As the size of the piece
decreases, however, accurate determinations are more difficult. Very small
fragments require special handling and identification techniques.
Wood can be found at crime scenes in many forms: as a murder weapon, as
material used to hide a body, or as trace evidence from forced entry or vandalism.
In the process, wood fragments get attached or linked to the culprit or victims.
These fragments can often be identified and linked to standards from the crime
scene.
When gathering trace evidence, do not ignore wood fragments. They could
contain clues that help solve the crime. In one form or another, in connection with
410 N. Arya

a variety of crimes, wood fragments’ use as evidence is limited primarily to these

areas:

• Color, odor, and density: The naked eye examination is used mainly to visually
determine the color, odor, weight, and unusual features or defects of the wood.
• Chemical test: such as the Froth and fluorescent tests, spot-test for aluminum, and
sodium nitrite spot-test.
• light microscope: Standard micro techniques can be used to cut, stain, and mount
the sections for analysis.
• Macroscopic examination includes physical matches between broken pieces of
wood, carrying tool marks, etc.
• Wood anatomy: includes matching of growth patterns in different pieces or to the
examination of a piece for clues and determine the extent of variation and to
interpret whether the differences are the effects of environmental conditions or
habitat, or whether they reflect genetic differences.
• Detector Dogs: The use of detector dogs for rapid-field identification of timber
can be very useful for particular species of concern. However, a dog can only
confirm if it detects the odor of a substance to which it has been trained to
respond; it cannot determine the identity of other substances.

Wood may present some special challenges because of its fibrous nature. The
identification of wood requires a knowledge of wood anatomy as well as skill in
sectioning and mounting small particles for microscopical study. A piece of wood,
no matter how small, retains its orientation with respect to the tree in which it
originally grew. These directions are not difficult to locate on a tree or a large
piece of wood, but become a challenge as the size of the specimen decreases.
Since most pieces of wood, with diameters of the order of a toothpick, are elongated
parallel to the fibrous elements of which they are composed, the easiest way to
determine orientation is to cut a cross-section straight through the sliver using a
sharp razor. The freshly cut surface is then held in the fingers (or if it is too small in a
pair of forceps) and examined under a stereomicroscope. The directions of the rays
will immediately reveal the true orientation of the fragment. The specimen is now
oriented so that the required sections can be cut from it. If the piece of wood is large
enough, it can either be mounted for sectioning in a microtome, or sections can be
cut freehand with a microtome knife blade using a technique similar to that
employed in peeling an apple. Particles of sawdust, which are too small to section,
are sprinkled on a slide so that they do not lie on top of one another, boiled in
glycerin-alcohol and observed directly under the microscope. Many of the sawdust
particles will be cut in a generally radial or tangential section and, therefore, will
often show enough characteristics to permit an identification to be made. While
examination of forensic sample, it is essential that good known samples be obtained.
A broken door and frame may produce particles from several different kinds of
wood. If adequate known samples are not taken at the crime scene, the microscopist
may erroneously eliminate questioned wood particles found on a sledge hammer
suspected in a break-in, for instance, from being associated with the incident. This
28 Forensic Botany 411

problem can become quite taxing in certain situations, such as when sawdust from a
workshop or particle board are involved. The number of different woods which may
be involved can mean that many samples may have to be prepared and examined
over a relatively long period of time before a conclusion can be reached.
On occasion, identification may be carried down to the species level by an
experienced microscopist well trained in wood anatomy. If the wood is not exotic,
a microscopist trained in wood identification will recognize the common woods
almost at sight, based on a few key characteristics. An exotic wood which is rare in
commerce will normally make the best evidence. Particles of wood recovered from
the scalp of a murder victim were identified as a species of Kokka, a rather rare
tropical wood not commonly found on the market. An examination of a pool which
belonged to the prime suspect showed that it was made from the same wood and had
sustained damage to its thick end. This was the most important piece of physical
evidence in the trial which resulted in the conviction of the defendant. After
identifying the wood trace, it becomes necessary to interpret the results. The first
consideration, aside from the integrity of the evidence itself, must be the accuracy of
the identifications. These must be based on a sound knowledge of wood anatomy
and comparison to reference specimens of standard woods. Whenever possible,
identifications should be checked by a second analyst, also skilled in the techniques
of wood identification. This is a general rule in forensic science and helps to ensure
the quality of the results obtained. The next step must be to consider how common or
rare the wood is. In this regard, it is important to know, or at least be able to look up,
something about the uses of a particular wood. Even a relatively rare wood may be
common in a certain application. Knowledge of the uses of different woods will help
prevent mistakes of this kind. The final conclusion of a positive wood examination
will be that the questioned and known woods are both the same type of wood.

Multiple Choice Questions

1. Forensic palynology refers to the examination of.

(a) soil,
(b) shoot and root,
(c) flowers,
(d) pollen and spores.
Answer (d)
2. Scientist who first used the pollens in forensics.
(a) Jeffry.
(b) Paul Sear.
(c) Bryant.
(d) Horrocks.
Answer (c)
3. Expertise of a forensic scientist must include the following.
(a) Analysis of physical evidence.
(b) Standard protocol of analysis.
412 N. Arya

(c) Expert witness.

(d) All of above.
Answer (d)
4. The age of tree can be estimated by.
(a) Diameter of trunk.
(b) Height of tree.
(c) Number of annual rings.
(d) biomass.
Answer (c)
5. When exposed to air, which undergoes decay.
(a) Dark wood.
(b) Sap wood.
(c) Light wood.
(d) Hard wood.
Answer (b)
6. The transfer of pollen from anther to stigma is.
(a) Fertilization.
(b) Pollination.
(c) Diffusion.
(d) All of above.
Answer (b)
7. Can wood traces found stick on accidental vehicle be matched with wood found
on scene of crime.
(a) Yes.
(b) Depends on environment condition.
(c) Not at all.
(d) In some cases.
Answer (a)
8. Botanical evidence may be present on.
(a) Victim’s body and clothing.
(b) Suspect vehicle and articles.
(c) Stick on weapon of offence.
(d) All of above.
Answer (d)
9. Inappropriate and deliberate use of plants can cause homicides or accidental
deaths.
(a) Not possible.
(b) Cannot comment.
(c) Absolutely.
(d) All of above.
Answer (c)
10. Evan’s blue dye stains the.
(a) Live cells.
(b) Dividing cells.
28 Forensic Botany 413

(c) Dead cells.

(d) None of above.
Answer (c)

Further Reading
Amankwaa AO, McCartney C (2021) The effectiveness of the current use of forensic DNA in
criminal investigations in England and Wales. Wiley Interdiscip Rev 3(6):e1414. https://doi.org/
10.1002/wfs2.1414
Aquila I, Ausania F, Serra A (2014) The role of forensic botany in crime scene investigation: case
report and review of literature. J Forensic Sci 59:3
Bryant VM Jr, Jones GD (2006) Forensic palynology: current status of a rarely used technique in
the Unites States of America. Forensic Sci Int 163:183
Craft KJ, Owners JD, Ashley MV (2007) Application of plant DNA markers in forensic botany:
genetic comparison of Quercus evidence leaves to crime scene trees using microsatellites.
Forensic Sci Int 165:65–70
Dunbar M, Murphy M (2009) DNA analysis of natural fibre rope. J Forensic Sci 54:1–6
Ishak S, Dormontt E, Young JM (2021) Microbes in forensic botany. Forensic Sci Med Pathol
17(2):297–307. https://doi.org/10.1007/s12024-021-00362-4
Thomas J. McClintock (2014) Forensic analysis of biological evidence. ISBN 9781466504561
Melton T, Holland M (2012) Forensic mitochondrial DNA analysis: current practice and future
potential. Forensic Sci Rev 24:101–122
Mildenhall DC, Wiltshire PE, Bryant VM (2006) Forensic palynology: why do it and how it works.
Forensic Sci Int 163(3):163–172
Milne L (2005) How Pollen Brought a Murderer to Justice. In: A grain of truth. Reel New Holland
Publ, Sydney
Arya Neelam (2007) Forensic botany as a tool in crime investigation. Published in proceedings in
XVIII all India forensic science Conference-2007, 270-73
Arya Neelam (2009) Green revolution: forensic botany as a Noval approach in crime investigation.
Published in proceedings in XX all India forensic science Conference-2009, 15–20
Arya Neelam (2011) High potential of plant DNA analysis in forensics. Published in souvneir on
biodiversity: challenges & opportunities
Rana AK (2018) Crime investigation through DNA methylation analysis: methods and applications
in forensics. Egypt J Forensic Sci 8:7
Zhang ZL, Liang WB, Sun HB, Yang X, Ma LY (2021) Forensic application of plant evidence. Fa
Yi Xue Za Zhi 37(1):87–90. https://doi.org/10.12116/j.issn.1004-5619.2019.490708
Forensic Entomology
29
Kamsalem Guite, Rutwik Shedge, Varsha Warrier,
and Tanuj Kanchan

Abstract

Forensic entomology deals with the application of arthropods and insects in the
investigation of legal matters. The areas of investigation include arthropods and
insect infestation of raw and processed food items, invasion of human habitation
and material structures, and infestation of dead and decomposing bodies. These
forensic entomology branches are known as stored or food product entomology,
urban entomology, and medico-legal entomology, respectively. Insects are
known to exhibit a distinct pattern of succession in the decomposing body. The
arrival of the first insect, the blowfly, sets off a biological clock that catalyzes the
response of other insects to invade the corpse. The established successional
pattern of insect infestation is useful in the determination of postmortem interval
(PMI) in the medico-legal context. Moreover, medico-legal entomology is also
used in the investigation of criminal acts such as rape, homicide, suicide, translo-
cation of the dead body, drug abuse, abuse and neglect of the elderly, cruelty to
animals, personal identification, insect species identification, and geographical
origin of species. Factors such as temperature, presence of clothing and
wrappings around the body, pH of the burial soil, and depth of burial can delay
the arrival of insects and the rate of decomposition. The integration of scientific
techniques in the field of forensic entomology has fundamentally expanded our
understanding of these tiny creatures and enhanced their admissibility in the
settlement of legal matters.

K. Guite (✉) · V. Warrier · T. Kanchan

Department of Forensic Medicine and Toxicology, All India Institute of Medical Sciences, Jodhpur,
Jodhpur, Rajasthan, India
R. Shedge
School of Forensic Science, National Forensic Sciences University, Gandhinagar, Gujarat, India

# The Author(s), under exclusive license to Springer Nature Singapore Pte 415
Ltd. 2024
A. Puri et al. (eds.), Fundamentals of Forensic Biology,
https://doi.org/10.1007/978-981-99-3161-3_29
416 K. Guite et al.

Keywords

Forensic entomology · Stored · Food product entomology · Urban entomology ·

Medico-legal entomology · Successional pattern · Postmortem interval

29.1 Introduction

Entomology is the study of arthropods and insects. It is the branch of zoology that
deals with the invertebrate phylum Arthropoda and the class Insecta. The word
entomology is derived from the Greek word “entomon,” meaning insect, and
“logos,” meaning discourse. Insects make up about 80% of all known animal
species, more than a million, the largest group in the animal kingdom (Singh and
Sachan 2007).
Entomology generally involves the study of the biology, habitation, mutation,
and management of arthropods and insects in relation to the environment (Singh and
Sachan 2007). Arthropods and insects are cosmopolitan in distribution, and they
have high adaptability to various geographical areas. They play a vital role in the
maintenance of ecological balance and the recycling of nature. Despite being
numerous, less than 1% of the total known insect species are harmful to us
(Omkar 2017). While some insects create problems for humans by destroying
agricultural crops, carrying diseases, and sometimes causing fatal bites, others play
a valuable role in the food, textiles, and cosmetic and medical industries (Vanin
2018).
In recent decades, arthropods and insects have been increasingly recognized by
law to regulate legal matters. This is possible due to the extensive studies conducted
by experts from various professions around the world. This introduced entomology
into the field of crime solving, now known as forensic entomology.
Forensic entomology is a branch of forensic science and is associated with the
utilization of arthropods and insects in a court of law (Lord and Rodriguez 1989).
Forensic entomology can be divided into three categories: urban, store-product, and
medico-legal entomology (Lord and Stevenson 1986; Catts and Goff 1992). Urban
entomology deals with arthropods and insects that infest houses, buildings, and
physical structures. Stored food/product entomology deals with arthropods and
insects that infest crops, stored products, and processed food, and medico-legal
entomology deals with arthropods and necrophagous insects in criminal cases such
as rape, murder, estimation of PMImin to name a few. Medico-legal entomology is
the most discussed and researched area of forensic entomology (Magni et al. 2013).
The utility of insects is diverse, and there is still much to be explored about them.
This chapter focuses on the field of forensic entomology and its application to
everyday life.
29 Forensic Entomology 417

29.2 History of Forensic Entomology

The field of forensic entomology is ancient. The foundation of this field lies in the
abundance of experimentation, research, and, above all, human curiosity to under-
stand the purpose of the existence of these tiny creatures. The first documented case
of forensic entomology came from China in 1235 (thirteenth century). Sung Tźu, a
Chinese lawyer and death investigator, wrote in his medical law book, Hsi yuan chi
lu “The washing away of wrongs,” about the event of the crime. The case involved a
stabbing homicide with a sickle. The criminal was convicted after a blowfly landed
on the old sickle smeared with blood (Warrier and Shedge 2019).
In the late seventeenth century, the Italian physician and naturalist Francesco
Redi confirmed that flies and maggots do not arise from meat, but from eggs laid by
adult flies that were attracted to decaying flesh. In the mid-eighteenth century, the
Swedish naturalist, Carolus Linnaeus, introduced the binomial nomenclature in 1735
(Gennard 2012). In the nineteenth century, Louis-François Bergerette, a French
physician, made the first estimate of the postmortem interval on a corpse from his
investigation of a mummified child found trapped in a chimney in 1850 (Benecke
2007).
In the following decades, investigations into death using insects continued. In
1878, a French pathologist Paul Camille Hippolyte Brouardel worked with Monsieur
Perier and Jean Pierre Megnin. Together, they investigated the death of a newborn
child infested with arthropods. Thereafter, Megnin published his books Fauna des
Tombeaux (1887) and La Faune des Cadavres (1894) in which he described eight
successive waves of insects colonizing dead bodies on land and two successional
waves colonizing dead bodies in soil (Benecke 2007; Rivers and Dahlem 2014).
In 1881, 10 years before Megnin published his book, German physician Hermann
Reinhard conducted an extensive study of insects in buried remains. His research led
to the detection of Phorid flies, also known as Coffin flies, inhabiting buried or
trapped remains (Gennard 2012). Around this time, in the United States, Murray Galt
Motter examined the decomposition patterns of unearthed human remains and
identified the role of different insect species, the effect of the depth of burial, and
the soil conditions at the burial sites (Benecke 2007). In the twentieth century, Jean-
Henri Casimir Fabre (1823–1915) published a collection of information on carrion
beetles and necrophagous fly species. He named these collections, the accumulation
of his research, Souvenirs Entomologiques (Souvenirs of Insect Life). Then, in 1916,
J.M. Aldrich published “Sarcophaga and Allies.” Twenty years later, D.G. Hall
published “The Blowflies of North America” (Rivers and Dahlem 2014). After more
than three decades, Adel S. Kamal’s publication in 1958 characterized 13 species of
necropsy insects, adding to the existing knowledge of insects of scientific impor-
tance (Kamal 1958). In 1965, Jerry Payne conducted the first experiment to study
insect succession on the decomposing body using pig carcasses. Through
subsequent efforts and initiatives by various other scientists, forensic entomology
was recognized as a branch of forensic science and consequently accepted by the
courts. In 1996, the American Board of Forensic Entomology (ABFE) was
established. Later, the European Association for Forensic Entomology (EAFE)
418 K. Guite et al.

was founded in 2002 and the North American Forensic Entomology Association
(NAFEA) organized its first meeting in Las Vegas in 2002 (Anderson 2014).
Recent advances in science and technology and their subsequent incorporation
into the field of forensic entomology have increased our understanding of arthropods
and insects. As a result, the importance of forensic entomology in criminal
investigations will continue to grow.

29.2.1 Stored Food/Product Entomology

Stored food/product entomology deals with the investigation of insect pests found in
raw and processed food items. The food items include cereals, pulses, seeds, nuts,
dry fruits, and other kinds of durable items (Hagstrum and Subramanyam 2009).
Typically, forensic cases of stored product entomology involve pest infestation at the
time of harvesting, storing, processing, selling, purchasing, and consuming of the
food items (Defilippo et al. 2017).

29.2.2 Urban Entomology

Urban entomology is the branch of forensic entomology that deals with arthropods
and insects in and around human habitation (Rivers and Dahlem 2014). Here, the
term “human habitation” not only comprises houses and infrastructures, but also the
environment in which people live (Catts and Goff 1992). Urban entomology
includes not only structural elements but also the problems of insect invasion of
patients in healthcare facilities, pets, and farm animals (Keil 2015). Moreover, urban
pests affect not only our well-being, but also man-made structures, landscapes, food
security, and livestock (Gordon 2020). Furthermore, these pests make irritating
noises and destroy our clothes, carpets, books, food items, furniture, etc. (Singh
and Sachan 2007). They also cause painful bites and stings. Some feed on blood,
while others transmit parasites and pathogens, causing entomophobia (Robinson
2005). Exposure to insect pests can induce allergic reactions (Gondhalekar 2019).
Moreover, their bites/stings can cause discomfort and can sometimes be fatal.

29.3 Medico-Legal Entomology

When a dead body is recovered, the question of what, where, how, when, who, and
why needs to be addressed by forensic experts. The methods of estimating the
postmortem interval (PMI) using the normal changes in the body have limitations
in that they can estimate the time since death within the first 72 h (Hall et al. 2012;
El-Kady 1999). In such situations, arthropods and insects become the best alternative
to answer the above questions. The first recorded case of medico-legal entomology
happened in China in the thirteenth century. Since then, the application of insect
knowledge in the medico-legal field has attracted considerable interest from
29 Forensic Entomology 419

researchers of various professional backgrounds around the world. Insect evidence is

often involved in crimes such as rape, suicide, murder, and poaching. Also, there are
deaths due to drug abuse and consumption of poisons and pesticides. Moreover,
insect infestations on living individuals or animals are also relatively common. In all
criminal activity where the evidence entails insect material, the nature of investiga-
tion falls under the domain of medico-legal entomology. Forensic medical entomol-
ogy or forensic medico-legal entomology, popularly known as medicocriminal
entomology (Hall 1990; Hall and Huntington 2009), is the branch of forensic
entomology that deals with the utilization of arthropods and insects to estimate the
minimum postmortem interval (PMImin), determine the cause of death, and relate the
evidence to the primary and secondary crime scenes (Catts and Goff 1992; Tüzün
et al. 2015). Medico-legal entomology has the highest application among the three
branches of forensic entomology (Magni et al. 2013).
The application of entomology to criminal investigation is myriad. Through their
activity, insects can reveal abuse, neglect, and cruelty toward children, the elderly,
and livestock. Besides, insects can also disclose the presence of wounds on a body
based on their area of localization. Insects are also helpful in identifying if the
murder is executed in a particular area and the corpse is relocated to a different
geographical area (Charabidze et al. 2017). They can also assist to ascertain that a
particular vehicle is being used to transport the dead body. Additionally, the pres-
ence of insect species from a particular geographic area on a cadaver in an area where
that species is absent can provide evidence of translocation of the corpse. Further-
more, non-native insects and pollens recovered on the dead body can be analyzed for
comparison with available data of the nearby geographical region. This can give a
clue to the location of the primary crime scene (Volckaert 2020; Pinto et al. 2021).
These miniature insects are highly adaptive and can withstand immolation (Malainey
and Anderson 2020). As a result, they can provide evidence to indicate the cause of
death in a fire or explosion case.
Blowflies (Calliphoridae) are usually the first insect to arrive on a dead body
(Malejko et al. 2020). They are the pioneers of the successive pattern of insect
colonization because they initiate the system that triggers the response of other
insects and arthropods to the decomposing body. Megnin was the first scientist to
observe the pattern of insect colonization on the dead body (Smith 1986). He
reported that insects exhibit eight successive waves on land and two successive
waves in soil. The necrophagous insects underwent four stages, i.e., egg, larval,
pupal, and adult stages to attain maturation. The knowledge of the waves of insect
successional patterns and the stages of insect development is paramount as they form
the core application of insects in medico-legal entomology, most importantly, in the
estimation of the PMImin of a recovered body.
The criminal, often after the murder, tried to hide the victim’s body by burial in a
shallow trench. Since the decomposed body is rarely encountered, necrophagous
insects developed a strong sense of smell and locomotion for their survival (Lord and
Rodriguez 1989). If insects discover the buried body and gain access to it, depending
upon the condition of the burial soil (whether the soil is loose or compact), the
presence of physical material such as a coffin, clothing and wrappings around the
420 K. Guite et al.

Fig. 29.1 Adult blue blowfly

(Calliphora vicina). (Pest and
Diseases Image Library,
Bugwood.org)

Fig. 29.2 Adult green bottle

fly (Lucilia spp.). (David
Cappaert, Bugwood.org)

body, pH of the soil, and depth of burial, they can effectively colonize and decom-
pose the body (Jordan and Tomberlin 2017; Mabika et al. 2014; Wang et al. 2017).
The most important insects in medico-legal entomology belong to the order
Diptera, which includes blowflies (family Calliphoridae) and flesh flies (family
Sarcophagidae). The species differ in abundance from region to region, habitat to
habitat, and from season to season (Lord and Rodriguez 1989). There is a greater
variety of arthropod species in the tropics than in urban areas of human habitation
(Azwandi et al. 2013). Also, the insect species present may differ geographically.
Other forensically significant arthropods include beetles (order Coleoptera), moths
(order Lepidoptera), and mites (class Acari) (Figs. 29.1, 29.2, 29.3, 29.4, 29.5, 29.6,
and 29.7) (Malejko et al. 2020).
29 Forensic Entomology 421

Fig. 29.3 Adult flesh fly

(Sarcophagidae)

Fig. 29.4 Blowfly larvae.

(Susan Ellis, Bugwood.org)

29.3.1 Important Insects in Medico-Legal Entomology

Arthropods and insects are ubiquitous and have a vast geographical habitat range.
Insects are the first organisms to show up on an exposed dead body. The first insect
to arrive, the adult blowfly, lays about 300 eggs at a time on the host (Sarwar 2020).
Soon after hatching, the larvae feed on the host and assist in the release of volatile
gases that attract other necrophagous insects. The feeding stage of the larvae is so
intense that they devour the corpse within a few days or weeks. Sarwar (2020)
422 K. Guite et al.

Fig. 29.5 Adult Dermestid

beetle. (Daniel R. Suiter,
University of Georgia,
Bugwood.org)

Fig. 29.6 American carrion

beetle (Necrophilia
americana). (Gary Alpert,
Harvard University,
Bugwood.org)

mentioned that under favorable conditions, larvae can devour 60% of the human
body in less than a week. To describe the numerous eggs produced by a single adult
fly and the rigorous feeding habit of the larvae, Linnaeus once mentioned that three
adult flies would decimate a horse as fast as a lion would (Benecke 2007). While the
blowflies are oviparous, the flesh flies are larviparous. Though there are more than a
million insect species in the world, only a handful of them is relevant to medico-legal
entomology. Some of these forensically significant insects are listed in Table 29.1.

29.3.2 Classification of Forensic Arthropods and Insects

The insects that feed on dead bodies can be divided into four ecological groups:
necrophagous species, predators, and parasite species that feed on necrophagous
29 Forensic Entomology 423

Fig. 29.7 Adult skin beetle

(Trox unistriatus).
(Pennsylvania Department of
Conservation and Natural
Resources Forestry,
Bugwood.org)

insects, omnivorous species that feed on the corpse and other insects, and adventive
species (Smith 1986).

1. Necrophagous species: These species include Diptera such as Calliphorids and

Sarcophagids, and Coleoptera such as Silphids and Dermestids. They are the
most forensically significant group because of their primary association with the
corpse (Hall et al. 2012).
2. Omnivores species: These species feed on the dead body and other infesting
insects. The presence of enormous omnivorous species may cause delayed
decomposition due to the dietary habit of other necrophagous insects (Early and
Goff 1986). This group includes species of ants, wasp, and beetles.
3. Predators and parasites species: This group is considered second only to necroph-
agous species in terms of forensic importance (Smith 1986). Arthropods and
insects in this group include species of Coleoptera (Silphids, Staphylinids,
Histerids), Diptera (Calliphorids), Hymenoptera that feed on immature flies,
and Mites (Macrochelids, Parasitids, Parholaspids, and Uropodids) that predates
on other mites, nematodes, and insects (Catts and Goff 1992).
4. Adventive species: This group includes arthropod species that benefit from the
corpse for their habitation. Arthropods in this group include spiders (which may
424 K. Guite et al.

Table 29.1 Insects of forensic importance

Flies (Order Diptera)
Blow flies (family Calliphoridae) Calliphora vicina (Robineau-Desvoidy),
Calliphora vomitoria (Linnaeus), Chrysomya
albiceps (Wiedemann), Chrysomya
megacephala (Fabricius), Chrysomya rufifacies
(Macquart), Cynomya mortuorum (Linnaeus),
Lucilia illustris (Meigen), Phormia regina
(Meigen), Lucilia sericata (Meigen)
Flesh flies (family Sarcophagidae) Sarcophaga bullata (Parker), Sarcophaga
haemorrhoidalis (Fallen), Sarcophaga
argryostoma, Sarcophaga crassipalpis,
Sarcophaga peregrina, Sarcophaga albiceps,
Sarcophaga africa, Sarcophaga caerulescens
Muscid flies (family Muscidae) Hydrotaea aenescens (Wiedemann), Hydrotaea
leucostoma (Wiedemann), Musca domestica
(Linnaeus), Muscina stabulans (Robineau-
Desvoidy), Musca autumnalis (De Geer),
Musca sorbens
Skipper flies (family Piophilidae) Piophila casei (Linnaeus), Prochyliza
sp. (Walker)
Dung flies (family Scathophagidae) Scatophaga stercoraria (Linnaeus)
Black scavenger flies (family Sepsidae) Sepsis sp.
Small dung flies, minute scavenger flies Poecilosomella angulata (Thomson)
(family Sphaeroceridae)
Soldier flies (family Stratiomyidae) Hermetia illucens (Linnaeus)
Humpbacked flies or scuttle flies (family Megaselia scalaris (Loew), Conicera tibialis
Phoridae) (Schmitz)
Moth flies, sand flies, and owl midges (family Psychoda alternata (Say)
Psychodidae)
Beetles (Order Coleoptera)
Carrion beetles (family Silphidae) Heterosilpha ramosa (Say), Necrodes
surinamensis (Fabricius), Necrophilia
americana (Linnaeus), Nicrophorus orbicollis
(Say), Oiceoptoma noveboracense (Forster),
Thanatophilus sinuata (Fabricius),
Thanatophilus rugosus (Fabricius),
Nicrophorus vespilloides (Herbst)
Skin beetles, leather beetles, hide beetles, Dermestes ater (DeGeer), Dermestes maculatus
carpet beetles, larder beetles (family (DeGeer), Dermestes lardarius, Dermestes
Dermestidae) frischii (Kugelann)
Rove beetles (family Staphylinidae) Creophilus maxillosus (Gravenhorst),
Platydracus fossator (Gravenhorst),
Platydracus maculosus
Clown beetles (family Histeridae) Hister noma (Erichson), Saprinus
pensylvanicus, Arcinops pumilo (Ericson),
Saprinus lugens (Erichson)
Checkered beetles (family Cleridae) Necrobia rufipes (DeGeer), Korynete
scaeruleus
(continued)
29 Forensic Entomology 425

Table 29.1 (continued)

Hide beetles (family Trogidae) Trox suberosus (Fabricius), Trox unistratus
(Beauvaris)
Scarab/dung beetles (family Scarabaeidae) Deltochilum gibbosum gibbosum (Fabricius),
Phanaeus vindex (MacLeay), Deltochilum
brasiliense (Castelnau), Eurysternus parallelus
(Castelnau), Coprophanaeus (Megaphanaeus)
ensifer (Germar)

Adult Blow fly

Eggs
Pupa After 10 days Oviposits after 2 (around 300 in
(Eclosion) days of maturation number in one
sitting)

After 4 days
(Prepupal stage) At 25° Clesius Hatch after 1 day

After 2 days After 1 day

Third instar larva
First instar larva
(length is about
(2mm in length)
17mm)
Second instar larva
(length increase by
2mm - 3mm)

Fig. 29.8 Life cycle of blowfly

become incidental predators), centipedes, springtales, pill bugs, and mite species
Acaridae, Lardoglyphidae, and Winterschmidtiidae (Smith 1986; Goff 1989).

29.3.3 Life Stages of Blowfly

The life cycle of a blowfly is a speedy process and usually spans between 2 and
4 weeks to attain maturation depending on the species (Cruz 2006; Dimitrov et al.
2020). The rate of development is temperature-dependent (Chen et al. 2019), i.e., the
higher the temperature, the faster the growth and vice versa (Cruz 2006; Anderson
2014; Sarwar 2020). Blowfly exhibits four stages of development (Hall et al. 2012):
the egg stage, the larva (maggot) stage, the pupa stage, and the adult stage (Dellinger
and Day 2015). A brief description of the four developmental stages is given below
(Fig. 29.8):
426 K. Guite et al.

29.3.3.1 The Egg Stage

The eggs are small and slightly elongated. Their size ranges from 2 to 3 mm, and
they look whitish yellow. They occur in clusters, especially in body openings, and
are visible to the naked eye. The number of eggs is relatively less in winter, and they
are concealed deep within the nostrils or underneath the eyelids of the host. The eggs
hatch within 1–3 days. However, the time of hatching depends upon the species and
the existent environmental conditions (Lord and Rodriguez 1989).

29.3.3.2 The Larva (Maggot Stage)

Larvae are the newborns from the eggs. They have a tapering anterior end that
contains a pair of mouth hooks used for feeding and movement. The larvae have a
pair of flattened structures called spiracles for breathing. The larval stage represents
the active feeding and growing stage. The growth and development of the larvae
involve three instars: first, second, and third instars, which are separated by a period
of molting of the skin (Hall et al. 2012). The first instar larva has a pair of D-shaped
posterior spiracles, while the second and third instar larvae have a pair of fan-shaped
anterior spiracles that are dorsally situated in the thorax. At each stage of molting, the
larva sheds the outer layer and internal cephalopharyngeal skeleton (mouthparts),
and the lining of the tracheal system. Therefore, each larva in each larval stage has a
new set of spiracular slits and mouthparts (Anderson and Cervenka 2002). The
larvae mature within several days to several weeks depending upon the ambient
temperature, the larval body temperature, and the heat emitted by the larval masses.

29.3.3.3 The Pupal Stage

At the end of the third instar, the larvae cease feeding and migrate to the nearby
areas. They slow down their activity and contract their body into a shorter, thicker
form that will eventually become the puparium (Cruz 2006). They bury themselves
inside the soil or hide under surrounding objects. They secrete a hard outer skin or
casting around their body known as pupae and undergo a transformation called
metamorphosis. The pupal cases are football-shaped, reddish to dark brown, and can
survive for more than a hundred years (Lord and Rodriguez 1989). Generally, the
pupal cases are found buried in the soil beneath the corpse and around its remains.

29.3.3.4 The Adult Stage

After complete metamorphosis or transformation inside the pupae, the adult fly
emerges from the pupae to continue the life cycle (Figs. 29.9, 29.10, and 29.11).

29.3.4 Fauna of Decomposing Body

The decomposition of a dead body is a long process. In general, decomposition lasts

between a few weeks to several months and, in some cases, even years depending
upon the environmental conditions. In their experimental study using pig carcasses,
Tullis and Goff (1987) noticed five waves of successional arthropods.
29 Forensic Entomology 427

Fig. 29.9 Larva of flesh flies

(Sarcophaga spp.). (Pest and
Diseases Image Library,
Bugwood.org)

Fig. 29.10 Larva of flesh

flies (Sarcophaga spp.). (Pest
and Diseases Image Library,
Bugwood.org)

Fig. 29.11 Pupa of Catalpa

sphinx (Ceratomia catalpae).
(Herbert A. “Joe” Pase III,
Texas A&M Forest Service,
Bugwood.org)
428 K. Guite et al.

29.3.4.1 Fresh Stage (1–2 Days)

This stage begins immediately after death and ends with the onset of bloating.
Although autolysis has begun, there is minimal morphological change. Arthropods
observed in this stage include Calliphorids such as Chrysomya megacephala (F.) and
Chrysomya rufifacies, Drosophila (Sophophora) sp., Diploneura peregrina, and
Creophilus maxillosus (L.).

29.3.4.2 Bloated Stage (2–7 Days)

Putrefaction starts at this stage, and bloating occurs due to the action of anaerobic
bacteria. The activity of colonizing insect maggots and the process of putrefaction
increase the internal temperature of the carcass. This stage ends with the deflation of
the carcass due to penetration of the abdominal wall by the feeding larvae. This stage
harbors the largest number of adult Diptera. The predominant species were
C. megacephala and C. rufifacies. Other insect species include Parasarcophaga
misera, Nabis lusciosus (White), C. maxillosus, and Thyreocephalus albertisi
(Fauvel).

29.3.4.3 Decay Stage (5–13 Days)

Most adult calliphorids leave the carcass at this stage. There is an increase in the
internal temperature of the decomposing carcass to higher than the ambient temper-
ature. The rise in internal temperature conforms to the development of putrefactive
odor. This increase in temperature is due to the heat released by the accumulation of
numerous maggots feeding on the carcass. The rise in temperature is followed by a
rapid drop in the internal temperature to match the ambient temperature. At the end
of this stage, the emitted odor diminishes. There is also a significant reduction in the
weight of the carcass because of the feeding larvae and their subsequent relocation
post-feeding to nearby places for pupation. This stage was dominated by the larvae
of insects, which include the Chrysomya species, C. rufifacies, C. megacephala,
Ophyra spp., Ophyra aenescens (Wiedemann), Ophyra chalcogaster, and
Atherigona orientalis (Schiner).

29.3.4.4 Post-Decay Stage (10–23 Days)

This stage marks the departure of the matured larvae from the carcass. The carcass
remain contains bones, hair, cartilage, tissues, and by-products of decay (BOD). The
BOD acts as a source of food for visiting arthropods. The weight of the carcass
continues to decline but not at a substantial level. Common arthropods found in this
stage include Leptocera punctipennis, Leptocera bifrons, Puliciphora lucifera
(Dahl), P. australis, and Psychoda pseudoalternata (Williams) and Dermaptera.

29.3.4.5 Remains Stage (18–90 Days and Above)

At this stage, the BOD is exhausted, and the remains consist of bones and a few
cartilages. The transition from the post-decay stage to the remains stage is gradual.
There is a sharp decline in the Dipteran population. Some of the entomofauna
encountered in this stage include Psycholids, Dermaptera, Isopoda, and Ants.
29 Forensic Entomology 429

29.3.5 Factors Affecting Insect Colonization in a Decomposing Body

The colonization of the decomposing body by arthropods and insects involves inter-
species and intra-species interaction and their interaction with the physical environ-
ment. Broadly considered, species interaction in nature is influenced by two factors:
biotic and abiotic (Jordan and Tomberlin 2017). The biotic factors include competi-
tion, predation, commensalism, pathogens, and resource quality. The abiotic factors
include nutrition, temperature, humidity, Ph, salinity, and resource quality (Jordan
and Tomberlin 2017). While biotic interaction is crucial for maintaining the balance
between species, abiotic interaction essentially determines their chance of existence
and continuation of the life cycle. The biogeoclimatic zone, also known as the
geographic zone, is an important element that influences insect distribution. The
biogeoclimatic zone includes both the biotic and abiotic factors such as vegetation,
habitat, soil type, and meteorological condition such as temperature, humidity, and
rainfall (Mabika et al. 2014). Of all the factors affecting the life cycle of insects,
temperature appears to be the most crucial.
Insects are poikilothermic, meaning their body temperature changes with the
ambient temperature (Hofer et al. 2017). Singh and Sachan (2007) noted that most
insects survive anywhere between 0 and 50 °C, but assumably no single species can
thrive across this range. The optimum temperature range for most species is between
22 and 38 °C. However, some species can survive temperatures above these ranges.
For instance, some dipteran larvae can survive at 55 °C or more, but certain beetles
can evolve at about 0 °C (Singh and Sachan 2007). Different insect species have
different temperature ranges in which they can survive, outside of which they die.
Insects are also known to tolerate high or low temperatures during certain stages of
their life cycle. For example, many insects can survive in much colder temperatures
in winter than in summer. Tropical species are generally less cold-hardy than
temperate species. Terrestrial insects can usually tolerate a wider range of
temperatures than aquatic insects. This is because the range of temperature change
for terrestrial habitats is typically larger than that for aquatic habitats (Singh and
Sachan 2007). Temperature also affects adult insect activity patterns, such as the
timing of egg laying (Fauvergue et al. 2008) and larval development (Ames and
Turner 2003). In addition to temperature and rain (Archer 2004), competition for
food can either accelerate or retard insect colonization of decomposing bodies
(Azwandi et al. 2013).
Seasons also contribute to the rate of body decomposition and the arrival of
necrophagous insects. In general, the hot season attracts more insects to a corpse than
the cold season. Low temperatures during the cold season can impede the hatching of
eggs (Iancu et al. 2015). Structures such as coffins, clothing, body wrappings, and
closed indoor scenes act as insulation from the outside environment (Hall et al. 2012;
Lowe et al. 2013). The presence of these elements limits insects’ access to the corpse
and delays its decomposition. Furthermore, the clothed-covered part of the body
dries slower than the unclothed part, resulting in fewer maggots over an extended
period of time (Voss et al. 2011). Interestingly, the pH of the burial soil can either
hasten or delay the decomposition rate. Higher pH (alkaline) soil tends to retard
430 K. Guite et al.

decomposition and vice versa (Lowe et al. 2013). The depth at which a body is
buried is another factor that needs to be considered when determining the time of
insect colonization. Buried corpses take a longer time to decompose. The diversity of
the necrophagous insect species is found to vary with soil depth (Rysavy and Goff
2014). In general, arthropod diversity increases (Smith 1986; Simon 2019) with
depth and with the long-term burial of cadavers (Simon 2019). The size of the
decomposing body also determines the diversity of insect fauna (Silva et al. 2014)
and the possibility of raising offspring by necrophagous insects as small carcasses
provide little to no chance of generating offspring (Perotti and Braig 2009; Wang
et al. 2017). In a study of organophosphate poisoning by Gunatilake and Lee Goff
(1989), the investigators observed that the presence of Malathion in the tissues
delayed insect colonization on the corpse for several days.
The insect colonization of decomposing bodies is enigmatic in the aquatic
environment. There is a disparate pattern of insect succession in water and on
land. Forensically significant aquatic insect includes Mayflies (Ephemeroptera),
Caddisflies (Trichoptera), and True flies (Diptera) that is chiefly represented by
Midges (Chironomidae) and Black flies (Simuliidae). These insect species are not
obligatory carrion feeders; rather, they utilize the submerged flesh for food and nests
(Amendt et al. 2009). Although seasonal changes appear to influence the pattern of
aquatic insect succession, there seem to exist some confounding elements to it
(Anderson and Hobischak 2004). Extensive research is imperative to further our
understanding of aquatic insects for medico-legal use.

29.3.6 Estimation of Postmortem Interval (PMI)

The necrophagous species, blowflies (Diptera), are the first insect to arrive at a scene
of death. They are considered the most useful evidence for the estimation of PMImin
(Hall et al. 2012). In warm weather, blowflies (Calliphoridae) can arrive within a few
seconds or minutes (El-Kady 1999). Shortly after death, the body starts to break
down through the process of autolysis. During this process, various gases such as
hydrogen sulfide, carbon dioxide, ammonia, methane, sulfur dioxide, and hydrogen
are released from the body (Smith 1986). The sulfur-based compounds attract insects
to the body, while the ammonium-based compounds induce oviposition (Elden
Elfeky et al. 2017). Flies have efficient sensory organs that help them detect these
gases even within far-off distances (El-Kady 1999).
Upon arrival, blowflies would either begin laying eggs or, at first, feeding on the
fluid emitted from the corpse. They then began laying eggs in body cavities such as
the mouth, nose, ears, eyes, and around the exposed anus and genitals. This happens
because blowflies cannot penetrate the skin due to their soft tongue. The body
cavities provide a favorable environment for larval growth and development (Lord
and Rodriguez 1989). The larvae grow in a semi-fluid environment and go through
stages of transformation until maturity. Blowflies’ activity triggered a biological
clock that facilitated the continuous arrival of other arthropod and insect species. The
analysis of the larval development and the foreseeable course of colonization of dead
29 Forensic Entomology 431

bodies by insects form the principal of PMI estimation (Catts and Goff 1992;
Anderson and Cervenka 2002).
Conventionally, the postmortem interval is estimated from the changes on the
external surface of the body. These include livor mortis, rigor mortis, lividity, and
changes in the eye. However, when the body is in an advanced state of decomposi-
tion and the identity of the external appearances cannot be accessed, insects offer the
best interpreting resource for determining the PMI. In general, there are two methods
of estimating PMI using insects. The first is the pattern of successive waves of insect
colonization and the second is the age and development of maggots (Anderson n.d.;
Anderson and Cervenka 2002). The succession pattern data provide information on
the range of time, while the development data provide information on the period of
time that the body was colonized by insects (Wang et al. 2019). Because the duration
of insect colonization does not provide accurate PMI (Amendt et al. 2007), the
development data are modified to represent a segment of the total PMI. This refined
concept is known as minimum postmortem interval (PMImin) and is explained as the
time between the colonization of the corpse by insects and the discovery of the oldest
immature insect, i.e., when it was first laid as an egg or as larvae in some species
(Villet et al. 2009).
If a body died between a month and a year or more, data on the successional
waves of insect colonization are used. However, if the body died 1 month before
discovery, maggots’ age and their development are used as the time frame (Anderson
n.d.). The latter is done by measuring the length of the oldest larvae and comparing it
with reference data (Volckaert 2020). If blowfly eggs are encountered on a dead
body at night or early in the morning, it is presumed that the body died the previous
day or earlier (El-Kady 1999).
When entomological evidence is involved in a crime, it is important to gather data
on insect activity, ambient temperature, barometric pressure, humidity, rain, depth of
burial, and the presence of scavengers (Nihal Açikgöz 2016). This is crucial because
higher temperatures (Elden Elfeky et al. 2017) and rainfall accelerate the decompo-
sition process (Hofer et al. 2020).
The collection of data on the past ambient temperature from the nearest weather
station is needed to reconstruct the rate of decomposition and period of insect
succession (Michalski and Nadolski 2018). Precise temperature data at a crime
scene are also critical for making accurate PMImin and estimating the
pre-appearance interval (PAI) of insect succession patterns (Hofer et al. 2017).
The most reliable variable for the determination of PMImin is the accumulated degree
day (ADD) and the accumulated degree hours (ADH) based on the measurement of
temperature (Nihal Açikgöz 2016). Alternatively, in the absence of these data,
examination of the cuticular bands in blowfly (Tyndale-Biscoe and Kitching
1974), measurement of pteridine levels in adult screw-worm fly (Bernhardt et al.
2017), and assessment of the changes in the chemical composition of the empty
puparia (Bajerlein et al. 2018; Wydra and Matuszewski 2021) can be used for
estimating the PMImin.
432 K. Guite et al.

29.3.7 Entomology in Child Abuse, Neglect of the Elderly,

and Cruelty to Animal

Medico-legal entomology is not only confined to the investigation of the dead. It also
finds its utility in the living. It can deliver information on the location of the wound,
the time the wound is inflicted, and if the nature of the wound characterizes abuse or
neglect (Brundage and Byrd 2016). This knowledge is especially useful in the
investigation of neglected and abused children and the elderly. The presence of
head lice and maggots, often in huge numbers on a person, is a sign of neglect and
lack of hygiene (Volckaert 2020). The infestation of injured living tissues by insect
larvae is called myiasis. Zumpt (1965) defined myiasis as “the infestation of live
human and vertebrate animals with dipterous larvae, which, at least/or a certain
period, feed on the host’s dead or living tissue, liquid body substances, or ingested
food.” Myiasis occurs due to the presence of untreated wounds or injuries. The
maggots feed on the dead and dying tissues of the individual and can cause extensive
damage if not attended to on time. By measuring the maggot size or length, it is
possible to estimate the minimum time lapse since the individual child (e.g., dirty
and soiled diapers) or elderly (e.g., infested bed sores) was last attended to
(Anderson n.d.).
Insects also play an essential role in the investigation of cruelty to animals. Fur, in
the absence of a wound, is the first area to be colonized by insects in neglected
animals (Brundage and Byrd 2016). Traditionally, the presence of insect maggots
(myiasis) in a living animal in a particular area is an indication of injury. The time of
colonization is estimated either from the stages of larval development or the succes-
sion of insect species and is an indication of the period the animal has been
neglected. Interestingly, the insects that cause myiasis are the same as those that
colonize the decomposing bodies. Blowfly species namely the New World screw-
worm fly (Cochliomyia hominivorax) and the Old World screwworm fly
(Chrysomya bezziana) are obligate parasites that cause myiasis. Other myiasis
causing Old Worm insects include Window Gnat (Anisopus fenestralis Scopoli),
Phryne fenestralis Lindner, Psychoda Latreille, Trichoptera Meigen, Megaselia
Rondani, Common House fly (Musca domestica Linnaeus), Lucilia sericata, Lucilia
porphyrina (Walker), Sarcophaga haemorrhoidalis (Fallen), Sarcophaga albiceps
(Meigen), and Gasterophilus intestinalis (De Geer) (Zumpt 1965).

29.3.8 Geographical Habitat of Some Insects of Forensic

Significance

Insects have a vast geographical distribution. Although cosmopolitan in distribution,

they have their own ecological niche where they are found in abundance. However,
the distribution of species is not uniform and local density differs from region to
region (Charabidze et al. 2017). Their activity and richness are also determined by
the season (Benbow et al. 2013; YuBo et al. 2018; Zou et al. 2022), vegetation
(MacLeod and Donnelly 1957; Hwang and Turner 2009), and abundance of light
29 Forensic Entomology 433

(Holdaway 1933; Barenbaum 1985) or shade (Nuorteva 1964; Barenbaum 1985).

Vasconcelos and Araujo (2012) reported that the necrophagous insect species
including Hystriocnema plinthopyga (Wiedemann, 1830), Oxysacordexia avuncu-
lar, O. fluminensis (Lopes, 1946), O. intona (Curran and Walley, 1934), O. modesta
(Lopes, 1946), Oxyvinia excisa (Lopes, 1950), Chloroprocta idioidea (Robineau-
Desvoidy, 1830), Hemilucilia segmentaria (Fabricius, 1805), H. semidiaphana
(Randoni, 1850), and Lucilia sericata (Meigen, 1826) were exclusive to the forest
of northeastern Brazil, whereas the urban areas were strongly associated with the
Dipteran species such as O. simplicoides Lopes (1933), O. thornax (Walker, 1849),
Sarcodexia lambens (Wiedmann, 1830), Biopyrellia bipuncta (Wiedemann, 1830),
Brontaea delecta (Wulp, 1896), Hydrotaea nicholsoni (Curran, 1939), Ophyra
aenescens (Wiedemann, 1830), and L. cuprina. Contrarily, the investigation of the
death of 26 men by Pujol-Luz et al. (2006) reported the presence of only one fly
species, P. fulvinota in the Brazilian Amazon rainforest. In the United States, Jeong
et al. (2022) conducted a survey of Tennessee’s abundant insect species and found
Phormia regina (Meigen) and Lucilia coeruleiviridis (Macquart) to be the major
insect species in the region.
Fremdt and Amendt (2014) highlighted the potential use of Sarcophaga
subvicina Baranov and Sarcophaga variegata (Scopoli) as an indicator of summer
urban habitation and S. albiceps as an indicator of rural habitation in the Frankfurt
region of Germany. In addition, the authors also noted a strong association between
Sarcophaga caerulescens and rural habitats and between Sarcophaga similis and
urban habitats. Moore et al. (2022) stated that from the empty pupae of insects, the
cuticular hydrocarbons (CHCs), being species-specific, can be used to identify and
distinguish the geographical origin of C. vicinia from Germany, Spain, Norway, and
England. They also emphasized the possibility of distinguishing L. sericata within
Germany, which is isolated by a geographical range of 70 km, through the chemical
analysis of cuticular hydrocarbons. Furthermore, Byrne et al. (1995) admitted that
cuticular hydrocarbons can be used to distinguish species of Phormia regina from
three geographic populations from Tucannon River and Lyle Grove, Washington,
and Rensselaer, Indiana. An analysis of actual cases in insect records from 1993 to
2007 by Hodecek and Jakubec (2022) reported that Calliphora vicina was the
dominant species throughout the Swiss season. In another study conducted in
Switzerland by Cherix et al. (2012), the researchers found that S. caerulescens,
S. similis, and S. africa were the dominant species in indoor death scenes, while
S. argyrostoma dominated outdoor death scenes. In the middle east, in Central Iran,
Calliphora vicina, Lucilia sericata, Musca domestica, Wohlfahrtia nuba, and
Chrysomya albiceps were observed to be the dominant insect species (Mozaffari
et al. 2020).
Several studies of these necrophagous insects have also been carried out in Asia,
particularly in China. Shen et al. (2021) noted that Protophormia terraenovae
(Robineau-Desvoidy, 1830) is the dominant year-round necrophagous insect species
in the Lhasa (Qinghai-Tibetan Plateau) region of China. In another study conducted
by Zou et al. (2022) in Shenyang, China, the researchers observed that in summer
and autumn, the species of Phoridae and Platystomatidae were dominant at a burial
434 K. Guite et al.

depth of 30 and 60 cm. Moreover, the authors also reported that Platystoma
mandschuricum (Enderlein, 1937) and Aleochara puberula (Klug, 1833) were the
first insects to colonize the carcass in the spring season and the insect species to
colonize the carcass for the longest time, extending their infestation till the winter
months. A study conducted by Song et al. (2022) on Hainan Island, China, found
that the dominant insect species was Chrysomya megacephala (Fabricius, 1794),
followed in descending order by Chrysomya rufifacies (Macquart, 1843),
Hemipyrellia ligurriens (Wiedemann, 1830), Boettcherisca peregrine (Robineau-
Desvoidy, 1830), Parasarcophaga dux (Thomson, 1868), Parasarcophaga misera
(Walker, 1849), Synthesiomyia nudiseta (Wulp, 1883), and Ophyra chalcogaster
(Wiedemann, 1924). Due to the ongoing global warming and climate change, these
insect species are likely to diversify their habitats and geographical distributions in
the coming years. Because insects are resistant and highly adaptive, their unique
ability to acclimatize to change can have implications for their service in forensic
investigations, particularly in the identification of the relocation of bodies and the
accompanying elements.

29.3.9 Insects as Indicators for Identifying Translocation of Dead

Body, Determining the Presence of Wounds, and Tracing
the Origin of Drugs

In recent decades, there has been a substantial increase in crime and insects provide
valuable assistance in the investigation of such cases. Generally, crime scenes have
blood stains, and in some instances, the victim’s body has excretory materials due to
the relaxation of the sphincter muscles during brutal death (Anderson 2014). The
odor emanating from the blood and excreta attracted insects to the area. If the body is
then transported elsewhere for disposal, the odor will further attract insect
communities from the area to infest the corpse. This is the fundamental logic
underlying the use of insects in determining whether a corpse was transported or
disturbed after disposal, but the bulwark of forensic entomology is based on a
practical approach. Therefore, this section is devoted to case studies involving insect
evidence in the investigation of criminal activities set earlier in this chapter.
Nuorteva et al. (1967) and Smith (1986) presented a case where insects help link
the possible area of death before the body has been moved to a different place. The
body of a deceased woman was found on the floor near a closed window in her flat in
Helsinki on the sixth of September 1964. The death occurred due to heart failure,
1 month prior to the discovery. Larvae collected from the skin surface during the
autopsy on eight September 1964 were reared to adulthood. Upon maturity, the
insect species were identified as Calliphora vicina (Robineau-Desvoidy) and Lucilia
sericata (Meigen). However, the presence of the Lucilia sericata species suggested
that the cadaver was transported to cities in southern Finland or an islet in the small
archipelago of Finland, as the range of Lucilia sericata is restricted to these regions
of Finland only. Through the analysis of insect evidence, it was concluded that the
29 Forensic Entomology 435

woman did not die in the house, but somewhere in other areas of Finland where the
insect Lucilia sericata is abundant.
Another case was reported by Smith (1986) related to insects in the translocation
and disturbance of a discarded body. The headless body of a woman was discovered
among gorse and bracken in Devon, England, in September 1983. The significant
absence of Calliphora larvae and puparia suggested that the body has been preserved
in a warm, dry place, probably indoors, given the abundance of larvae and pupae of
Ophyra species. When the head was recovered, it has a huge number of Calliphora
species, but only one Ophyra species. Further interrogation of the suspect revealed
that the woman was shot dead and kept in a sauna for 5 months. The body was then
disposed of in the woods (where it was found) with the head removed at the scene
and stored in a plastic bag in the boot of a car.
Gail and Gaudet (1999) and Cruz (2006) described a case where insects helped
determine the occurrence of body translocation. The decomposing body of a woman
was discovered in a dumping site in Maryland, the USA, in July 1984. The body was
exposed to open daylight. Upon examination, the investigators observed that there
were no species of Lucilia sericata, a green bottle fly that prefers lighted areas.
However, the body was colonized by Phormia regina, a species of black blowfly that
prefers shaded areas. From this insect evidence, the investigators concluded that the
body was moved from a shaded area to a well-lighted area where it was finally
discarded.
An interesting case presented by Anderson (2014) involved the remains of a man
found in a shallow grave in the Lower Mainland area of British Columbia. The well-
skeletonized body indicated that the body had been colonized by blowflies for an
extended period of time. However, there was no evidence of puparial remains in the
upper half of the body. A search for insect evidence on the second day of investiga-
tion uncovered multiple pupal cases associated with the lower half of the body. This
suggested that the upper half of the body had decomposed at the same site as the
lower half but had later been moved to a secondary location after skeletonization,
probably because part of it had been exposed. The evidence indicated that the body
was disturbed by reburying the upper half of the body several weeks after the
original burial.
Another incident involving the translocation of a body as a cover-up for a crime
was reported by Erzinclioglu (2003). Dr. Anthony Samson Perera was a specialist
lecturer in Oral Biology at the University of Leeds, School of Dentistry, UK. He
murdered and dismembered his 13-year-old adopted daughter Nilanthi from Sri
Lanka. He buried part of her remains at his residence in Wakefield, West Yorkshire,
England. Dr. Perera also preserved some of Nilanthi’s bones in enamelware, stain-
less steel, and a coffee jar in the laboratory where he worked. A criminal investiga-
tion was initiated following a complaint made by Perera’s neighbors and his
co-worker, Frank Ayton. Forensic investigation revealed the presence of human
vertebrae and rotting flesh in three indoor plant pots at his home. Human bones were
also recovered under the living room floor. A search of the garden further revealed a
recently disturbed burial spot behind the garage containing human remains. In
addition, a microscopic examination of the mites in the decaying flesh unearthed
436 K. Guite et al.

from the garden and from beneath the living room floor revealed that parts of the
body from the garden were later moved under the living room floor. Furthermore, the
presence of larvae (endemic to human settlements) on bodies recovered from the
garden, beneath the living room floor, and laboratory, indicated that the body parts
were derived from the same individual. Moreover, the presence of larvae of spring-
breeding fly species corresponds to the time around the disappearance of Nilanthi.
The insect evidence helped convict Dr. Anthony Samson Perera, who was sentenced
to life imprisonment on charges of manslaughter.
Not only can insects tell a “real story,” but they also provide valuable information
about drug trafficking. Illegal drugs are often manufactured in one country and sold
in another, so knowing where the drug was made can be important. The case
presented by Cruz (2006) demonstrated the utility of insects in identifying drug
trafficking. Marijuana grown in the higher elevations of Colombia was trafficked to
America. At the time of their entry into the United States, the drugs were seized by
the Border Patrol agents. Further analysis of the marijuana bricks revealed that a
unique spider found only in the mountainous highlands of Colombia was present in a
pound of marijuana brick. This allows the investigator to track the source of the drug.
Another case from New Zealand reported by du Plessis and der Walt (2004)
presented an example of how forensic entomology can be applied to an illicit drug
investigation. Sixty insect specimens were found in two separate cannabis seizures.
Of these, only one insect species was known to exist in New Zealand, while the other
eight insect species were typical of Asia. By investigating the nature and extent of
the overlap, investigators were able to determine that the cargo originated from the
“Tenasserim region between the Andaman Sea in the west and Thailand in the east.”
It can even be assumed that cannabis was harvested near streams and lakes with
nearby fig trees and termite nests. As a result of this evidence, one of the suspects
admitted to trafficking the drugs.
Insects can also provide clues about the presence of wounds on corpses. One
instance has been reported by Anderson (2014). A few days after going out for a
walk, the body of a young woman was found. Her body had many maggots on her
chest and palms. Regrettably, no forensic entomologist was summoned to investi-
gate the incident and the victim was buried and listed as an uncertain death. When
Dr. Bill Rodriguez, a Forensic Anthropologist was shown the photographs, he
noticed that maggot activity was predominantly on the chest and palms rather than
the face, suggesting the presence of scars in those areas. Moreover, the presence of
maggots on the palms, an area where insects rarely colonize due to the hard skin,
indicated the presence of defensive wounds. Based on this evidence, a court-ordered
exhumation was carried out and the remains were reconsidered. Re-examination of
the corpse revealed numerous stab wounds to the chest and severe lacerations on the
hands that nearly severed one thumb. The case was subsequently revived as murder.
In another case described by Anderson (2014), insects help connect the perpetra-
tor of the crime to the time it was committed. In a Chicago suburb case, a woman was
raped by a man wearing a ski mask. The rape occurred in early to mid-summer. A
suspect was identified, and a search of his house revealed the presence of a ski mask.
The suspect admitted to possessing the mask, but he swore he had not worn it since
29 Forensic Entomology 437

last winter, months before the rape. However, investigators noticed several plant
parts on the mask, including Cockleburs. When a forensic entomologist opened the
Cockleburs, it was found to contain a live caterpillar. From the analysis of the life
cycle of the caterpillar, the mask was found to be outdoors by the beginning of the
summer of the same year. When presented with the evidence, the suspect confessed
to committing the crime.

29.3.10 Entomotoxicology

Entomotoxicology is the qualitative and quantitative determination of toxic

substances consumed through accidental, suicidal, or homicidal acts (Malejko
et al. 2020). It also deals with the investigation of explosive compounds from larvae
feeding on corpses (Cruz 2006), and the effects of toxins on the growth and
development of insects (Gagliano-Candela and Aventaggiato 2001).
Entomotoxicology involves finding the cause of death through the analysis of insects
and larvae for the presence of drugs, poisons, pesticides, insecticides, and metals
such as Mercury, Cadmium, and Thallium. (Gosselin et al. 2011). Insects are found
in abundance and their puparial cases remain for a long time for analysis even when
other sources such as tissues are no longer available (Gagliano-Candela and
Aventaggiato 2001; Bourel et al. 2001). Besides, drugs tend to remain more stable
in insects than in decaying human tissues (Kintz et al. 1990). The presence of drugs
such as cocaine (Goff et al. 1989), heroin (Goff et al. 1991), methamphetamine (Goff
and Lord 2009), amitriptyline (Goff et al. 1993), and 3,4
methylenedioxymethamphetamine (MDMA) (Goff et al. 1997) and morphine
(Hédoui et al. 1999) in the food source is known to increase the larval size and
either increase or decrease pupation time and larval mortality. The first report of the
accumulation of metals such as copper, zinc, iron, and calcium in the tissues of house
flies was made by Sohal and Lamb in the 1970s (Sohal and Lamb 1977, 1979). Later,
in 1980, J.C. Beyer and colleagues (Beyer et al. 1980) detected the presence of drugs
in fly larvae, and this subsequently became the foundation of entomotoxicology.
Blowfly, flesh fly, and beetle are the insects that are mainly used for toxicological
analysis. The larvae, puparial cases, adult insects, exuviae, beetle fecal material
(frass), fly predators, and scavengers are collected for toxicological analysis
(Gagliano-Candela and Aventaggiato 2001). The method of extraction and prepara-
tion of insect samples is similar to the method used for human tissue (Kintz et al.
1990). Though there are various methods of extraction techniques, solid-phase
extraction is known to give the best-purified organic toxicant from aqueous entomo-
logical extract (Gagliano-Candela and Aventaggiato 2001). The analysis and identi-
fication of the toxicological substance are done with the help of instruments such as
high-performance liquid chromatography (HPLC), gas chromatography–mass spec-
trometry (GCMS), and liquid chromatography–mass spectrometry (LCMS), radio-
immunoassay (RIA), and enzyme-linked immunosorbent assay (ELISA) (Moody
2006; Chophi et al. 2019).
438 K. Guite et al.

29.3.11 Collection and Preservation of Insect Specimens

Proper collection and correct preservation of entomological artifacts are critical for
insect species identification and PMImin estimation. The investigators should be
familiar with forensically relevant arthropods and insects. Moreover, it is necessary
that precautions be taken at all steps of sample collection and handling. Essential
items for collecting and storing insect specimens include forceps, teaspoons, vials or
vented storage tubes, ethanol, a small sieve, a handheld insect capture net, protective
clothing (disposable suits, gloves, shoe covers, face masks), tapes, notebook, pens,
pencils, and digital camera (Hall et al. 2012). Lord and Rodriguez (1989) specified
the process for the collection and preservation of insect specimens. They are
discussed as follows.

29.3.11.1 Procedure
1. A sufficient number of representative insect species should be collected,
consisting of larvae, pupae, and adults. It is important to catch the adults first
before they flee the scene. A hand net should be used when capturing flying
adults.
Captured adults may be retained for analysis. When transferring adults directly
for analysis, a stock solution of 70% ethanol or isopropyl alcohol and water in a
1:1 ratio should be used. This is necessary because isopropyl alcohol
concentrations above 70% make the specimen brittle. If the specimen is stored
in formalin, it must be transferred to 70% isopropyl alcohol as soon as possible.
2. Always wear gloves. Maggots on and inside the carcass can be collected with a
spoon, forceps, or fingers. If the specimen is small (less than 5 mm), it can be
collected with a small artist’s paintbrush dipped in a preservation solution.
Immature beetles do not need to be reared for identification and can be added
directly to the preserving liquid.
3. Maggots under the carcass can be collected by scooping the top layer of soil with
a spoon and storing it in a refrigerated plastic bag. Essentially, the purpose of
using a refrigerated plastic bag is to slow larval growth and development.
4. In situations of advanced decomposition, it is important to collect soil at a
suitable depth below where the corpse is placed. It is also important to collect
a large amount of soil samples around the body. The soil should be stored in a
plastic bag and refrigerated for further analysis.
5. In the case of bones, the cavities in the bone should be carefully examined. The
skull can be examined with forceps and a light source after being placed on a
white sheet or large piece of white paper. You can use water to wash the skull
with a collection strainer or gauze underneath to capture maggots and insects.
6. Collected representative maggots should be divided into two groups—one
group for immediate preservation and the other group grown to adulthood for
species identification.
7. Place the to-be-preserved group in boiling water (approximately 76 or 170 °F)
for 2–3 min. Then transfer to storage solution (70% ethanol).
29 Forensic Entomology 439

8. The to-be-grown for identification group should be kept in a carton box, quarter
to half filled with vermiculite or moist soil. This group should not be kept in
sealed plastic bags or vials for more than 12 h.
9. Use the fastest mode of transportation to reach the rearing facility. Ordinary
postal services are not recommended for this purpose but can be used in the
absence of rapid transit.
10. At the rearing facilities, maggots can be successfully grown using animal liver
and muscles taken from the carcass. Forceps must be used to transfer the
maggots to the feed. Maggots are best kept in an environment that mimics the
environment in which they were collected.
11. Beakers or small glass bowls with a diameter of 8–10 cm are suitable for rearing
maggots. Each growing container should contain about 15–25 maggots.
12. Containers for preserved and grown specimens should be labeled in the order
with the date of collection, time of collection, location of remains (along with a
complete set of photographs of the crime scene), area of the body infested,
name, address, and collector’s phone number.
13. Maggots’ activity is to be closely monitored and records kept of its size and
instar stage. The feed can be provided as needed. Mature maggots move
downward into the food material and pupate.
14. Adult flies emerge from the puparial case. Depending on the ambient tempera-
ture, this process may take weeks or months. It is important to place standard
insect-rearing cases around the growing container to prevent adult insects from
escaping.
15. Give the newly emerged flies a small amount of Gatorade soaked in cotton wool
for 24 h. This will harden the outer skin and will allow for accurate identification
of the insect species.
16. Later, these new adults can be kept in 70% ethanol or pinned to an insect box for
storage.

29.4 Limitations of Forensic Entomology

Although the applications of entomology to forensics are massive, the discipline,

like any other branch of science, is not without flaws. Volckaert (2020) and Catts and
Goff (1992) pointed out the drawbacks of forensic entomology. Some of the
highlights were stated as follows:

1. The whole process of specimen collection is an exhausting process.

2. Insect species may die before proper analysis. Also, the state of the corpse might
make it impossible to gather live insects.
3. Lack of proper facilities for safe collection and proper transport can hinder the
efficient collection of specimens.
4. Sometimes, there can be a potential absence of live insects if the remains are
relatively ancient.
440 K. Guite et al.

5. Maggots rearing is a time-consuming process and requires a certain temperature

and humidity for their proper growth and development.
6. The estimated PMImin is a mere representation of arthropod activity and may not
necessarily correspond to the total postmortem interval.
7. The commonly used successional wave pattern of colonization to estimate
PMImin is not viable in cold climates and in situations where the body is frozen.
8. Improper handling or careless collection of specimens can damage or kill
specimens.
9. The method of victim disposal has a large impact on insect colonization or lack
thereof. For example, frozen bodies must be exposed to an open environment for
some time to attract insects.
10. The colonization of a dead body by insects is considerably determined by the
depth of burial and the physical environment of the corpse.
11. The estimation of accurate PMImin does not depend only on the successful
identification of the insect species. Many factors such as temperature, humidity,
soil pH, presence of clothing, and wrappings play an equally important role in
the determination of the PMImin.
12. Since the distribution and activity of insects are geographically and seasonally
determined, there can be lots of complications in calculating the PMImin.

29.5 Acarology

Mites and ticks are not insects. They belong to the order Acari or class Acarina and
are distinguished by the presence of chelicerae in the mouthpart and pedipalp (Singh
and Sachan 2007). They are found in fresh and salt water, in our homes, and even in
our bodies (Perotti et al. 2009). They are particularly useful when factors such as
temperature and physical barriers retard the decomposition of the body by delaying
insect invasion of the corpse. The fact that mites and ticks are present in humans and
animals and their obligatory dependence on them made their utility in forensic
investigation advantageous. Forensic acarology is part of forensic entomology that
deals with the legal investigation of mites found on the dead in violent criminal cases
(Rasmy 2007). Like insects, mites and ticks can proliferate and colonize the body. In
1894, Megnin witnessed the presence of mites on the dead body in the first wave of
succession and their climax invasion in the sixth wave (Smith 1986; Perotti et al.
2009).
Some mites are phoretic, meaning that they depend on other species for their
migration (Perotti and Braig 2009). They are believed to outnumber other arthropod
and insect species that scavenge a dead body. Mites can arrive at the carcasses by
walking, air currents, material transfer, and specific carrier host (Perotti et al. 2009).
Each phoretic mite species utilizes a specific insect host for migration to arrive at its
feeding destination, i.e., the corpse (Tüzün et al. 2015). For instance, blowflies are
the specific host for the phoretic mites Prostigmata, Astigmata, and Mesostigmata.
Mites can reproduce much faster than their carrier insects (Perotti et al. 2009). They
are usually known to be transmitted in their transitional stage of development. Once
29 Forensic Entomology 441

they arrive at their destination, they leave the carrier insect and attain maturation
shortly after. These mites feed on the eggs and larvae of the infesting insects on the
corpse (Perotti and Braig 2009; Tüzün et al. 2015). During the early stages of
decomposition, Macrochelid (mites that form a phoretic association with beetles
and muscids) are sighted in abundance. Because of their specific affinity to arthropod
and insect species for dispersion, they can provide information as to which insect has
arrived even when the insects are not available. This can essentially contribute to
finding the environmental condition of the crime scene and estimating the PMImin.
Mites are also used as an indicator of human habitat, workplace conditions, and
association with animals. Some mites from the order Metastigmata are non-phoretic
(Tüzün et al. 2015). Also known as Ticks, they infest living vertebrates by sucking
blood. The presence of these non-phoretic mites on a corpse can be an indication that
the living individual was infected with this mite when alive. DNA analysis of these
feeding mites can be used to determine the identity of the decedent. Mites that
commonly infest humans include the family Demodicidae, which are present in the
hair follicles, and the family Sarcoptidae, which are present in the skin and our
clothes. They can survive for about 2 weeks after the death of their host (Tüzün et al.
2015). This can be useful when estimating the PMImin and can provide other
valuable information even if insect activity is impeded by physical barriers around
the corpse.

29.6 Recent Advancements in Forensic Entomology

29.6.1 Wildlife Forensic Entomology

Wildlife exploitation in terms of poaching has become a global concern because of

the extensive damage incurred by it (Obour et al. 2016). To combat the illegal
poaching and trading of wildlife across international borders, the Convention on
International Trade in Endangered Species of Wild Fauna and Flora (CITES) is
established in 1973. Wildlife forensic entomology is the legal use of insects to
investigate and solve illegal wildlife poaching. Wild animals are poached for their
valuable body parts. For example, elephants are killed for their tusks, rhinoceros for
their horns, pangolins for their scales, tigers for their skins, claws, and teeth
(UNODC, World Wildlife Crime Report 2020), and bears for their gall bladders
(Hall and Huntington 2009). These animal products are traded within countries and
across international borders illegally. A proper understanding of the arthropods and
insect species distribution in a geographical location can help relate investigators to
the area where the poaching occurred. For instance, the species of blue bottle fly
Calliphora alaskensis is found in the cold northern regions of Canada, Alaska,
Colorado, and Wyoming, while the species of green bottle fly Lucilia Mexicana is
found in the warm areas in the southern regions of Texas through Brazil (Brundage
and Byrd 2016). The presence of these fly species on animals outside their geo-
graphic range indicates that the animal is not endemic to the region of recovery.
442 K. Guite et al.

29.6.2 DART-HRMS Technology

Direct analysis in real-time high-resolution mass spectrometry (DART-HRMS)

technique involves thermal desorption, penning ionization, and transferring of
charge from metastable helium into the mass spectrometer by helium-heated gas
(Doué et al. 2015). The technique is non-destructive and does not require sample
preparation. Furthermore, the technique enables the instant differentiation of various
insect species including Calliphoridae, particularly Calliphora vicina, Lucilia
sericata, L. coeruleiviridis, and Phormia regina species as well as the Phoridae
and Sarcophagidae families from the amino acid profile of the insect eggs (Giffen
et al. 2017).

29.6.3 Molecular Identification of Insect Species

Molecular methods are used to determine insect species when morphological deter-
mination is not possible due to damage to the specimen. Molecular identification of
insect species can be done from the larvae and does not require the rearing of the
larvae to adulthood (Chen et al. 2004). The technique involves the sequencing of the
mitochondrial DNA, particularly the mitochondrial cytochrome C oxidase subunit I
(COI), cytochrome oxidase II (COII), and t-RNA leucine of the larvae (Wells and
Stevens 2008; Cainé et al. 2009; Kavitha et al. 2012, 2013; Park et al. 2018b).
Besides, the molecular technique also utilizes single-nucleotide polymorphisms
(SNPs) (Jang et al. 2019) and nuclear DNA markers such as the internal transcribed
spacer 2 (ITS2) (Park et al. 2018a) for species identification.

29.6.4 Human DNA Identification from Larval Gut Contents

Larvae feeding on decomposing human tissue store their feed in the gut. By
analyzing their gut contents with molecular techniques, the mitochondrial DNA
(mtDNA) of humans can be extracted from the hypervariable segment 2 (HV2) of
mtDNA of the larvae (Wells et al. 2001). This can help in the identification of the
decedent when the morphological features are badly decomposed and physical
identification is not possible.

29.6.5 Virtual Forensic Entomology

The method involves the incorporation of micro-CT to visualize and comprehend the
internal anatomical changes inside the puparial case of the developing pharate adult
(Richards et al. 2012). The technique requires staining the pupae with iodine prior to
observation under low contrast resolution. This novel approach has the advantage in
that it is relatively fast, non-destructive, and can process multiple specimens at a
29 Forensic Entomology 443

time. The method can also be used for estimating PMImin when the insect evidence
involves pupae.

Multiple Choice Questions

1. Forensic entomology is the study of?

(a) Arthropods
(b) Pollen grains
(c) Diatoms
(d) Decomposition
Answer: A
2. Which of the following insect families is the first to reach a cadaver?
(a) Beetles
(b) Mites
(c) Aphids
(d) Flies
Answer: D
3. Where are clumps of eggs of flies most commonly observed in a dead body?
(a) In the hair
(b) Near natural orifices
(c) Underarms
(d) Sole of the feet
Answer: B
4. Presence of large number of larvae over the chest of a cadaver indicates ________
(a) Signs of lack of hygiene
(b) Presence of open wounds
(c) Heart disease
(d) Asphyxial death
Answer: B
5. Study of mites and ticks is called?
(a) Entomology
(b) Palynology
(c) Limnology
(d) Acarology
Answer: D

References
Amendt J, Campobasso CP, Gaudry E et al (2007) Best practice in forensic entomology- standards
and guidelines. Int J Legal Med 121:90–10. https://doi.org/10.1007/s00414-006-0086-x
Amendt J, Zehner R, Johnson DG, Wells J (2009) Future trends in forensic entomology. In: Amendt
J et al (eds) Current concepts in forensic entomology. Springer, New York, NY, pp 353–368
Ames C, Turner B (2003) Low temperature episodes in development of blowflies: implications for
postmortem interval estimation. Med Vet Entomol 17:178–186. https://doi.org/10.1046/j.
1365-2915.2003.00421.x
444 K. Guite et al.

Anderson GS (2014) Forensic entomology. In: James SH, Nordby JJ, Bell S (eds) Forensic science:
an introduction to scientific and investigative techniques, 4th edn. CRC Press/Taylor & Francis
Group, Boca Raton, FL
Anderson GS (n.d.) Forensic entomology: the use of insects in death investigations. https://www.
sfu.ca/~ganderso/forensicentomology.htm#_ftnref1. Accessed 28 Sept 2022
Anderson GS, Cervenka VJ (2002) Insects associated with the body: their use and analyses. In:
Haglund WD, Sorg MH (eds) Advances in forensic taphonomy: method, theory and archaeo-
logical perspectives. CRC Press, Boca Raton, FL
Anderson GS, Hobischak NR (2004) Decomposition of carrion in the marine environment in British
Columbia, Canada. Int J Legal Med 118:206–209. https://doi.org/10.1007/s00414-004-0447-2
Archer MS (2004) Rainfall and temperature effects on the decomposition rate of exposed neonatal
remains. Sci Justice 44(1):35–41. https://doi.org/10.1016/s1355-0306(04)71683-4
Azwandi A, Keterina N, Owen H (2013) Adult carrion arthropod community in a tropical rainforest
of Malaysia: analysis on three common forensic entomology animal models. Trop Biomed 30:
481
Bajerlein D, Taberski D, Matuszewski S (2018) Estimation of postmortem interval (PMI) based on
empty puparia of Phormia regina (Meigen) (Diptera: Calliphoridae) and third larval stage of
Necrodes littoralis (L.) (Coleoptera: Silphidae) – advantages of using different PMI indicators. J
Forensic Legal Med 55:95–98. https://doi.org/10.1016/j.jflm.2018.02.008
Barenbaum MR (1985) Ninety-nine more maggots, mites, and munchers. University of Illinois
Press, Urbana, IL; Chicago, IL, pp 10–46
Benbow ME, Lewis AJ, Tomberlin JK, Pechal JL (2013) Seasonal necrophagous insect community
assembly during vertebrate carrion decomposition. J Med Entomol 50:440–450. https://doi.org/
10.1603/ME12194
Benecke M (2007) A brief survey of the history of forensic entomology/Ein kurzer Streifzug durch
die Geschichte der forensischen Entomologie. Acta Biologica Benrodis 14:15
Bernhardt V, Hannig L, Kinast R et al (2017) Quantitative pteridine fluorescence analysis: a
possible age-grading technique for the adult stages of the blow fly Calliphora vicina (Diptera:
Calliphoridae). J Insect Physiol 98:356–359. https://doi.org/10.1016/j.jinsphys.2017.03.002
Beyer JC, Enos WF, Stajić M (1980) Drug identification through analysis of maggots. J Forensic
Sci 25(2):411
Bourel B, Tournel G, Hedouin V et al (2001) Morphine extraction in necrophagous insects remains
for determining ante-mortem opiate intoxication. Forensic Sci Int 120:127–131. https://doi.org/
10.1016/s0379-0738(01)00428-5
Brundage A, Byrd JH (2016) Forensic entomology in animal cruelty cases. Vet Pathol 53(5):
898–909. https://doi.org/10.1177/0300985816651683
Byrne AL, Camann MA, Cyr TL et al (1995) Forensic implications of biochemical differences
among geographic populations of the black blow fly, Phormia Regina (Meigen). J Forensic Sci
40:372. https://doi.org/10.1520/jfs13789j
Cainé LM, Corte Real F, Saloña-Bordas MI et al (2009) DNA typing of Diptera collected from
human corpses in Portugal. Forensic Sci Int 184:e21. https://doi.org/10.1016/j.forsciint.2008.
10.016
Catts EP, Goff ML (1992) Forensic entomology in criminal investigations further annual reviews.
Annu Rev Entomol 37:253–272
Charabidze D, Gosselin M, Hedouin V (2017) Use of necrophagous insects as evidence of cadaver
relocation: myth or reality? PeerJ 5:e3506. https://doi.org/10.7717/peerj.3506
Chen WY, Hung TH, Shiao SF (2004) Molecular identification of forensically important blow fly
species (Diptera: Calliphoridae) in Taiwan. J Med Entomol 41:47–57
Chen W, Yang L, Ren L et al (2019) Impact of constant versus fluctuating temperatures on the
development and life history parameters of Aldrichina grahami (Diptera: Calliphoridae). Insects
10:184. https://doi.org/10.3390/insects10070184
29 Forensic Entomology 445

Cherix D, Wyss C, Pape T (2012) Occurrences of flesh flies (Diptera: Sarcophagidae) on human
cadavers in Switzerland, and their importance as forensic indicators. Forensic Sci Int 220:158–
163. https://doi.org/10.1016/j.forsciint.2012.02.016
Chophi R, Sharma S, Sharma S, Singh R (2019) Forensic entomotoxicology: current concepts,
trends and challenges. J Forensic Legal Med 67:28–36
Cruz AM (2006) Crime scene intelligence: an experiment in forensic entomology. The National
Defense Intelligence College Press, Washington, DC
Defilippo F, Calzolari M, Bonilauri P (2017) Stored-product forensic entomology: study of
development of Plodia Interpunctella (Lepidoptera: Pyralidae) and use of data in determining
time intervals of food infestation. Poster presented at the 14th Meeting European Association for
Forensic Entomology, Treviso, Italy, 7–10 June 2017
Dellinger TA, Day E (2015) Blow flies Diptera: Calliphoridae. Virginia Cooperative Extension
Virginia Tech. Virginia State University. https://www.pubs.ext.vt.edu/content/dam/pubs_ext_
vt_edu/ENTO/ENTO-134/ENTO-134-PDF.pdf. Accessed 3 Oct 2022
Dimitrov RE, Amendt J, Rothweiler F, Zehner R (2020) Age determination of the adult blow fly
Lucilia sericata (Diptera: Calliphoridae) through quantitative pteridine fluorescence analysis.
Foren Sci Med Pathol 16:641–648. https://doi.org/10.1007/s12024-020-00295-4
Doué M, Dervilly-Pinel G, Pouponneau K et al (2015) Direct analysis in real time - high resolution
mass spectrometry (DART-HRMS): a high throughput strategy for identification and quantifi-
cation of anabolic steroid esters. Drug Test Anal 7:603–608. https://doi.org/10.1002/dta.1727
Early M, Goff ML (1986) Arthropod succession patterns in exposed carrion on the island of O’ahu,
Hawaiian Islands, USA. J Med Entomol 23(5):520–531
Elden Elfeky AK, Moharm IM, El Aswad BEDW (2017) Role of house fly in determination of post-
mortem interval: an experimental study in albino rats. Ain-Shams J Forensic Med Clin Toxicol
28:133–143
El-Kady EM (1999) Problems facing application of forensic entomology. Pak J Biol Sci 2:280
Erzinclioglu Z (2003) Maggots, murder, and men: memories and reflections of a forensic entomol-
ogist. St. Martin’s Griffin, New York, NY
Fauvergue X, Lo Genco A, Lo Pinto M (2008) Virgins in the wild: mating status affects the
behavior of a parasitoid foraging in the field. Oecologia 156:913–920. https://doi.org/10.1007/
s00442-008-1037-7
Fremdt H, Amendt J (2014) Species composition of forensically important blow flies (Diptera:
Calliphoridae) and Flesh Flies (Diptera: Sarcophagidae) through space and time. Forensic Sci
Int 236:1–9. https://doi.org/10.1016/j.forsciint.2013.12.010
Gagliano-Candela R, Aventaggiato L (2001) The detection of toxic substances in entomological
specimens. Int J Legal Med 114:197–203
Gail A, Gaudet J (1999) A practical exercise in forensic entomology. RCMP Gazette 53:10–14
Gennard D (2012) Forensic entomology: an introduction, 2nd edn. Wiley-Blackwell, London
Giffen JE, Rosati JY, Longo CM, Musah RA (2017) Species identification of necrophagous insect
eggs based on amino acid profile differences revealed by direct analysis in real time-high
resolution mass spectrometry. Anal Chem 89:7719–7726. https://doi.org/10.1021/acs.
analchem.7b01708
Goff ML (1989) Gamasid mites as potential indicators of postmortem interval. In:
Channabasavanna GP, Viraktamath CA (eds) Progress in acarology, vol 1. Brill, Leiden, pp
443–450
Goff ML, Lord WD (2009) Insects as toxicological indicators and the impact of drugs and toxins on
insect development. In: Byrd JH, Castner JL (eds) Forensic entomology: the utility of arthropods
in legal investigations, 2nd edn. CRC Press, Boca Raton, FL
Goff ML, Omori AI, Goodbrod JR (1989) Effect of cocaine in tissues on the development rate of
Boettcherisca Peregrina (Diptera: Sarcophagidae). J Med Entomol 26:91–93. https://doi.org/
10.1093/jmedent/26.2.91
Goff ML, Brown WA, Hewadikaram KA, Omori AI (1991) Effect of heroin in decomposing tissues
on the development rate of Boettcherisca Peregrina (Diptera, Sarcophagidae) and implications
446 K. Guite et al.

of this effect on estimation of postmortem intervals using arthropod development patterns. J

Forensic Sci 36:537–542
Goff ML, Brown WA, Omori AI, LaPointe DA (1993) Preliminary observations of the effects of
amitriptyline in decomposing tissues on the development of Parasarcophaga ruficornis
(Diptera: Sarcophagidae) and implications of this effect to estimation of postmortem interval.
J Forensic Sci 38:316–322
Goff ML, Miller ML, Paulson JD et al (1997) Effects of 3,4-methylenedioxymethamphetamine in
decomposing tissues on the development of Parasarcophaga ruficornis (Diptera: Sarcophagidae)
and detection of the drug in postmortem blood, liver tissue, larvae, and puparia. J Forensic Sci
42:276–280
Gondhalekar AD (2019) 2018 Highlights of urban entomology. J Med Entomol 56:1188–1193
Gordon JR (2020) Urban entomology highlights from 2019 help create integrated pest management
plans. J Med Entomol 57(5):1342–1348. https://doi.org/10.1093/jme/tjaa121
Gosselin M, Wille SMR, Fernandez MMR et al (2011) Entomotoxicology, experimental set-up and
interpretation for forensic toxicologists. Forensic Sci Int 208:1–9
Gunatilake K, Lee Goff L (1989) Detection of organophosphate poisoning in a putrefying body by
analyzing arthropod larvae. J Forensic Sci 34:714. https://doi.org/10.1520/jfs12698j
Hagstrum DW, Subramanyam B (2009) A review of stored-product entomology information
sources. Am Entomol 55(3):174–183
Hall RD (1990) Medicocriminal entomology. In: Catts EP, Haskell NH (eds) Entomology and
death: a procedural guide. Joyce’s Print Shop, Inc, Clemson, SC
Hall RD, Huntington TE (2009) Introduction: perceptions and status of forensic entomology. In:
Byrd JH, Castner JL (eds) Forensic entomology: the utility of arthropods in legal investigations,
2nd edn. CRC Press, Boca Raton, FL
Hall M, Whitaker A, Richards C (2012) 8 Forensic entomology. In: Grant NM, Roberts J (eds)
Forensic ecology handbook: from crime scene to court, 1st edn. Wiley, pp 111–140
Hédoui V, Bourel B, Martin-Bouyer L et al (1999) Morphine perfused rabbits: a tool for
experiments in forensic entomotoxicology. J Forensic Sci 44(2):347–350
Hodecek J, Jakubec P (2022) Spatio-temporal distribution and habitat preference of necrophagous
Calliphoridae based on 160 real cases from Switzerland. Int J Legal Med 136:923–934. https://
doi.org/10.1007/s00414-021-02769-8
Hofer IMJ, Hart AJ, Martín-Vega D, Hall MJR (2017) Optimising crime scene temperature
collection for forensic entomology casework. Forensic Sci Int 270:129–138. https://doi.org/
10.1016/j.forsciint.2016.11.019
Hofer IMJ, Hart AJ, Martín-Vega D, Hall MJR (2020) Estimating crime scene temperatures from
nearby meteorological station data. Forensic Sci Int 306:110028. https://doi.org/10.1016/j.
forsciint.2019.110028
Holdaway FG (1933) Differential behaviour of Lucilia sericata Meig. and Lucilia Caesar L. in
natural environments. J Anim Ecol 2:263. https://doi.org/10.2307/962
Hwang CC, Turner BD (2009) Small-scaled geographical variation in life-history traits of the
blowfly Calliphora vicina between rural and urban populations. Entomologia Experimentalis et
Applicata 132:218–224. https://doi.org/10.1111/j.1570-7458.2009.00891.x
Iancu L, Carter DO, Junkins EN, Purcarea C (2015) Using bacterial and necrophagous insect
dynamics for post-mortem interval estimation during cold season: novel case study in Romania.
Forensic Sci Int 254:106–117. https://doi.org/10.1016/j.forsciint.2015.07.024
Jang H, Shin SE, Ko KS, Park SH (2019) SNP typing using multiplex real-time PCR assay for
species identification of forensically important blowflies and flesh flies collected in South Korea
(Diptera: Calliphoridae and Sarcophagidae). Biomed Res Int 2019:6762517. https://doi.org/10.
1155/2019/6762517
Jeong Y, Weidner LM, Pergande S et al (2022) Biodiversity of forensically relevant blowflies
(Diptera: Calliphoridae) at the anthropology research facility in Knoxville, Tennessee, USA.
Insects 13:109. https://doi.org/10.3390/insects13020109
29 Forensic Entomology 447

Jordan HR, Tomberlin JK (2017) Abiotic and biotic factors regulating inter-kingdom engagement
between insects and microbe activity on vertebrate remains. Insects 8(54):1–19
Kamal AS (1958) Comparative study of thirteen species of sarcosaprophagous Calliphoridae and
Sarcophagidae (Diptera) I. Bionomics Ann Entomol Soc Am 51:261–271. https://doi.org/10.
1093/aesa/51.3.261
Kavitha R, Nazni WA, Chye T et al (2012) Molecular identification of blow flies recovered from
human cadavers during crime scene investigations in Malaysia. Malay J Pathol 34:127
Kavitha R, Tan TC, Lee HL et al (2013) DNA typing of Calliphorids collected from human corpses
in Malaysia. Trop Biomed 30:119
Keil CB (2015) Research needs for forensic entomology in Ecuador. REMCB 36:71–78
Kintz P, Tracqui A, Mangin P (1990) Toxicology and fly larvae on a putrefied cadaver. J Foren Sci
Soc 30:243–246
Lord WD, Rodriguez WC (1989) Forensic entomology: the use of insects in the investigation of
homicide and untimely death. Prosecutor 22(3):41–48
Lord WD, Stevenson JR (1986) Directory of forensic entomologists, 2nd edn. Defense Pest
Information Analysis Center, Walter Reed Army Medical Center, Washington, DC
Lowe AC, Beresford DV, Carter DO et al (2013) The effect of soil texture on the degradation of
textiles associated with buried bodies. Forensic Sci Int 231:331–339. https://doi.org/10.1016/j.
forsciint.2013.05.037
Mabika N, Masendu R, Mawera G (2014) An initial study of insect succession on decomposing
rabbit carrions in Harare, Zimbabwe. Asian Pac J Trop Biomed 4(7):561–565. https://doi.org/
10.12980/APJTB.4.2014C1031
Macleod J, Donnelly J (1957) Some ecological relationships of natural populations of calliphorine
blowflies. J Anim Ecol 26:135. https://doi.org/10.2307/1786
Magni P, Guercini S, Leighton A, Dadour I (2013) Forensic entomologists: an evaluation of their
status. J Insect Sci 13:78
Malainey SL, Anderson GS (2020) Effect of arson fires on survivability of entomological evidence
on carcasses inside vehicle trunks. Forensic Sci Int 306:110033. https://doi.org/10.1016/j.
forsciint.2019.110033
Malejko J, Deoniziak K, Tomczuk M et al (2020) Puparial cases as toxicological indicators:
bioaccumulation of cadmium and thallium in the forensically important blowfly Lucilia
sericata. Front Chem 8:586067. https://doi.org/10.3389/fchem.2020.586067
Michalski M, Nadolski J (2018) Thermal conditions in selected urban and semi-natural habitats,
important for the forensic entomology. Forensic Sci Int 287:153–162. https://doi.org/10.1016/j.
forsciint.2018.03.042
Moody DE (2006) Immunoassays in forensic toxicology. In: Encyclopedia of analytical chemistry.
Wiley, New York, NY, pp 1–34. https://doi.org/10.1002/9780470027318.a1109
Moore H, Lutz L, Bernhardt V et al (2022) Cuticular hydrocarbons for the identification and
geographic assignment of empty puparia of forensically important flies. Int J Legal Med 136:
1791–1800. https://doi.org/10.1007/s00414-022-02786-1
Mozaffari E, Saghafipour A, Arzamani K et al (2020) Geographical distribution, biodiversity, and
species richness of medically important necrophagous flies in Central Iran. J Med Entomol 57:
377–381. https://doi.org/10.1093/jme/tjz203
Nihal Açikgöz H (2016) Malpractices concerning collection of forensic entomological evidence and
importance of standardization in Turkey. Foren Res Criminol Int J 3(1):237–241. https://doi.
org/10.15406/frcij.2016.03.00080
Nuorteva P (1964) Differences in the ecology of L. caesar (L.) and L. illustris (Meig.) (Diptera,
Calliphoridae) in Finland. Wiad Parazytol 10:583–587
Nuorteva P, Isokoski M, Laiho K (1967) Studies on the possibilities of using blowflies (Dipt.) as
medico-legal indicators in Finland. Annales Entomologici Fennici 33:217–225
Obour R, Asare R, Ankomah P, Larson T (2016) Poaching and its potential to impact wildlife
tourism: an assessment of poaching trends in the Mole National Park in Ghana. Am J Transplant
3:169–192. https://doi.org/10.30958/ajt.3-3-1
448 K. Guite et al.

Omkar (2017) Industrial entomology. Springer, New York, NY

Park JH, Kim YH, Ham CS et al (2018a) Molecular identification of forensically important
calliphoridae and sarcophagidae species using ITS2 nucleotide sequences. Forensic Sci Int
284:1–4. https://doi.org/10.1016/j.forsciint.2017.12.017
Park JH, Shin SE, Ko KS, Park SH (2018b) Identification of forensically important Calliphoridae
and Sarcophagidae species collected in Korea using SNaPshot multiplex system targeting the
cytochrome C oxidase subunit I gene. Biomed Res Int 2018:2953892. https://doi.org/10.1155/
2018/2953892
Perotti MA, Braig HR (2009) Phoretic mites associated with animal and human decomposition. Exp
Appl Acarol 49:85–124. https://doi.org/10.1007/s10493-009-9280-0
Perotti MA, Goff ML, Baker AS et al (2009) Forensic acarology: an introduction. Exp Appl Acarol
49:3–13. https://doi.org/10.1007/s10493-009-9285-8
Pinto J, Magni P, O’Brien RC, Dadour I (2021) Forensically relevant blow flies (Diptera:
Calliphoridae) of Central Connecticut, USA. Forensic Sci Int 327:110940. https://doi.org/10.
1016/j.forsciint.2021.110940
du Plessis M, der Walt LM-V (2004) Forensic entomology: relevant to legal dispute resolution? JJS
29(3):100–121
Pujol-Luz JR, Marques H, Ururahy-Rodrigues A et al (2006) A forensic entomology case from the
Amazon Rain Forest of Brazil. J Forensic Sci 51:1151–1153. https://doi.org/10.1111/j.
1556-4029.2006.00217.x
Rasmy A (2007) Forensic acarology: a new area for forensic investigation. Acarines: J Egypt Soc
Acarol 1:5–6. https://doi.org/10.21608/ajesa.2007.4983
Richards CS, Simonsen TJ, Abel RL et al (2012) Virtual forensic entomology: improving estimates
of minimum post-mortem interval with 3D micro-computed tomography. Forensic Sci Int 220:
251–264. https://doi.org/10.1016/j.forsciint.2012.03.012
Rivers D, Dahlem G (2014) The science of forensic entomology. Wiley-Blackwell, London
Robinson W (2005) Urban insects and arachnids a handbook of Urban Entomology. Cambridge
University Press, Cambridge
Rysavy NM, Goff ML (2014) Preliminary observations of arthropods associated with buried carrion
on Oahu. J Forensic Sci 60(2):462–467. https://doi.org/10.1111/1556-4029.12643
Sarwar M (2020) Typical flies: natural history, lifestyle and diversity of Diptera. IntechOpen,
London. https://doi.org/10.5772/intechopen.91391
Shen X, Jiang Y, Shang Y et al (2021) A preliminary study of necrophagous flies (Insecta: Diptera)
in the Lhasa Region (Qinghai–Tibet plateau), China. J Med Entomol 59:467–479. https://doi.
org/10.1093/jme/tjab187
Silva ÂZ, Hoffmeister CH, Anjos VA et al (2014) Necrophagous Diptera associated with wild
animal carcasses in southern Brazil. Revista Brasileira de Entomologia 58:337–342. https://doi.
org/10.1590/s0085-56262014000400001
Simon TM (2019) Forensic entomology and wildlife crime- the role of Blowfly larvae. Int Res J
Biol Sci 8(9):1–7
Singh R, Sachan GC (2007) Elements of entomology, 1st edn. Rastogi Publications, India
Smith KGV (1986) A manual of forensic entomology. British Museum (Natural History), London
Sohal RS, Lamb RE (1977) Intracellular deposition of metals in the midgut of the adult housefly,
Musca Domestica. J Insect Physiol 23:1349–1354. https://doi.org/10.1016/0022-1910(77)
90156-1
Sohal RS, Lamb RE (1979) Storage-excretion of metallic cations in the adult housefly, Musca
Domestica. J Insect Physiol 25:119–124. https://doi.org/10.1016/0022-1910(79)90089-1
Song T, Zhang P, Tang K et al (2022) A preliminary study on the distribution of necrophagous flies
on Hainan Island, China. J Forensic Sci 67:741–748. https://doi.org/10.1111/1556-4029.14937
Tullis K, Goff ML (1987) Arthropod succession in exposed carrion in a tropical rainforest on O’ahu
Island, Hawai’i. J Med Entomol 24:332–339
Tüzün A, Murat HG, Bilgili G (2015) Forensic acarology. Türk Bilimsel Derlemeler Dergisi 8(1):
54–56
29 Forensic Entomology 449

Tyndale-Biscoe M, Kitching RL (1974) Cuticular bands as age criteria in the sheep blowfly Lucilia
cuprina (Wied.) (Diptera, Calliphoridae). Bull Entomol Res 64:161–174
UNODC (2020) World wildlife crime report 2020: Trafficking in protected species. UN, New York,
NY. https://doi.org/10.18356/9789210052252
Vanin S (2018) Forensic entomology: an overview. Crime Secur Soc 1:1. https://doi.org/10.5920/
css.2018.05
Vasconcelos SD, Araujo MC (2012) Necrophagous species of Diptera and Coleoptera in northeast-
ern Brazil: state of the art and challenges for the forensic entomologist. Revista Brasileira de
Entomologia 56:7–14. https://doi.org/10.1590/s0085-56262012005000014
Villet MH, Richards CS, Midgley JM (2009) Contemporary precision, bias and accuracy of
minimum post-mortem intervals estimated using development of carrion-feeding insects. In:
Amendt J et al (eds) Current concepts in forensic entomology. Springer, New York, NY, pp
109–137. https://doi.org/10.1007/978-1-4020-9684-6_7
Volckaert H (2020) Current applications and limitations of forensic entomology. Themis: Res J Just
Stud Foren Sci 8:4. https://doi.org/10.31979/themis.2020.0804
Voss SC, Cook DF, Dadour IR (2011) Decomposition and insect succession of clothed and
unclothed carcasses in Western Australia. Forensic Sci Int 211:67–75. https://doi.org/10.1016/
j.forsciint.2011.04.018
Wang Y, Ma MY, Jiang XY et al (2017) Insect succession on remains of human and animals in
Shenzhen, China. Forensic Sci Int 271:75–86. https://doi.org/10.1016/j.forsciint.2016.12.032
Wang M, Chu J, Wang Y et al (2019) Forensic entomology application in China: four case reports. J
Forensic Legal Med 63:40–47. https://doi.org/10.1016/j.jflm.2019.03.001
Warrier V, Shedge R (2019) LETTER TO THE EDITOR Forensic entomology: applications in
investigations. J Indian Acad Forensic Med 41(3):219
Wells JD, Stevens JR (2008) Application of DNA-based methods in forensic entomology. Annu
Rev Entomol 53:103–120
Wells JD, Introna F, Di Vella G et al (2001) Human and insect mitochondrial DNA analysis from
maggots. J Forensic Sci 46(3):685–687. https://doi.org/10.1520/jfs15022j
Wydra J, Matuszewski S (2021) The optimal post-eclosion interval while estimating the post-
mortem interval based on an empty puparium. Foren Sci Med Pathol 17(2):192–198. https://doi.
org/10.1007/s12024-020-00328-y
YuBo Z, Yue Z, ZhengXiang Z et al (2018) Seasonal diversity of necrophagous flies in Anshun,
Guizhou. Acta Parasitologica et Medica Entomologica Sinica 25(2):101–106
Zou T-L, Feng D-X, Huang G-Y et al (2022) Species composition and succession of necrophagous
insects on small buried baits in China. J Med Entomol 59:1182–1190. https://doi.org/10.1093/
jme/tjac045
Zumpt F (1965) Myiasis in man and animals in the old world: a textbook for physicians,
veterinarians and zoologists. Butterworth and Co (Publishers) Ltd, London
Wildlife Forensics
30
Arjun Rao Isukapatla, Prachi Yadav, and Moumita Sinha

Abstract

Wildlife forensics is a multidisciplinary field that combines the techniques and

methods of various sciences, including biology, chemistry, and genetics to
address the illegal trade and exploitation of wildlife species. The ultimate aim
of wildlife forensics is to provide scientific evidence to support investigations and
enforcement of wildlife crimes and to contribute to the conversation and protec-
tion of wildlife populations. This field plays a crucial role in addressing traffick-
ing, which has a significant impact on biodiversity, ecosystems, and human
health.

Keywords

Wildlife · Wildlife Protection Act · Geographic · mtDNA · DNA barcoding

30.1 Wildlife

Wildlife broadly refers to the diverse array of non-domesticated creatures, animals,

plants, and other organisms that play an important role in nature. It also includes a
wide variety of species, such as mammals, birds, reptiles, fish, and insects. Wildlife

A. R. Isukapatla (✉)
Department of Life Sciences, Christ University, Bengaluru, Karnataka, India
e-mail: [email protected]
P. Yadav
Department of Forensic Science, Guru Ghasidas Vishwavidyalaya, Bilaspur, Chhattisgarh, India
M. Sinha
Department of Forensic Science, Kalinga University, Raipur, Chhattisgarh, India
e-mail: [email protected]

# The Author(s), under exclusive license to Springer Nature Singapore Pte 451
Ltd. 2024
A. Puri et al. (eds.), Fundamentals of Forensic Biology,
https://doi.org/10.1007/978-981-99-3161-3_30
452 A. R. Isukapatla et al.

builds and maintains the balance of ecosystem and yet many species are also
important for the livelihoods of human and cultural values. In contrast to this,
numerous human activities such as habitat destruction, pollution, and overhunting
play a major threat to wildlife populations around the globe. Many efforts are
necessary to conserve and protect wildlife and their habitats for biodiversity preser-
vation and for conserving the planet health. The idea of wildlife can challenge
different thoughts and emotions in people. For some, wildlife symbolizes nature
beauty and diversity and the importance to preserve it for forthcoming generations.
Others may think that wildlife can be a source of food or economic gains or a
potential threat to human safety or property. Many have deep emotions to specific
species, ecosystem, nature, and a sense of reverence, wonder, and curiosity when
observing wildlife and natural habitats, especially when they are aware of the threats
that wildlife is facing in recent times. Contrary, some people may feel that conserv-
ing wildlife is not the priority and that human needs should take precedence and not
see the importance of protecting wildlife and preserving their habitat. Overall, views
on wildlife are complex and may shape by cultural, economic, and personal reasons.

30.1.1 Wildlife Crime

Wildlife crime refers to illegal activities related to wild animals and plants, such as
poaching, illegal trade, smuggling, and habitat destruction (Cooper and Cooper
2008; Lawton and Cooper 2009). Wildlife crime can have a significant impact on
the survival of threatened and endangered species and can also disrupt the balance of
ecosystems. After the illegal smuggling of narcotic drugs and arms trafficking, the
third stands for wildlife products and related materials in any form (Sahajpal et al.
2009; Sreepada et al. 2002). Wildlife crime is often organized and perpetrated by
criminal networks, which can make it difficult to combat. However, there are many
efforts being made to combat wildlife crime, including the use of forensic science to
investigate crimes, the development of laws and regulations to protect wildlife, and
the use of education and awareness campaigns to reduce demand for wildlife
products. International cooperation is also critical in addressing wildlife crime, as
many of the illegal activities cross borders and require collaboration among different
countries and organizations.

30.1.2 Few Wildlife Crimes Entire the Globe Are Mentioned Below

Poaching Poaching is one of the most significant wildlife crimes, and it is driven by
the demand for wildlife products such as ivory, rhino horn, and animal parts used in
traditional medicine. Illegal trade in wildlife is also a major problem, as it fuels the
black market for wildlife products. This can include the illegal trade of live animals,
such as exotic pets, and also trade in products derived from wild animals, such as fur,
leather, and other body parts.
30 Wildlife Forensics 453

Smuggling Smuggling is another form of wildlife crime, as it involves the illegal

transport of wildlife and wildlife products across national or international borders.
Habitat destruction is also a major problem, as it can make it difficult for wildlife to
survive and reproduce and can also disrupt the balance of ecosystems.

Illegal Trade Illegal trade of wildlife, also known as wildlife trafficking, is the
buying, selling, and transportation of wild animals and plants, as well as their
products and derivatives, in violation of national and international laws and
regulations.

Habitat Destruction Habitat destruction refers to the destruction or degradation of

natural habitats such as forests, wetlands, and grasslands, which can make it difficult
for wildlife to survive and reproduce. Habitat destruction is a major threat to wildlife
populations around the world and is driven by a variety of human activities such as
urbanization, agriculture, mining, logging, and dam construction. Deforestation is
one of the most significant causes of habitat destruction.

Endangered Species Endangered species are wild animals and plants that are at
risk of extinction. The term “endangered” is used to describe a species that is in
danger of dying out completely. The International Union for Conservation of Nature
(IUCN) maintains a Red List of Threatened Species, which categorizes species into
different levels of risk, with “Endangered” being the second highest level of risk.

Trophy Hunting Trophy hunting refers to the practice of hunting wild animals for
the purpose of obtaining a part of the animal (such as a head, antlers, or tusks) as a
trophy or souvenir. This practice is controversial, as some argue that it is a necessary
tool for conservation and population management, while others argue that it is cruel
and inhumane and can contribute to the decline of certain species.

Wildlife Crime Syndicate A wildlife crime syndicate refers to a group of

individuals or organizations that are involved in illegal activities related to wildlife.
These activities can include illegal hunting, poaching, trafficking of wildlife and
wildlife products, and other forms of wildlife exploitation. Wildlife crime syndicates
often operate on a large scale and can be highly organized, using methods such as
bribery, corruption, and violence to evade law enforcement.

30.1.3 Wildlife Forensics

Wildlife forensics is an associated field of crime investigation that uses the scientific
procedures and principles to examine, classify, and compare the recovered pieces of
evidence from the crime scene. Numerous ways of poaching, killing, hunting of wild
animals and illegal cutting, and trading of plants for medicinal purposes make ways
to deteriorate the wild species round the globe. This can include the analysis of
physical evidence such as DNA, fingerprints, and trace evidence, as well as the
454 A. R. Isukapatla et al.

examination of wildlife products such as meat, ivory, and fur. Wildlife forensics can
be used to identify suspects, link suspects to crimes, and establish the origin and
movement of wildlife products. The field of wildlife forensics is interdisciplinary,
drawing on expertise from a variety of fields such as biology, genetics, chemistry,
and criminology. The goal of wildlife forensics is to help protect wildlife by
providing scientific evidence to support law enforcement efforts to combat wildlife
crime. In modern times, the emerging field of wildlife forensics has constantly
progressed with new tools and technologies for addressing crimes against wildlife.
The advanced use of technologies such as fingerprinting identification, hybrid DNA
analysis, toxicology, ballistics, and cyber forensic has upgraded the law enforcement
ability and conservator groups to examine, investigate, and prosecute wildlife
crimes.

• Fingerprints can play a role in wildlife investigation by providing a means of

identifying suspects who have left their fingerprints at a crime scene, or on items
related to the crime such as weapons or illegally obtained wildlife products.
Fingerprints can also be used to identify poachers by matching fingerprints
found on illegal hunting equipment, poaching traps, or other objects found at
the crime scene.
• DNA is commonly used in wildlife forensics as a tool for identifying individual
animals and determining their relationships with one another. This can be used for
a variety of purposes, such as tracking the movement of threatened and
endangered species, investigating wildlife crimes, and determining the origin of
products made from wildlife parts, such as ivory or meat. DNA analysis can also
be used to study the genetic diversity and population structure of wildlife
populations, which can enlighten conservation efforts.
• For forensic toxicology in wildlife examination, the samples can be examined
from wildlife for the presence of toxic chemicals, such as pesticides, heavy
metals, and pollutants. This can help to determine the cause of death in cases of
wildlife poisoning, as well as to identify the source of the poison. Toxicology can
also be used to monitor the health of wildlife populations and detect any changes
in the levels of pollutants in the environment. This information can then be used
to implement conservation measures to protect wildlife from exposure to toxic
chemicals.
• Forensic ballistics in wildlife investigation can be used to match bullets or bullet
fragments found at a crime scene to a specific firearm and to determine the
trajectory of the bullet, which can help investigators determine the location of
the shooter. This information can be used to identify suspects and build a case
against them. Forensic ballistic techniques can also be used in cases of poaching,
where wildlife species are hunted illegally, and bullets or fragments of bullets are
found at the crime scene, and the bullet or fragment can be matched to the firearm
used by the poacher, which can help to identify and prosecute the poacher and
also help to recover the illegally obtained wildlife species.
• Cyber forensics can play a role in wildlife investigation by helping to uncover and
analyze digital evidence related to wildlife crimes, such as illegal hunting or
30 Wildlife Forensics 455

trafficking of endangered species. This can include analyzing data from surveil-
lance cameras, social media, and other online sources to identify suspects and
gather information about their activities. Additionally, cyber forensics can be
used to track the movement of illegal wildlife products through digital supply
chains and to identify and shut down online marketplaces that facilitate such
crimes.

In addition, the use of forensic techniques can also help in understanding the
extent of the illegal trade of wildlife products and the impact of these activities on
wild populations. Furthermore, the use of remote sensing and GIS analysis can also
be useful in detecting illegal activities like illegal logging and habitat destruction and
also in monitoring wildlife populations.

30.2 Scope of Wildlife Forensics

In a worldwide scenario, wildlife crime is fascinating huge monetary gains for those
who participate in this illegal smuggling but unknowingly at the cost of many
species extinction (Johnson et al. 2014). From the wildlife crime monetary benefit
latest estimates to USD 30 billion per year, this not includes the illegal trade in
timber, which alone costs more than USD 5 billion dollars and illegal fishing from
USD 20–25 billion dollar approximately (Linacre and Ciavaglia 2017). The cost for
the wildlife species black market may increase for those species, which are listed in
the protection category under the Convention on the International Trade in
Endangered Species of Wild Flora and Fauna (CITES) (Schneider 2008). Wildlife
forensics is the application of forensic science techniques to investigate crimes
against wildlife. This can include the illegal trade in endangered species, poaching,
and the illegal use of wildlife products. The scope of wildlife forensics includes the
collection and analysis of physical evidence, such as DNA, blood, and other
biological samples, as well as the examination of wildlife products and packaging
materials to determine their origin. Wildlife forensic scientists also use techniques
such as stable isotope analysis and trace element analysis to track the movement of
animals and their products. Additionally, wildlife forensics also includes the use of
forensic techniques to combat wildlife crime, such as the identification of poached
animals and the development of new technologies to aid in the detection of illegal
wildlife trade.
Forensic science is crucial in wildlife investigation as it allows for the identifica-
tion and prosecution of individuals who engage in illegal activities related to
wildlife. It can provide valuable evidence to support criminal cases and can also
aid in identifying and dismantling criminal networks involved in wildlife trafficking.
Forensic techniques used in wildlife investigation include DNA analysis, which can
identify the species of an animal and link a suspect to a specific animal or animal
product; trace evidence analysis, which can identify the origin of an animal or animal
product; and veterinary forensic pathology, which can determine the cause of death
of an animal. Forensic science also helps in wildlife conservation, as it can be used to
456 A. R. Isukapatla et al.

identify illegal trade routes and understand the full extent of the problem, providing
evidence to support conservation efforts and help to protect endangered species.
Furthermore, it also allows investigators to understand the motivations of poachers
and traffickers, which can inform more effective countermeasures.

30.2.1 Importance of Wildlife Forensics

Wildlife forensics plays a critical role in protecting and conserving wildlife

populations and their habitats. The illegal trade in wildlife products is a major threat
to many species, and wildlife forensic techniques can be used to identify, track, and
prosecute those responsible for these crimes. One of the key uses of wildlife
forensics is in the identification of poached animals and illegally traded wildlife
products. By analyzing physical evidence, such as DNA, blood, and other biological
samples, forensic scientists can match a product or animal to a specific location or
population and determine if it was obtained illegally. This information can be used to
prosecute those responsible for wildlife crimes and to help protect endangered
species. Another important use of wildlife forensics is in the development of new
technologies and methods to detect and prevent illegal wildlife trade. For example,
wildlife forensic scientists are currently working on developing DNA testing
methods that can be used to quickly and accurately identify different species of
animals and their products, making it easier to detect illegal trade. Moreover, wildlife
forensics is a unique field that helps to bridge the gap between conservation, law
enforcement, and forensic science by providing scientific evidence for court cases.
Furthermore, it helps in the protection and conservation of biodiversity and sustain-
able use of natural resources.

30.2.2 Ethics in Wildlife Forensics

Ethics play an important role in wildlife forensics, as it involves the collection,

preservation, and analysis of evidence from wild animals, which can raise a number
of ethical considerations. Some of the key ethical issues that may arise in wildlife
forensics include the following.

Animal Welfare Wildlife forensics may involve the collection of samples from live
animals or from animals that have been killed, which raises concerns about the
welfare of these animals. It is important to ensure that any collection of samples is
done in a way that minimizes harm to the animal.

Respect for Wildlife Wildlife forensics may also involve the examination of
evidence from animals that have been killed, which raises concerns about respect
for wildlife. It is important to ensure that the collection and examination of evidence
are done in a way that is respectful of the animals and their remains.
30 Wildlife Forensics 457

Privacy Wildlife forensics may also involve the collection and analysis of DNA
samples from wild animals, which raises concerns about the privacy of these
animals. It is important to ensure that any collection and analysis of DNA samples
are done in a way that respects the privacy of the animals.

Conservation Wildlife forensics may also involve the investigation of crimes

against wildlife, which raises concerns about the conservation of wildlife. It is
important to ensure that the investigation of crimes against wildlife is done in a
way that promotes conservation and the protection of wildlife.

Transparency and Impartiality Wildlife forensics investigation should be trans-

parent and impartial, avoiding any bias or corruption that may impede the process
and integrity of the investigation.

30.3 Wildlife Protection Act 1972

The Wildlife Protection Act (WPA) of 1972 is an Indian law that provides for the
protection of wild animals, birds, and plants. The act is intended to protect India’s
biodiversity and natural heritage, and it is enforced by the country’s forest depart-
ment. The act has been amended several times over the years to include more
animals and plants under protection and to increase penalties for wildlife crimes.
The act also provides for the creation of special courts for the trial of offenses under
the act, which helps to speed up the process of prosecution of wildlife crimes. The
Wildlife Protection Act of 1972 is an important law that helps to protect India’s
wildlife and biodiversity, and it serves as a model for other countries looking to
develop similar legislation. Under the act, hunting and trapping of wild animals are
prohibited, and trade in wild animals and their products is regulated. The Act also
provides for the creation of protected areas, such as national parks, wildlife
sanctuaries, and closed areas, where hunting and other activities that could harm
wildlife are prohibited. The Wildlife Protection Act of 1972 also includes provisions
for the regulation of trade in wildlife and wildlife products and the seizure and
forfeiture of illegally obtained wildlife and wildlife products. Penalties for violations
of the act include fines and imprisonment.
Some of the key measures that India has taken to protect its wildlife under
Wildlife Protection Act 1972 include the following.

Protected Areas India has a large network of protected areas, including national
parks, wildlife sanctuaries, and biosphere reserves, which provide critical habitat for
many of the country’s species of wild animals, birds, and plants.

Wildlife Crime Control Bureau A dedicated agency is established to combat

wildlife crime, and it helps in the investigation of wildlife crimes and the seizure
and forfeiture of illegally obtained wildlife and wildlife products.
458 A. R. Isukapatla et al.

Ban on Wildlife Trade India has banned the trade of certain wildlife products, such
as tiger bone and rhinoceros horn, in an effort to protect these species from
extinction.

Community-Based Conservation India has also implemented community-based

conservation programs, which involve local communities in the management and
conservation of wildlife and their habitats. These programs have helped to reduce
human–wildlife conflict and to build support for conservation among local
communities.

The Wildlife Protection Act (WPA) of 1972 is divided into six schedule lists that
provide varying degrees of protection. Poaching, smuggling, and illegal trade in
animals listed in Schedules 1–4 are all prohibited. Animals included in the schedule
are completely protected from hunting, and trade and commerce involving such
animals is strictly regulated. The WPA 1972 governs wildlife conservation and
protection in India. India is the first country in the world to include measures for
environmental preservation and conservation in its constitution.
The WPA 1972 is categorized into six different schedules (Table 30.1) that
protect and preserve wildlife animals, plants, and the ecosystem. The animals listed
in the schedule are defined as protected from any illegal activities like hunting,
poaching, trading, and commerce of these animals. India stood first to take safety
measures for preserving and conserving the environmental habitats.

30.3.1 Conservation Projects

Conservation projects are efforts to protect and preserve natural resources and
habitats, such as forests, wetlands, and wildlife. These projects can take many
forms, including habitat restoration, reintroduction of endangered species, and
protection of keystone species. Additionally, conservation projects may also focus
on reducing human impacts on the environment, such as by promoting sustainable
land use practices and reducing pollution. Conservation projects are documented to
utilize the evolutionary theory, which helps in current and future wildlife challenges,
and also for wildlife survival since the key challenges are global warming, pollution,
wildlife threat, and hunting. The projects can be undertaken by government
agencies, non-profit organizations, or private companies and may be funded by a
variety of sources, including government grants, private donations, and corporate
sponsorships. Few of the conservation projects are planned under WPA 1972.

30.3.1.1 Project Snow Leopard

Project Snow Leopard is a conservation program launched by the government of
India in 2009 to protect and conserve the endangered snow leopard and its ecosystem
in the Himalayan region of the country. The project aims to improve the conserva-
tion status of the snow leopard through a combination of measures such as habitat
protection, prey base enhancement, community participation, and research. The
30 Wildlife Forensics 459

Table 30.1 Different schedules under Wildlife Protection Act

S. no. Schedule Definition Animals
1. Schedule Deals with endangered species and Andaman wild pig, blackbuck,
I requires strict protection. Species brow-antlered deer, Himalayan
defined in this schedule are brown bear, cheetah, Chinese
prohibited from hunting in India, pangolin, clouded leopard, four-
except if they become threat to horned antelope, bison or gaur,
human life or in case of disabled or golden langur, Indian lion,
diseased beyond recovery Kashmir stag, leopard or panther,
musk deer, rhinoceros
2. Schedule Deals with the animals also needed Assamese macaque, Himalayan
II high protection with trading crestless porcupine, Himalayan
prohibited either as animal, or part newt or salamander, pig-tailed
of animals macaque, stump-tailed macaque,
wild dog or dhole, spiny-tailed
lizard, or sanda
3. Schedule Deals with non-endangered species Barking deer or muntjac, bharal,
III include protected species where chital, hyaena, nilgai, sambar, wild
hunting is prohibited but the pig, sponges
punishments are less severe than
the first two schedules
4. Schedule As mentioned in Schedule III A five-striped palm squirrel,
IV Himalayan mouse hare, hedgehog
5. Schedule Deals with animals that are termed Common crow, fruit bats, mice,
V “vermin” and can be hunted rats
6. Schedule Deals with the cultivation of a Beddomes’ cycad, blue vanda,
VI specific plant and restricted from kuth, ladies slipper orchids, pitcher
Illegal possession, sale, and plant, red vanda
transportation

project is being implemented in 12 states in India, including Himachal Pradesh,

Jammu and Kashmir, and Uttarakhand, which are known to be snow leopard
habitats. Schedule I of the WPA 1972 and the International Union for Conservation
of Nature (IUCN) declared the species under “Vulnerable category.” The species
listed in the Convention on International Trade in Endangered Species (CITES) and
the Convention on Migratory Species (CMS), which defines the highest conserva-
tion of the species both under national and International borders. The protection
program is established under the Global protocol of Global Snow Leopard and
Ecosystem Protection Program.

30.3.1.2 Project Tiger

Project Tiger is a wildlife conservation program launched by the government of
India in 1973 to protect the Bengal tiger and its habitats. The project aims to ensure a
viable population of tigers in the wild, while also preserving areas of biological
importance as a natural heritage for the benefit of all living beings. The project is
being implemented in various tiger reserves across the country, which are managed
by the National Tiger Conservation Authority (NTCA). These reserves provide a
protected area for tigers to breed and live, while also promoting conservation and
460 A. R. Isukapatla et al.

protection of the species’ natural habitats. Project Tiger also includes a comprehen-
sive monitoring system and anti-poaching efforts to ensure the safety of tigers and
other wildlife in the reserves. The project is considered one of the most successful
conservation programs in the world. Measures are taken for the conservation of
tigers under the WPA 1972.

Core Zones
The designated areas are exclusively used for the conservation of tiger but should not
invade the scheduled tribes’ rights or other forest inhabitants. Additionally, the zone
and areas should be free from forest actions and disturbances. The timber collection,
grazing of cattle, and other human activities are not allowed within this zone.

Buffer Zones
This zone acts as an additional habitat for the tigers and also offers co-existence of
human activities. This zone is parallel to the core tiger habitat area.

30.3.1.3 Project Elephant

Project Elephant is a conservation program launched by the Government of India in
1992 to protect Indian elephants and their habitats. The main objectives of the
program include protection of elephants, their habitats, and corridors, as well as
mitigation of human–elephant conflicts. The program also focuses on research and
monitoring of elephant populations and the development of elephant-friendly infra-
structure. It is important to mention that human activities such as agriculture,
urbanization, and infrastructure development have led to the fragmentation and
degradation of elephant habitats and corridors, causing human–elephant conflicts
and threatening elephant populations. Elephant corridors are narrow strips of land
that connect fragmented habitats, allowing elephants to move safely between them.
In India, elephant corridors are used by wild elephants to migrate between habitats in
search of food, water, and mates. These corridors are important for the survival and
genetic diversity of elephant populations. The Indian government, along with vari-
ous conservation organizations, has identified and is working to protect several
elephant corridors across the country (Table 30.2). Some of the important elephant
corridors in India include the following.

30.3.1.4 Project Hangul

Project Hangul is a conservation program aimed at protecting the Hangul deer
(Cervus elaphus hanglu), also known as the Kashmir stag, which is a subspecies
of the European red deer. The program is run by the government of the India and
state of Jammu and Kashmir, in collaboration with local communities and conserva-
tion organizations. The Hangul deer is considered one of the most critically
endangered deer species in the world, with only around 150 remaining in the wild.
Project Hangul is an important conservation effort to protect the remaining popula-
tion of the species and to ensure its survival for future generations. The main
objectives of the program include the following.
30 Wildlife Forensics 461

Table 30.2 Elephant corridors in India

S. no. Elephant corridor State Connects to
1 The Rajaji-Corbett Elephant Uttarakhand Rajaji National Park and the Corbett
Corridor National Park
2 The Kutch-Pachmarhi Gujarat Pachmarhi Forest in Madhya Pradesh
Elephant Corridor
3 The North Bank Elephant Assam Dibru Saikhowa National Park
Corridor
4 The Nilgiri Elephant Corridor Tamil Nadu Sathyamangalam Wildlife Sanctuary
5 The Anechowkur Elephant Karnataka Talakaveri Wildlife Sanctuary
Corridor

Protection of the Hangul Deer The program aims to protect the deer from
poaching and habitat loss, which are the main threats to the species.

Habitat Restoration The program works to restore the natural habitat of the
Hangul deer, which includes wetland, grassland, and forest habitats.

Monitoring The program conducts regular monitoring of the population of the

Hangul deer and its habitat to assess the effectiveness of conservation efforts.

Research The program conducts research on the biology and ecology of the Hangul
deer to understand the species better and to make informed conservation decisions.

Community Engagement The program involves local communities in conserva-

tion efforts, through awareness campaigns and alternative livelihood programs.

Law Enforcement The program works with law enforcement agencies to combat
poaching and to protect the deer from illegal hunting.

Ecotourism The program promotes ecotourism as a means of generating income

for local communities and raising awareness about the importance of conservation.

30.3.1.5 Crocodile Conservation Project

A crocodile conservation project is a program aimed at preserving and protecting
crocodile populations and their habitats. This can include activities such as monitor-
ing crocodile populations, habitat restoration, research, education and awareness
campaigns, and law enforcement to prevent illegal hunting and trade. The ultimate
goal of a crocodile conservation project is to ensure the long-term survival of
crocodile species and the ecosystems they inhabit.

Directions for Crocodile Conservation Project Conduct a comprehensive assess-

ment of the current crocodile population and distribution: This will provide a
462 A. R. Isukapatla et al.

baseline for monitoring population trends and identifying areas where conservation
efforts need to be focused.

Develop a conservation plan: This should include specific goals and objectives, as
well as strategies for achieving them.

Implement Habitat Restoration and Protection Measures This could include

activities such as removing invasive species, restoring wetlands, and protecting
nesting sites.

Conduct Research to Better Understand Crocodile Biology and Ecology This

will provide valuable information for making informed conservation decisions.

Educate and Raise Awareness About Crocodile Conservation This can include
public education campaigns, working with local communities, and training law
enforcement to better protect crocodiles and their habitats.

Enforce Laws and Regulations to Prevent Illegal Hunting and Trade This is
critical to protecting crocodile populations from unsustainable hunting and
poaching.

Monitor and Evaluate the Success of Conservation Efforts Regular monitoring

will help identify areas where the conservation plan needs to be adjusted and track
progress toward achieving conservation goals.

30.3.1.6 Project Rhino

Project Rhino was launched in 2005 to protect and conserve the rhinos. The Indian
Rhino Vision 2020 project aimed to achieve a wild population of at least 3000
greater one-horned rhinos spread across seven protected areas in the Indian state of
Assam by 2020. Kaziranga National Park, Pobitora National Park, Orang National
Park, Manas National Park, Laokhowa Wildlife Sanctuary, Burachapori Wildlife
Sanctuary, and Dibru Saikhowa Wildlife Sanctuary are the seven protected areas.

30.3.1.7 Indian Rhino Vision 2020

The Department of Environment and Forests, State of Assam collaboration with The
Bodo Autonomous Council as an active partner, executed The Indian Rhino Vision
2020. World Wildlife Fund WWF-India, WWF AREAS (Asian rhino and elephant
action strategy), and The IRF (International Rhino Foundation), along with number
of NGOs, are actively participating in the program. The prime focus and vision are to
increase the one-horned rhino population from around 2000–3000 and to protect
them from poaching and illegal hunting, and their distribution across seven protected
areas to safeguard them for long-term sustainability is also one of the major visions
of the program.
30 Wildlife Forensics 463

30.4 Pieces of Evidence and Identification

Different markers used worldwide for species identification in wildlife forensics are
morphological studies, microscopic examinations, anatomical landmarks, taxo-
nomic identification, phylogeographic analysis, serological methods, and genetic
markers. This individual identification is based on hair characterization, long bones,
tooth morphology, pug marks, and related traits (Bell and Machin 2011). In wildlife
forensics, the pieces of evidence used for species identifications are processed meats
(Fortajada et al. 2021), shark fins (Chapman et al. 2003), egg shells (Coghlan et al.
2012), animal hairs (Ahmed et al. 2018), bones (Gouda et al. 2020), ivory (Kitpipit
et al. 2016), rhinoceros horns (Hsieh et al. 2003), turtle shell (Yadav et al. 2021),
feathers (Dove and Koch 2011), and fish scales (Kumar et al. 2007).

30.4.1 Geographical Origin in Wildlife Forensics

Identifying the geographic origin of animals in cases of import and export of animal
or animal body parts is crucial. Identifying the origin of wildlife samples can be
proceeded by isotope comparison using methods like inductively coupled plasma
mass spectrometry (ICP-MS) and isotope ratio mass spectrometry (IRMS) (Tobe
2009). In routine wildlife forensics and other scientific disciplines, using the isotope
analysis to identify the trace pieces of evidence, to track the movements of animals,
and to regulate the geographic origin of individual animals is possible (Bowen et al.
2005). Radioactive isotope analysis is a technique used in wildlife forensics to
determine the origin or movement of wildlife and their products, such as meat,
ivory, and fur. The method involves measuring the levels of naturally occurring
radioactive isotopes, such as carbon-14 and strontium-90, in the sample. These
isotopes have different levels in different geographic regions due to variations in
geology and climate, which makes it possible to identify the region of origin.
Additionally, the ratios of different isotopes in the sample can provide information
on the age of the animal, diet, and migration patterns. This information can be used
in investigations related to wildlife trafficking and poaching illegal trade in
endangered species. Detecting the stable isotopes in animal soft tissue can possibly
result to identify the precise location of an animal shortly after death. The results can
be varied based on the types of tissue and the type of animal from which it originates.
The type of tissue material uses for such analysis is imperative as the different types
of tissues can incorporate the different results at different time intervals (Ogden et al.
2004). Stable isotope analysis is applicable to wide range of applications in forensic
science and can be used to validate byproducts like meat, milk, and cheese (Renou
et al. 2004; Boner and Förstel 2004) and for different migration patterns of animals
and birds (Hobson and Wassenaar 1996; Chamberlain et al. 1996).
Remote sensing and GIS (geographic information systems) analysis can be used
in wildlife forensics to help identify and track the movement of animal populations,
as well as to monitor and manage habitats. Remote sensing can be used to gather data
on the environment and the animals that inhabit it, such as through the use of satellite
464 A. R. Isukapatla et al.

imagery and aerial photography. GIS can then be used to analyze these data and
create maps and models that can be used to understand the distribution and
movements of animal populations, as well as to identify potential threats to their
habitats. This information can be used to help protect and conserve animal
populations and to aid in the investigation of wildlife crimes.
Remote sensing can be used in wildlife forensics to gather data on the environ-
ment and the animals that inhabit it. These data can be analyzed using GIS (geo-
graphic information systems) to create maps and models that can be used to
understand the distribution and movements of animal populations, as well as to
identify potential threats to their habitats. One example of the use of remote sensing
in wildlife forensics is the use of satellite imagery to monitor and track the movement
of endangered species. High-resolution satellite imagery can be used to identify and
map the locations of specific animals or groups of animals, such as elephants or
rhinos. This information can be used to understand their migration patterns, popula-
tion densities, and potential threats to their habitats, such as illegal poaching or
habitat destruction. Aerial photography can also be used to gather data on the
environment and wildlife. This can be used to identify and map wildlife habitats,
such as wetlands or forests, and to monitor changes in these habitats over time. This
information can be used to understand how human activities, such as land develop-
ment or resource extraction, may be impacting wildlife populations. Another use of
remote sensing in wildlife forensics is the use of thermal imaging cameras to detect
and track the movement of animals at night. This can be particularly useful for
monitoring nocturnal animals, such as bats, or for identifying and tracking illegal
poaching activities.

30.4.1.1 Advantages of Geographic Information Systems in Wildlife

Forensics
There are several advantages of using geographic information systems (GIS) in
wildlife forensics, including the following.

Data Integration GIS allows for the integration and analysis of multiple types of
data, such as satellite imagery, aerial photography, and GPS tracking data, which can
be used to create more detailed and accurate maps and models of animal populations
and habitats.

Spatial Analysis GIS provides a wide range of spatial analysis tools, such as spatial
querying, overlay, and modeling, which can be used to understand the distribution
and movements of animal populations and the potential threats to their habitats.

Visualization GIS allows for the creation of maps and 3D models that can be used
to visualize and analyze data, making it easy to understand and communicate
information on wildlife populations and habitats.
30 Wildlife Forensics 465

Historical Data Management GIS allows for the management and analysis of
historical data over time, which can be used to understand changes in animal
populations and habitats over time.

Collaboration and Sharing GIS makes it easy to share and collaborate on data and
analysis with other researchers, conservation organizations, and law enforcement
agencies.

Cost-Effective GIS is relatively low-cost and easy to use, making it a valuable tool
for conservation efforts and the investigation of wildlife crimes.

Predictive Modeling GIS can be used to create predictive models that can be used
to identify potential threats to animal populations and habitats and to plan conserva-
tion strategies.

30.4.2 Morphological and Microscopic Examination in Wildlife

Forensics

Morphological examination is a traditional method of species identification in

wildlife forensics that involves the visual examination of physical characteristics,
such as anatomy, size, shape, and coloration. This method is used to identify species
based on the unique morphological characteristics of different taxa, such as feathers,
scales, fur, and bones. Morphological examination is often used as a first step in
species identification, especially in cases where DNA analysis is not feasible or
practical, or in conjunction with DNA analysis to provide additional information for
species identification. It is also used to determine the age, sex, and health status of
individual animals and to provide information on the cause of death in cases of
wildlife mortality. Despite advances in DNA-based methods, morphological exami-
nation remains an important tool in wildlife forensics due to its versatility and ease of
use in a wide range of sample types and conditions.
Hair morphology examination is a subcategory of morphological examination in
wildlife forensics that focuses on the physical characteristics of hair samples, such as
shape, color, and structure. Hair samples can provide valuable information for
species identification, as well as for determining the age, sex, and health status of
individuals. In addition, hair samples can provide information on the individual’s
geographic location and diet, which can be used to infer the movements and
behavior of wildlife. A morphological examination can be performed by visual
examination of the hair under a microscope or by using specialized techniques,
such as light microscopy, scanning electron microscopy, and Fourier transform
infrared spectroscopy. These techniques can be used to examine the cuticular scale
pattern, shaft shape, and pigment distribution of hair samples, which can provide
species-specific information. Hair morphology examination is often used in combi-
nation with other methods, such as DNA analysis, to provide a more complete
picture of the species and individual.
466 A. R. Isukapatla et al.

The other type of morphology examination can be of Horns, which is a subcate-

gory of morphological examination in wildlife forensics that focuses on the physical
characteristics of horn samples, such as shape, size, color, and structure. Horns are
important structures in many species of wildlife, serving various functions such as
defense, display, and competition for mates. As a result, they can provide valuable
information for species identification and population management. Horn
examinations can be performed by visual examination or under a microscope or
by using specialized microscopic techniques, such as scanning electron microscopy,
and X-ray diffraction. These techniques can be used to examine the internal struc-
ture, size, and shape of horns, which can provide species-specific information. In
wildlife forensics, horns examination is particularly useful in cases of illegal trade
and poaching of protected or endangered species, where the horns are highly valued
for their use in traditional medicines, ornamental items, and other commercial
purposes. Horn morphology examination can also provide important information
for population management and conservation, by helping to determine the age and
sex of individuals and by providing information on the geographic origin and
migration patterns of wildlife.
Teeth examination is a subcategory of morphological examination in wildlife
forensics that focuses on the physical characteristics of teeth samples, their size,
shape, and structure. Teeth are important structures in many species of wildlife,
serving various functions such as feeding, eating, and for prey. As a result, they can
provide valuable information for species identification and population management.
These techniques can be used to examine the internal structure, size, and shape of
teeth, which can provide species-specific information. Teeth morphology examina-
tion is often used in combination with other methods, such as DNA analysis, to
provide a more complete picture of the species and individual. In wildlife forensics,
teeth morphology examination is particularly useful in cases of illegal trade and
poaching of protected or endangered species, where the teeth are highly valued for
their use in traditional medicines, ornamental items, and other commercial purposes.
Teeth morphology examination can also provide important information for popula-
tion management and conservation, by helping to determine the age and sex of
individuals and by providing information on the geographic origin and migration
patterns of wildlife.
Hair morphology refers to the physical structure and characteristics of an animal’s
hair. In wildlife forensics, hair morphology is often used to identify the species of an
animal, as well as the individual, based on differences in hair structure such as
medulla pattern, scale pattern, shaft diameter, and pigment distribution. By examin-
ing the hair under a microscope, forensic scientists can compare it to reference hair
samples to determine the species and sometimes even the individual source of the
hair sample. Hair is commonly used in wildlife forensics as a means of species
identification (Sahajpal and Goyal 2009). Hair morphology can be used to solve
crimes involving wildlife, such as poaching or illegal hunting. Wildlife forensics
uses microscopy to examine physical evidence from wildlife crime scenes, such as
hairs, bones, scales, and feathers. Microscopes help identify the species of origin and
provide evidence linking a suspect to a crime scene. Techniques used in wildlife
30 Wildlife Forensics 467

forensics microscopy include light microscopy, scanning electron microscopy

(SEM), and transmission electron microscopy (TEM).
The cuticle is the outermost layer of hair shaft, and its structure is important in
wildlife forensics for species identification. The cuticle structure of an animal hair
can vary depending on the species, and it can provide valuable information for
species identification. Some of the features of the cuticle structure that can be used
for species identification include the shape and pattern of the scales, the thickness of
the cuticle, and the presence or absence of pigment in the cuticle. The cortex is the
main structural part of an animal hair shaft, and it provides important information for
species identification in wildlife forensics. The cortex structure can vary depending
on the species, and it can contain important information such as pigment, medulla
patterns, and cortical fibrils. The presence or absence of pigment, as well as its
distribution, can be used to identify the species of an animal. The medulla pattern,
which is the innermost part of the cortex, can also be used for species identification,
as different species may have unique medulla patterns. Cortical fibrils, which are the
structural proteins within the cortex, can also be used for species identification, as
their arrangement and size can vary between species. The compositional pattern of
the pigmentation can vary widely in different animals. It is denser toward the
medulla. In animal, pigments are often found in solid masses called ovoid bodies,
especially in dogs and cattle. Some of the cuticular and medullary patterns of wild
and domestic animals are shown in (Fig. 30.1). Microscopy of hair involves the
examination of hair shafts and cuticles under a microscope to determine the species
of origin and to compare the hair sample with known reference samples. Light
microscopy is used to examine the overall structure of the hair, including the
shape and size of the shaft and the pattern of the cuticle. Scanning electron micros-
copy (SEM) is used to examine the surface characteristics of the hair in greater detail,
such as the scale pattern (Chernova 2014). Transmission electron microscopy (TEM)
can provide high-resolution images of the hair’s internal structure, including the
cortex and medulla. These techniques can help forensic scientists determine the
species of origin of hair found at a crime scene and can provide evidence linking a
suspect to the scene.

30.4.3 DNA-Based Identification in Wildlife Forensics

Wildlife forensics mainly involves DNA identification for illegal trades, hunting
animals, and the different types of wildlife crime identification. Microscopic identi-
fication or morphological determination cannot be justified for wildlife material
identification where the materials’ presence may be in other forms. In such cases,
molecular-based approaches or DNA-based identification tools can be useful for
examinations (Linacre and Tobe 2011). The universal method opted for DNA-based
analysis is mitochondrial DNA (mtDNA) sequencing for specimen identification of
either animals or animal parts with a wide range of markers. Such highly precise way
of identification methods are truly based upon the type of identification materials
such as specific region of animal and plant material, taxonomic level identification
468 A. R. Isukapatla et al.

Fig. 30.1 Cuticular and medullary patterns of wild and domestic animals

for inter- and intra-species level, applications of new DNA markers, phylogenetic
tree-based approaches, and applying the next generation sequencing (NGS) models.
The high standards and requirements for DNA-based identification is an approach to
truly identify the species of animal and plant with a specific set of either autosomal or
nuclear DNA markers. Usage of molecular biology techniques in wildlife material
investigation is found more reliable than the older techniques like anatomical
landmark-based identification, morphological characterization, microscopic
features, and serological markers. In wildlife forensics, the DNA-based methods
were utilized and found to be a more reliable technique for species identification,
which includes random amplified polymorphic DNA (RAPD), restriction fragment
length polymorphism (RFLP), amplified fragment length polymorphism (AFLP),
PCR amplification, usage of species-specific DNA markers, and DNA sequencing.
30 Wildlife Forensics 469

These DNA markers not only limit species identification but can be found useful to
relationship identity between different and common species.

30.4.3.1 Mitochondrial DNA

Mitochondrial DNA (mtDNA) is often used in wildlife forensics due to its high copy
number, making it easier to detect and analyze than nuclear DNA. mtDNA is also
useful in species identification as it is maternally inherited and evolves more quickly
than nuclear DNA, allowing for distinct differences between species to be identified.
In wildlife forensics, mtDNA analysis is often used to identify the species of an
unknown sample, to match an individual animal to a population, or to trace the origin
of a product made from animal parts (such as ivory or fur). However, mtDNA
analysis restricts to wildlife forensics, such as the possibility of homoplasy (similar
mtDNA sequences in different species) and the need for reference databases for
comparison. Ideally, mtDNA typing in wildlife forensics is commonly applied due
to the regular usage in molecular taxonomy and phylogenetic analysis for species
identification, the availability of universal primers, and due to the highly degraded
samples identification in wildlife encounter (Johnson et al. 2014). Comparatively,
the nuclear marker has a low amplification and success against the mtDNA, which is
not much precisely used as in wildlife material identification (Tobe and Linacre
2008). Other genes such as cytochrome b (cyt b) (Tobe and Linacre 2010), the
cytochrome oxidase 1 (CO1) (Ferri et al. 2009), two ribosomal RNA (Guha and
Kashyap 2006), and the control (D-loop) region (Pun et al. 2009) are the highly
influenced mitochondrial loci preferred in taxonomic identification and phylogenetic
analysis in wildlife forensics. Some highly specific mitochondrial 12S (Balitzki-
Korte et al. 2005; Melton and Holland 2007) and 16S ribosomal RNA loci (rRNA)
(Mitani et al. 2009) markers are also found to be highly utilized for wildlife species
identification. DNA barcoding is widely used and considered one of the most useful
tools in wildlife forensics for the identification of different species including cooked
and processed materials (Ferri et al. 2009). Mitochondrial region-specific cyto-
chrome C oxidase (CO1) is referred to as the barcoding region sequence for different
species of animal identifications (Fig. 30.2) (Dawnay et al. 2007).

30.4.3.2 Single-Nucleotide Polymorphisms (SNP)

Single-nucleotide polymorphisms (SNPs) are genetic variations in which a single-
nucleotide (A, T, C, or G) in the DNA sequence differs between individuals. In
wildlife forensics, SNPs can be used as genetic markers to establish the identity of an
individual animal and determine its relatedness to other individuals within a popula-
tion (Ogden 2011). SNPs have several advantages over other types of genetic
markers, such as microsatellites or minisatellites, in wildlife forensics. They are
abundant in the genome, allowing for the simultaneous analysis of many markers in
a single reaction. They are also highly informative, providing high discrimination
power for individual identification and population structure analysis (Martinsohn
and Ogden 2009). SNPs can be used in various wildlife forensics applications, such
as tracking the movement of animals, investigating wildlife crimes, and determining
the relatedness of individuals within a population. They are also useful for
470 A. R. Isukapatla et al.

Chital

at
Go
o
rG
ho
r ark
ba M
m
Sa

Red Deer
Wild Goat
0.010

o
fal
Bu
n
so
Bi
i
Nilga
Cow

Fig. 30.2 Maximum-likelihood tree based on a short sequence of 16S rRNA. Cluster 1: cow and
bison, Cluster 2: nilgai and buffalo, Cluster 3: wild goat, markhor goat, and goat, Cluster 4: red deer,
sambhar, and chital

population genetics studies, as they can provide information on the genetic diversity,
structure, and demographic history of a population (Sobrino et al. 2005). The use of
SNPs in wildlife forensics has been applied to a wide range of species, including
mammals, birds, fish, and reptiles, and has become an important tool in the fight
against wildlife trafficking and illegal trade, as well as in conservation biology and
management.

30.4.3.3 Cytochrome c Oxidase and Cytochrome b

Cytochrome c oxidase subunit 1 (CO1) is a gene that is commonly used in wildlife
forensics. It encodes for a subunit of the cytochrome c oxidase complex, which is
involved in cellular respiration. The CO1 gene is often used as a DNA barcode in
species identification and has become a standard marker in forensic investigations of
wildlife species (Stock et al. 2009), especially in cases of illegal trade and poaching.
The high genetic variability of the CO1 gene across species, combined with the ease
of DNA extraction and amplification, makes it a valuable tool for species identifica-
tion and differentiation. Cytochrome b (cyt b) is another gene that is commonly used
in wildlife forensics for species identification and differentiation. Cyt b is a
30 Wildlife Forensics 471

mitochondrial gene that encodes for a protein involved in cellular respiration. It is

often used in combination with other genetic markers, such as CO1 and the ribo-
somal RNA genes, to confirm species identification. The cyt b gene is highly
conserved within a species but varies enough between species to be used as a genetic
marker. The high degree of variability of the cyt b gene makes it a valuable tool in
forensic investigations of wildlife species, especially in cases of illegal trade and
poaching.

30.4.3.4 12S and 16S Ribosomal RNA

The 12S ribosomal RNA (12S rRNA) gene is another marker that is commonly used
in wildlife forensics. Like the CO1 gene, it is useful for species identification and
differentiation. The 12S rRNA gene is a component of the ribosome and is highly
conserved within a species (Janczewski et al. 1995), but varies enough between
species to be used as a genetic marker. It is especially useful in forensic
investigations involving the identification of animal products and derivatives, such
as meat, leather, and traditional medicines. The 12S rRNA gene is also used in
phylogenetic studies to infer evolutionary relationships among species. The 16S
ribosomal RNA (16S rRNA) gene is also used in wildlife forensics, particularly in
species identification and differentiation. It is a component of the ribosome and, like
the 12S rRNA gene, is highly conserved within a species but varies enough between
species to be used as a genetic marker. The 16S rRNA gene is widely used in
microbial ecology and has been applied to various wildlife forensic investigations
(Jogayya et al. 2013), including the identification of bacteria in food and other
animal-derived products. In addition to species identification, the 16S rRNA gene
is also used in phylogenetic studies to infer evolutionary relationships among species
(Kitano et al. 2007) and to infer the taxonomic classification of microorganisms.

30.4.3.5 D-Loop Region

The D-loop region is a non-coding region of the mitochondrial DNA (mtDNA) that
is commonly used in wildlife forensics for species identification and differentiation.
The D-loop region is highly variable between species and is commonly used in
conjunction with other mtDNA markers (Saccone et al. 1987), such as cytochrome b,
to increase the power of species identification. The D-loop region is often used in
forensic investigations of wildlife species, especially in cases of illegal trade and
poaching, due to the high degree of variability (Brown et al. 1986) and the ease of
DNA extraction and amplification from a variety of sample types. Additionally, the
D-loop region is useful in phylogenetic studies to infer evolutionary relationships
among species and in population genetic studies to infer patterns of genetic diversity
and structure within and among species.

30.4.3.6 Microsatellites or Short Tandem Repeats (STRs)

Microsatellites are DNA sequences that repeat a small number of times within a
genome and vary greatly between individuals. In wildlife forensics, microsatellites
are used as genetic markers to establish the identity of an individual animal and
determine its relatedness to other individuals within a population. Microsatellites are
472 A. R. Isukapatla et al.

useful in wildlife forensics because they are highly variable, allowing for the creation
of unique DNA fingerprints for individual animals. This can be useful in tracking the
movements of animals, investigating wildlife crimes, and determining the related-
ness of individuals within a population. In wildlife forensics, STRs are used to
identify individuals within a species. This is accomplished by analyzing the number
of repeats at specific loci (known as “markers”) across the genome. Because STRs
are highly variable between individuals, even within the same species, they can be
used to distinguish between individuals (Poetsch et al. 2001) and track the move-
ment of wildlife or wildlife products. STR analysis is widely used in forensic
investigations, including cases of illegal trade, poaching, and poaching of protected
or endangered species (Hoff-Olsen et al. 2001). STR analysis can also be used to
track the movement of wildlife products, such as meat, leather, and traditional
medicines, to help enforce wildlife protection laws. Microsatellites are also useful
for population genetics studies, as they can provide information on the genetic
diversity, structure, and demographic history of a population. The use of
microsatellites in wildlife forensics has been applied to a wide range of species,
including mammals, birds, fish, and reptiles. It has become an important tool in the
fight against wildlife trafficking and illegal trade, as well as in conservation biology
and management. Microsatellites have been widely adopted as the preferred genetic
markers for individual identification in many species and are widely used in wildlife
forensics worldwide.

30.4.3.7 Minisatellites or Variable Number of Tandem Repeats (VNTRs)

Minisatellites also known as variable number of tandem repeats (VNTRs) are DNA
sequences that repeat many times within a genome and vary greatly between
individuals. They are useful in wildlife forensics as they provide a unique DNA
fingerprint for each animal, which can be used to identify specific individuals, track
their movements, and establish their relatedness to other animals. Animal samples in
criminal cases rarely include substantially undamaged nuclear DNA, which is
essential for VNTR analysis (Ogden et al. 2009). Minisatellites are particularly
useful in species determination where traditional DNA markers, such as
microsatellites, are not informative enough for individual identification (Kashyap
et al. 2004). Minisatellites have been applied in a variety of species, including fish,
birds, mammals, and reptiles, and have become an important tool in the fight against
wildlife trafficking and illegal trade. The use of minisatellites in wildlife forensics
can provide valuable information on population structure and diversity, which is
important for conservation biology and management.

30.4.3.8 Messenger RNA

Messenger RNA (mRNA) is a type of RNA molecule that plays a key role in the
expression of genes. In wildlife forensics, mRNA analysis can be used to determine
the presence of specific genes in a sample and to gain insight into the biological
processes occurring within an animal. One common application of mRNA analysis
in wildlife forensics is the identification of species. By analyzing the mRNA
expression patterns of specific genes, researchers can determine the species of an
30 Wildlife Forensics 473

animal based on its genetic signature. This approach can be particularly useful when
traditional DNA-based methods are not feasible, such as when working with
degraded or low-quality DNA samples. In addition to species identification,
mRNA analysis can also be used to study the effects of environmental factors on
wildlife populations, such as exposure to pollutants or changes in habitat quality. By
analyzing mRNA expression patterns, researchers can determine the impact of these
factors on the biology of wildlife species, providing valuable information for
conservation and management efforts.

30.4.3.9 DNA Barcoding

DNA barcoding is a method used in wildlife forensics to identify species based on a
short, standardized segment of DNA. This technique has become increasingly
popular in recent years for its accuracy, speed, and cost-effectiveness in species
identification. By comparing the DNA sequences obtained from a sample with a
reference database of known species, it is possible to determine the identity of an
animal, even from small or degraded samples. DNA barcoding has been applied in
various wildlife forensic applications, such as solving wildlife crimes, monitoring
illegal trade, and supporting conservation efforts. The most commonly used DNA
barcoding segment in wildlife forensics is the mitochondrial cytochrome c oxidase
subunit I (COI) gene (Vences et al. 2005). The COI gene provides a fast, reliable,
and cost-effective way to identify species, as it is highly conserved within species
but divergent between species. This makes it an ideal barcode for species identifica-
tion and has been adopted by the Barcode of Life Data System (BOLD) as the
reference barcode for animals. Additionally, other DNA barcoding segments, such
as the ribosomal internal transcribed spacer (ITS) region, have also been used in
wildlife forensics, but COI remains the most widely used and accepted barcode in
the field.

30.5 Conclusion

Wildlife forensics is a field that uses scientific methods to investigate crimes against
wildlife, including poaching, trading, and hunting of endangered species. It involves
collecting, analyzing, and interpreting physical pieces of evidence from wildlife
crime scenes to help enforce wildlife protection laws and regulation. The ultimate
goal of wildlife forensics is to protect and conserve wildlife populations and to bring
those responsible for illegal activities to justice.

References
Ahmed YA, Ali S, Ghallab A (2018) Hair histology as a tool for forensic identification of some
domestic animal species. EXCLI J 17:663
Balitzki-Korte B, Anslinger K, Bartsch C, Rolf B (2005) Species identification by means of
pyrosequencing the mitochondrial 12S rRNA gene. Int J Legal Med 119(5):291–294
474 A. R. Isukapatla et al.

Bell B, Machin S (2011) The impact of migration on crime and victimisation. UK Government,
London
Boner M, Förstel H (2004) Stable isotope variation as a tool to trace the authenticity of beef. Anal
Bioanal Chem 378(2):301–310
Bowen GJ, Wassenaar LI, Hobson KA (2005) Global application of stable hydrogen and oxygen
isotopes to wildlife forensics. Oecologia 143(3):337–348
Brown G, Gadaleta G, Pepe G, Saccone C, Sbisà E (1986) Structural conservation and variation in
the D-loop-containing region of vertebrate mitochondrial DNA. J Mol Biol 192:503–511
Chamberlain CP, Blum JD, Holmes RT, Feng X, Sherry TW, Graves GR (1996) The use of isotope
tracers for identifying populations of migratory birds. Oecologia 109(1):132–141
Chapman DD, Abercrombie DL, Douady CJ, Pikitch EK, Stanhopen MJ et al (2003) A streamlined,
bi-organelle, multiplex PCR approach to species identification: application to global conserva-
tion and trade monitoring of the great white shark, Carcharodon carcharias. Conserv Genet 4:
415–425
Chernova OF (2014) Scanning electron microscopy of the hair medulla of orangutan, chimpanzee,
and man. Dokl Biol Sci 456(1):199
Coghlan ML, White NE, Parkinson L, Haile J, Spencer PB, Bunce M (2012) Egg forensics: an
appraisal of DNA sequencing to assist in species identification of illegally smuggled eggs. Foren
Sci Int Genet 6(2):268–273
Cooper JE, Cooper ME (2008) Introduction to veterinary and comparative forensic medicine.
Blackwell, Oxford
Dawnay N, Ogden R, McEwing R, Carvalho GR, Thorpe RS (2007) Validation of the barcoding
gene COI for use in forensic genetic species identification. Forensic Sci Int 173:1–6
Dove CJ, Koch SL (2011) Microscopy of feathers: a practical guide for forensic feather identifica-
tion. Microscope 59(2):51
Ferri G, Alu M, Corradini B, Licata M, Beduschi G (2009) Species identification through DNA
“barcodes”. Genet Test Mol Biomark 13(3):421–426
Fortajada EB, Fontanilla IKC, De Ungria MCA (2021) Incorporating animal forensics in routine
meat inspection in the Philippines. Foren Sci Int Anim Environ 1:100020
Gouda S, Kerry RG, Das A, Chauhan NS (2020) Wildlife forensics: a boon for species identification
and conservation implications. Forensic Sci Int 317:110530
Guha S, Kashyap VK (2006) Molecular identification of lizard by RAPD & FINS of mitochondrial
16s rRNA gene. Legal Med 8(1):5–10
Hobson KA, Wassenaar LI (1996) Linking breeding and wintering grounds of neotropical migrant
songbirds using stable hydrogen isotopic analysis of feathers. Oecologia 109(1):142–148
Hoff-Olsen P, Jacobsen S, Mevag B et al (2001) Microsatellite stability in human post-mortem
tissues. Forensic Sci Int 119:273–278
Hsieh HM, Huang LH, Tsai LC, Kuo YC, Meng HH et al (2003) Species identification of
rhinoceros horns using the cytochrome b gene. Forensic Sci Int 136:1–11
Janczewski DN, Modi WS, Stephens JC, O’Brain SJ (1995) Molecular evaluation of mitochondrial
12S RNA and cytochrome b sequences in the Pantherine lineage of Felidae. Mol Biol Evol 12:
690–707
Jogayya KN, Meganathan PR, Dubey B, Haque I (2013) Mitochondrial 16S ribosomal RNA gene
for forensic identification of crocodile species. J Forensic Legal Med 20:334–338
Johnson RN, Wilson-Wilde L, Linacre A (2014) Current and future directions of DNA in wildlife
forensic science. Foren Sci Int Genet 10:1–11
Kashyap VK, Sitalaximi T, Chattopadhyay P et al (2004) DNA profiling techniques in forensic
analysis. Int J Hum Genet 4:11–30
Kitano T, Umetsu K, Tian W, Osawa M (2007) Two universal primer sets for species identification
among vertebrates. Int J Legal Med 121:423–427
Kitpipit T, Thanakiatkrai P, Penchart K, Ouithavon K, Satasook C, Linacre A (2016) Ivory species
identification using electrophoresis-based techniques. Electrophoresis 37(23–24):3068–3075
30 Wildlife Forensics 475

Kumar R, Singh PJ, Nagpure NS, Kushwaha B, Srivastava SK et al (2007) A non-invasive

technique for rapid extraction of DNA from fish scales. Indian J Exp Biol 45:992–997
Lawton MPC, Cooper JE (2009) Wildlife crime scene visits. Appl Herpetol 6:29–45
Linacre A, Ciavaglia SA (2017) Wildlife forensic science. In: Handbook of forensic genetics:
biodiversity and heredity in civil and criminal investigation. World Scientific Publishing,
Singapore, pp 449–471
Linacre A, Tobe SS (2011) An overview to the investigative approach to species testing in wildlife
forensic science. Investig Genet 2(1):1–9
Martinsohn JT, Ogden R (2009) Fishpoptrace: developing Snp-based population genetic assign-
ment methods to investigate illegal fishing. Foren Sci Int Genet 2:294–296
Melton T, Holland C (2007) Routine forensic use of the mitochondrial 12S ribosomal RNA gene for
species identification. J Forensic Sci 52(6):1305–1307
Mitani T, Akane A, Tokiyasu T, Yoshimura S, Okii Y, Yoshida M (2009) Identification of animal
species using the partial sequences in the mitochondrial 16S rRNA gene. Leg Med 11(Suppl 1):
S449–S450
Ogden R (2011) Unlocking the potential of genomic technologies for wildlife forensics. Mol Ecol
Resour 11(Suppl. 1):109–116
Ogden LJE, Hobson KA, Lank DB (2004) Blood isotopic (δ13C and δ15N) turnover and diet-tissue
fractionation factors in captive Dunlin (Calidris alpina pacifica). Auk 121(1):170–177
Ogden R, Dawnay N, McEwing R (2009) Wildlife DNA forensics: bridging the gap between
conservation genetics and law enforcement. Endanger Species Res 9:179–195
Poetsch M, Seefeldt S, Maschke M et al (2001) Analysis of microsatellite polymorphism in red
deer, roe deer, and fallow deer – possible employment in forensic applications. Forensic Sci Int
116:1–8
Pun KM, Albrecht C, Castella V, Fumagalli L (2009) Species identification in mammals from
mixed biological samples based on mitochondrial DNA control region length polymorphism.
Electrophoresis 30(6):1008–1014
Renou J-P, Deponge C, Gachon P, Bonnefoy J-C, Coulon J-B, Garel J-P, Vérité R, Ritz P (2004)
Characterization of animal products according to geographic origin and feeding diet using
nuclear magnetic resonance and isotope ratio mass spectrometry: cow milk. Food Chem
85(1):63–66
Saccone C, Attimonelli MA, Sbisà E (1987) Structural elements highly preserved during the
evolution of the D-Loop containing region in vertebrate mitochondrial DNA. J Mol Evol 26:
205–211
Sahajpal V, Goyal SP (2009) Microscopic examinations in wildlife investigations. In: Forensic
science in wildlife investigations. CRC Press, Boca Raton, FL, pp 33–74
Sahajpal V, Goyal SP, Raza R, Jayapal R (2009) Identification of mongoose (genus: Herpestes)
species from hair through band pattern studies using discriminate functional analysis (DFA) and
microscopic examination. Sci Justice 49:205–209
Schneider JL (2008) Reducing the illicit trade in endangered wildlife: the market reduction
approach. J Contemp Crim Justice 24:274
Sobrino B, Brion M, Carracedo A (2005) SNPs in forensic genetics: a review on SNP typing
methodologies. Forensic Sci Int 154:181–194
Sreepada RA, Desai UM, Naik S (2002) The plight of Indian sea horses: need for conservation and
management. Indian Acad Sci 82:377–378
Stock F, Edwards CJ, Bollongino R, Finlay EK, Burger J et al (2009) Cytochrome b sequences of
ancient cattle and wild ox support phylogenetic complexity in the ancient and modern bovine
populations. Anim Genet 40:694–700
Tobe SSS (2009) Determining the geographic origin of animal samples. In: Forensic science in
wildlife investigations. CRC Press, Boca Raton, FL, pp 141–170
Tobe SS, Linacre AM (2008) A technique for the quantification of human and non-human
mammalian mitochondrial DNA copy number in forensic and other mixtures. Foren Sci Int
Genet 2(4):249–256
476 A. R. Isukapatla et al.

Tobe SS, Linacre A (2010) DNA typing in wildlife crime: recent developments in species identifi-
cation. Foren Sci Med Pathol 6:195–206
Vences M, Thomas M, van der Meijden A, Chiari Y, Vieites DR (2005) Comparative performance
of the 16S rRNA gene in DNA barcoding of amphibians. Front Zool 2:1–12
Yadav P, Kumar A, Sahoo S, Yadav N, Hussain SA, Gupta SK (2021) Identification of Gangetic
turtles based on species-specific variations on mitochondrial cyt b and nuclear Cmos genes.
Foren Sci Int Anim Environ 1:100035
Evidence and Identification
31
Rahul Ravindra Darunde, Hansi Bansal, and Avinash Puri

Abstract

A relatively recent area of criminal investigation is wildlife forensics. Its

objectives are to correlate the evidence from crime scenes to a suspect and a
victim, in this case, an animal, by using scientific methods to inspect, classify, and
compare the evidence from crime scenes. It is the application of different
techniques of forensic science to investigate crimes related to wild animals,
including poaching, illegal trade in wildlife products, and other wildlife-related
crimes, to identify the species, origin, and history of the evidence, and to link it to
the crime scene or suspects. Poaching, often known as killing wild creatures
legally exempt from hunting, is one of the most serious offenses that wildlife
forensic specialists look into. The use of wildlife forensics in criminal
investigations has proven to be a quick, accurate, and dependable method with
comprehensive coverage and simple accessibility. The resolution of taxonomic
conflicts, the identification of spatiotemporal genetic divergence, the study of
evolutionary history, origins, and even endemism have all benefited from it.

Keywords
Endangered · Habitats · Climate · Genetic divergence · Wildlife trade

R. R. Darunde
Department of Forensic Science, Medi-Caps University, Indore, India
H. Bansal
Department of Forensic Science, Government Institute of Forensic Science, Nagpur, India
A. Puri (✉)
Department of DNA and Forensic Biology, Regional Forensic Science Laboratory, Indore, Madhya
Pradesh, India

# The Author(s), under exclusive license to Springer Nature Singapore Pte 477
Ltd. 2024
A. Puri et al. (eds.), Fundamentals of Forensic Biology,
https://doi.org/10.1007/978-981-99-3161-3_31
478 R. R. Darunde et al.

31.1 Wildlife Forensics

Wildlife forensic science has emerged as a crucial tool for implementing laws about
the illegal trade of endangered and protected animals. The illegal wildlife trade is
responsible for the exploitation of several animal and plant species and the destruc-
tion of habitats (Ogden and Linacre 2015). The introduction of exotic species,
climate change, soil degradation, and ecological imbalance are all made more
accessible by the illegal wildlife trade. The commerce in wildlife is not a recent
development; it has existed for many centuries. Ivory was employed in ancient
European cultures for tools and jewelry. Due to their quest for ivory, the Romans
decimated the elephant herds in northern Africa and Asia Minor (Keskin et al. 2022).
The illegal taking, trading, exploiting, possessing, or killing of animals or plants in
violation of local, national, or international regulations is known as wildlife crime.
The recent increase in wildlife crime, especially wildlife trafficking, poses a severe
threat to the environment, local and national economy, public health, security, and
even the criminal justice system (Kurland et al. 2017). Although forensic analysis
has long been used in wildlife law enforcement, interest in the field has grown
significantly during the past 10 years (Linacre et al. 2011).
Identification of the species of origin of carcasses is necessary in forensic cases
(Dalton and Kotze 2011). DNA profiling, toxicology, animal pathology, ballistics,
and fiber analysis are a few analytical techniques used to investigate crimes against
wildlife under the umbrella term “wildlife forensics” (Huffman and Wallace 2012).
Recognizing the species represented in the evidence is a crucial first step in any
inquiry into a wildlife crime. While certain species are strictly protected and can face
severe fines for being killed or traded commercially, others have no legal protection.
As a result, establishing a taxonomic identity is necessary to evaluate whether a
wildlife crime has been committed (Trail 2021). Morphological or DNA investiga-
tion often uses wildlife evidence to identify the species present. Using physical
characteristics found in the data, such as avian feather patterns, mammalian denti-
tion, or reptilian scale counts, trained and competency-tested professionals identify
species (Lyman 2019). After illicit drug sales and the sale of firearms, the wildlife
trade is the third-largest illegal enterprise in the world. While animal carcasses are
easily identified at the species level, wildlife artifacts are stripped of identifying traits
at their crime scenes, making identifying both legally and criminally trafficked
wildlife species and objects challenging for wildlife forensic experts (Sahajpal
et al. 2009).

31.2 Physical Evidence

Any object, material, or physical entity connecting the victim, suspect, and the crime
scene is considered physical evidence. The hardest part of processing a crime scene
is identifying the evidence, gathering it, and keeping it safe so that it can be
examined further in a laboratory. A forensic laboratory veterinary pathologist will
often collect the carcass and identify the cause of death. Once an item of evidence is
31 Evidence and Identification 479

identified for collection, a placard with a unique number is set up next to it. Prior to
collection, evidence is then photographed and mapped (Linacre 2009). Some of the
commonly found physical evidence in wildlife crime scenes is as follows.

31.2.1 Hair

An essential part of species identification at a crime scene is looking at the hair of the
animals. The root and shaft of the hair can be distinguished. The guard hairs found
on most mammal species flatten (shield) at the distal end (away from the skin). Some
species have guard or fur hairs that appear zigzagged. When creating a reference
checklist and looking through unidentified samples, these general forms or profiles
should be carefully noted because they aid in focusing the research on the most likely
family, genus, or species (Linacre 2009). The guard hair, one of the four primary
types of hair identified in mammals, is crucial for determining an animal’s species
(Knecht 2012). For the characterization of different traits, it is strongly advised to
examine the hair shaft, including its medulla (internal center), cortex (transitional
layer), and cuticle (outer covering), using proper magnifying tools such as com-
pound microscopes or scanning electron microscopes (Bell 2011; Ahmed et al.
2018).

31.2.2 Claw

A claw is a pointed, curved nail or talon that can be seen on the feet of several
animals, including cats, birds, and lobsters. Hunting, self-defense, and gripping or
holding onto objects are the usual uses of claws. Keratin is used to make claws in
mammals. Some animals, like cats, can extend or retract their retractable claws at
will. In many cultures and legends, the use of claws as a symbol of strength or fury is
also every day. A clear indication of poaching for the illicit sale of the taken items is
the discovery in a conservation area of the carcass of a protected animal whose claws
had been removed (Huffman and Wallace 2012). A stereo microscope can be used to
investigate the surface morphology of a claw at low magnification (Linacre et al.
2011).

31.2.3 Ivory

Elephant ivory and other skeletal artifacts are increasingly traded illegally because
they are valued as ornamental objects. African elephants (Loxodonta cyclotis and
L. africana) and Asian elephants (Elephas maximus) are currently in danger, and the
ivory trade is the primary cause (Lee et al. 2013). Dentine is a material that includes
ivory, resembling bones (Espinoza and Mann 1992). Ivory has a distinctive
microstructural characteristic known as the Schreger patterns, which have measured
and identifiable angles. All three varieties of elephants, including mammoths, exhibit
480 R. R. Darunde et al.

a distinct variance in the mean angles of the Schreger pattern. It might serve as a
criterion for separating various types of ivory. Identifying and separating ivory from
horn, hoof, and shells using FTIR and Raman’s spectroscopy based on their band
patterns at different wavelengths is depicted through studies (Singh et al. 2006).
Ivories and other artifacts can be used to date using FTIR and Raman’s spectroscopy
(Espinoza and Mann 1993).

31.2.4 Bones

Hunters and poachers keep bones, horns, or hooves as trophies and decorative
things. As they are curled for use as ornaments, statues, and altered artifacts,
bones are also referred to as “poor man’s ivory.” Joints, general size and shape,
dentition, ligament insertion, and other characteristics of bones that identify species’
characteristics are typically used to identify bones. Since most species have distinc-
tive dental structures, the likelihood of correct identification is significantly
increased by the presence of dental structures (Sims et al. 2011). Zooarchaeology
commonly establishes the identity of animals through their remains or fossil
materials and bone pieces. Other characteristics used to identify mammal bones
include vascular tissues, tiny nutrition canals, and gritty particles inside the bone
matrix (Espinoza and Mann 1992). Bones can be used to identify morphological
species. However, doing so can be difficult because the bones’ diagnostic features
are subject to aging, and the origin of the species is unclear (Sims et al. 2011).
Recently, the bones of lions and tigers were separated using morphological identities
and a quick real-time PCR approach (Dalton et al. 2020).

31.2.5 Mitochondrial DNA

Molecular markers are collections of DNA sequences with known chromosomal

locations whose inheritance can be tracked for genetic diversity or DNA typing
(Kumar et al. 2018; Coghlan et al. 2012; Green et al. 2019; Nishant et al. 2017; Mosa
et al. 2019). Mitochondrial markers and nuclear markers are the two primary markers
utilized in wildlife forensic science (Mitra et al. 2018; Jan and Fumagalli 2016).
Mitochondrial DNA (mtDNA) is a collection of genetic materials that are genetically
conserved and located in the mitochondria of the cell. Taxonomic, phylogenetic,
forensic, and conservation organizations have joined forces to develop an advanced,
reliable, and reasonably priced DNA sequencing method to eliminate these
restrictions and tie up loose ends (Green et al. 2019). It has several uses in phyloge-
netic investigations (Kumar et al. 2020; Toren et al. 2016). In the process, incom-
plete data for 29 non-chordate species were found, along with several other things
(Boore 1999). The National Centre for Biotechnology Informatics (NCBI) most
recently made 9034 genome sequences available out of the 10,249 animal mitochon-
drial genomes (Zhou et al. 2020). For efficient profiling of wild species, mitochon-
drial DNA markers such as cytochrome b (Cyt b), cytochrome c oxidase subunit I, II,
31 Evidence and Identification 481

and III (COI), ATP synthase 6 (ATP6), NADH dehydrogenase 3 (ND3), NADH
dehydrogenase 4 (ND4), NADH-ubiquinone oxidoreductase chain 4 L (ND4 L)
gene, 16S, 12S rRNA, tRNAs, and the control region (D-loop) are used (Mitra et al.
2018; Detwiler 2019; Abbas et al. 2020). COI is the most often used mtDNA marker
overall due to its benefits, including its small size, wide variety, ready-to-use
universal primers, and durability (De Mandal et al. 2014; Linacre et al. 2011).

31.2.6 Nuclear DNA

Short tandem repeat (STR) profiles of nuclear DNA based on an animal species are
primarily used in using nuclear DNA markers in individual identification. Especially
for domesticated mammals, using the short tandem repeat (STR) locus is a good tool
for determining samples’ levels (Linacre et al. 2011). Amplified fragment length
polymorphism (AFLP), random amplified polymorphic DNA (RAPD), and short
sequence repeats (SSRs) or microsatellites are a few of the regularly employed
nuclear markers (Mitra et al. 2018). Markers like RAPD and AFLP stand out from
the competition because they can identify and distinguish between various animal
species without requiring prior molecular knowledge (Arif et al. 2011). The most
often utilized nuclear DNA markers are microsatellites. With bi-allele or multi-allele
representing an individual or a population, respectively, microsatellites are
co-dominant markers. These genetic markers are polymorphic and highly adaptable
for molecular fingerprinting since they are simple to amplify using PCR (Arif et al.
2011; Arif and Khan 2009).

31.2.7 Firearms and Ammunition

During the postmortem examination, it is essential to remove the pellets or bullets

from the carcass in cases where firearms were used to determine the type of firearms
used. To identify the firearm used, pellets or bullets should be delivered to the
Forensic Laboratory for the Ballistic expert’s analysis. If someone is suspected of
shooting an animal, it is advised to wash their hands and check their fingers for any
gunshot residue. Along with the ballistics examination report and fingerprints, this is
crucial evidence to prove that the accused shot (Negi 2013; Warlow 2004).

31.2.8 Digital Devices

The accused/suspect’s mobile phone devices should be checked for stored phone
numbers, and a list of those numbers should be made. The laptops and computers
should also be checked for information like a map and other facts about pertinent
topics like information on sanctuaries or national parks, and email files of the
agreements. A laptop should only be used in public with witnesses present. The
suspect/accused should be questioned regarding passwords used to access email
482 R. R. Darunde et al.

accounts, computers, etc. The devices should be promptly turned off after inspection,
and their battery should be removed. These devices are required to be seized for
expert examination (Negi 2013).

31.2.9 Hoof Marks

The hoof is the protective outer covering of the foot of certain animals, such as
horses, cattle, deer, pigs, and many other mammals. Hooves are made of keratin, the
same substance that makes up human nails and hair. In wildlife forensic
investigations, hooves can identify the animal species from which a sample came
and provide information about the animal’s age, sex, and habitat. In addition, the
analysis of hooves can be used to identify the cause of death, such as starvation,
disease, or trauma (Edwards et al. 1998).

31.3 Analysis of Wildlife Evidence

Analyzing wildlife forensic evidence is crucial in investigating and prosecuting

wildlife crimes. Some of the fundamental techniques used in the analysis of wildlife
forensic evidence include the following.

31.3.1 Isotope Analysis

Isotope analysis is used to study the ecology and biology of wild animals, including
their diet, migration patterns, and habitat use. The technique involves analyzing the
isotopes, or different forms, of elements found in an animal’s tissue, such as its
bones, hair, or feathers. Isotope analysis is non-destructive and is applied to many
species and samples, making it a valuable tool for wildlife conservation and man-
agement. It is used to study the population dynamics, habitat use, diet, and migration
patterns of wild animals, which can help conservationists better understand and
protect wildlife (Bowen et al. 2005).

31.3.2 DNA Analysis

DNA analysis typically involves extracting DNA from a sample, amplifying a

specific region of the DNA using polymerase chain reaction (PCR), and then
analyzing the amplified DNA using techniques such as gel electrophoresis, capillary
electrophoresis, or DNA sequencing. Mitochondrial DNA is abundant in cells, easy
to extract, and has a high degree of variation among different species, making it an
ideal target for PCR amplification and DNA sequencing. STRs are highly variable
among individuals and populations and can be used to track the movement of illegal
products. DNA analysis can be used to identify the species of origin of an illegal
31 Evidence and Identification 483

product, such as ivory, meat, or fur. It can also be used to determine the animal’s or
plant’s geographical origin, which can help investigators identify the source of the
illegal trade. The validity of the DNA analysis results depends on the DNA sample’s
quality and quantity, the choice of DNA markers, and the accuracy of the PCR
amplification and DNA sequencing methods (Lorenzini 2005; Kanokwongnuwut
et al. 2020).

31.3.3 Entomological Analysis

Entomological analysis in wildlife forensics involves the study of insects, particu-

larly their life cycles and stages, to determine the time of death, or the postmortem
interval, in human or animal death investigations. It can be used in wildlife crime
investigations, such as illegal hunting or poaching, to help establish the time of death
of an animal and also to provide information about the location where the animal was
killed (Byrd and Tomberlin 2019).

31.3.4 Microscopy

Microscopic analysis in wildlife forensics involves the examination of small samples

or particles using a microscope to identify the species or origin of the sample. This
can include analyzing hair, feathers, scales, bones, and other biological materials.
Different microscopes are commonly used in wildlife forensic investigations, includ-
ing light, fluorescence, transmission electron, scanning electron, and Fourier trans-
form infrared microscopes. Light microscopy examines hair, feathers, scales, and
other small samples. Fluorescence microscopy uses fluorescent dyes to highlight
certain features of a sample, such as specific types of cells or proteins. It is used to
examine hair, feathers, and other small samples. Transmission electron microscopy
(TEM) examines small samples, such as bone, teeth, or scales. Scanning electron
microscopy (SEM) is used to examine small samples, such as hair, feathers, and
scales, and provide detailed information about the surface features of the sample.
Fourier transform infrared spectroscopy (FTIR) is used to identify the species of
animal from which a sample came and to detect the presence of certain chemicals or
substances that may be used in wildlife crime (Edwards et al. 1998; Gouda et al.
2020).

31.3.5 Chromatography

Chromatography is an instrumental technique used to separate and analyze different

components of a mixture. In wildlife forensics, various types of chromatography can
be used to analyze samples from wildlife crime scenes, such as blood, tissue,
feathers, or other organic materials. Gas chromatography (GC) and liquid chroma-
tography (LC) are two commonly used types of chromatography in wildlife
484 R. R. Darunde et al.

forensics. GC is used to separate and analyze volatile compounds, such as pesticides

or pollutants, while LC is used to separate and analyze non-volatile compounds,
such as drugs or toxins. Other types of chromatography that are used in wildlife
forensics include high-performance liquid chromatography (HPLC), ion chromatog-
raphy (IC), and size exclusion chromatography (SEC). Gas chromatography–mass
spectrometry (GC-MS) and liquid chromatography–mass spectrometry (LC-MS) are
powerful tools for identifying and quantifying illegal drugs, pesticides, and other
chemicals in wildlife samples (Bell 2011; Gouda et al. 2020).

31.3.6 Computer Forensics

Computer forensics in wildlife refers to using digital forensic techniques to investi-

gate crimes and other illegal activities related to wildlife. It includes the analysis of
computers, smartphones, and other digital devices that may contain evidence of
illegal hunting, poaching, or wildlife trafficking. Forensic examiners use various
techniques to extract data from digital devices, such as disk imaging, file carving,
and keyword searching. They also use specialized software to analyze the data, such
as GPS mapping tools to track the movement of poachers or social media analysis
tools to identify networks of wildlife traffickers. It can also be used in wildlife
conservation, for example, to prevent illegal logging and trade of wildlife and study
the wildlife population for conservation (Negi 2013).

31.3.7 Ballistic Analysis

Ballistic analysis can be used in wildlife crime investigations, such as illegal hunting
or poaching, to help establish a link between a suspect and a crime. Ballistic analysis
in wildlife forensics involves the examination of firearms and ammunition to identify
the type of weapon used in a crime, as well as to determine the origin of the weapon
and to link it to specific crimes. Analysis of bullets involves comparing the
characteristics of bullets recovered from a crime scene to those fired from a specific
weapon to determine if the weapon was used in the crime. Bullet characteristics that
can be analyzed include the rifling marks, land and groove marks, and caliber.
Analysis of cartridge cases involves comparing the characteristics of firing pin
impressions, extractor marks, and ejector marks (Warlow 2004).

31.3.8 Toxicology

Toxicological analysis in wildlife forensics involves the examination of biological

samples, such as blood, tissue, or organs, to detect the presence of toxic substances
or pollutants. It detects many toxic substances, including pesticides, heavy metals,
and other pollutants. These substances can harm wildlife and are helpful as evidence
in criminal investigations. Toxicology analysis can also detect the presence of drugs,
31 Evidence and Identification 485

such as tranquilizers and opioids, which are used illegally to capture wildlife for
trade or other purposes (Everatt et al. 2019).

31.3.9 Geographical Information System (GIS)

GIS is a powerful tool that allows scientists to combine, analyze, and visualize
spatial data, such as maps, satellite imagery, and other data layers. GIS is used in
wildlife forensics to help identify the origin of an animal or its products, such as meat
or ivory. It is used to map the location of crime scenes, illegal hunting sites, and
routes of illegal trade and to identify patterns and trends in wildlife crime. One way
GIS can be used in wildlife forensics is to map the distribution of different animal
species and their isotopic signatures, which can help to identify the geographic origin
of illegally traded wildlife products, such as ivory or shark fins, and track down the
locations where the animals were poached (Bowen et al. 2005; Linacre and Ciavaglia
2017).

31.3.10 Radiocarbon Dating

Radiocarbon dating (carbon-14 dating) determines organic materials’ age. It

measures the amount of carbon-14, a radioactive isotope of carbon, present in a
sample. It is used to determine the age of an animal or plant, which can help to
identify illegal hunting methods or to track the illegal trade of certain species like
ivory. In wildlife forensics, radiocarbon dating is used to determine the age of animal
remains or other organic materials found at a crime scene. This information helps
solve wildlife-related crimes, such as poaching or illegal hunting (Uno et al. 2013;
Cerling et al. 2016).

31.3.11 3D Scanning

3D scanning in wildlife forensics involves using 3D scanning technologies, such as

laser scanning or structured light scanning, to create detailed 3D models of
biological samples, such as bones, teeth, or other body parts. These models can be
used to identify the species of animal from which the sample came, as well as to
identify specific individuals within a population. It can also create 3D models of
other body parts, such as footprints, tracks, or scats, to identify animal species and
study their behavior and ecology (Košinová et al. 2022).

31.3.12 Dental Analysis

In wildlife forensics, dental analysis is used to identify poached animals, study the
population dynamics and health of wildlife, and track the movement of animals.
486 R. R. Darunde et al.

Dental characteristics such as tooth shape, size, number, and wear patterns are used
to identify the species of an animal. Dental development and wear patterns can
determine the age of an animal. It can provide vital information for the conservation
and management of wildlife populations and criminal investigations related to
wildlife (Viciano et al. 2022).

31.3.13 Metabolomics

Metabolomics is a field of study that involves analyzing the complete set of small
molecules, known as metabolites, present in an organism. In wildlife forensics,
metabolomics can be used to study the metabolic profile of animals and provide
information on their diet, health, and exposure to pollutants or other environmental
factors. It is used to study the exposure of animals to pollutants or other environ-
mental factors. Metabolites can be used as biomarkers to detect exposure to
pollutants, such as pesticides or heavy metals, which can help detect illegal
activities, such as illegal hunting or wildlife trafficking (Luo et al. 2020).
It is imperative to note that not all of these techniques are suitable for all types of
evidence or all cases. The selection and use of these techniques should be based on
the case’s specific circumstances and the forensic analyst’s expertise.

31.4 Significance of Wildlife Forensics

Investigation and prosecution of wildlife crimes depend heavily on wildlife

forensics. Some of the principal advantages of wildlife forensics are as follows:

• Determining whether or not a product is made from illegal wildlife: Wildlife

forensics techniques, such as DNA analysis, can be used to identify the type of an
animal or plant and can assist investigators in figuring out whether or not a
product is unlawful.
• Tracing the origin of illegal products: Wildlife forensics methods, such as isotope
analysis, can be used to track the provenance of illegal wildlife products and assist
investigators in locating the illegal trade’s origin.
• Establishing a link and proving criminal intent: Wildlife forensics methods like
fingerprint and blood spatter analysis can produce tangible proof of criminal
intent.
• Promoting international cooperation: To fight wildlife crime worldwide, wildlife
forensics techniques can be utilized to exchange information and coordinate
activities between various nations and organizations.
• Providing scientific proof in court: Wildlife forensics can produce proof that can
be utilized in court to help prosecute wildlife offenders.
• Supporting conservation efforts: By identifying the species that are becoming
extinct and determining the cause, wildlife forensic techniques can assist
conservationists in taking preventive action.
31 Evidence and Identification 487

• Closing the legal loopholes: Using wildlife forensic techniques, the legal founda-
tion to combat wildlife crime can be strengthened by finding the weaknesses in
current laws and regulations.
• Preventing wildlife crime: Using wildlife forensics can help prevent wildlife
crime by making it more likely that offenders will be found out and brought to
justice.
• Preventing the extinction of endangered species: Wildlife forensics methods can
be used to locate and monitor the illegal trade in threatened and endangered
species.
• Providing insights into crime syndicates: Wildlife forensics can help detectives
break up criminal networks involved in wildlife crime by revealing their organi-
zational structure and methods of operation.
• Facilitating international trade: Wildlife forensics can help ensure that interna-
tional trade in wildlife products is legal and sustainable and can help prevent the
illegal trade in endangered species.
• Advancement of scientific knowledge: By supplying new data on species, their
distribution and population trends, and the effects of human activity on wildlife,
wildlife forensics can contribute to the advancement of scientific knowledge.
• Preventing unlawful hunting: Wildlife forensics can be utilized to locate and
apprehend those who engage in illegal hunting.
• Determining the effects of climate change: Wildlife forensics can determine the
effects of climate change on different wildlife species and their habitats, which
can then be used to guide management and conservation efforts.
• Raising public awareness: Wildlife forensics can be used to inform people about
the need to protect wildlife and the repercussions of wildlife crime.

References
Abbas G, Nadeem A, Javed M, Ali MM, Aqeel M, Babar ME et al (2020) Mitochondrial
cytochrome-b, cytochrome-c and D-loop region based phylogenetic and diversity analysis in
blackbuck (Antilope cervicapra). Kafkas Üniversitesi Veteriner Fakültesi Dergisi 26(1):25
Ahmed YA, Ali S, Ghallab A (2018) Hair histology as a tool for forensic identification of some
domestic animal species. EXCLI J 17:663
Arif IA, Khan HA (2009) Molecular markers for biodiversity analysis of wildlife animals: a brief
review. Anim Biodivers Conserv 32(1):9–17
Arif IA, Khan HA, Bahkali AH, Al Homaidan AA, Al Farhan AH, Al Sadoon M, Shobrak M (2011)
DNA marker technology for wildlife conservation. Saudi J Biol Sci 18(3):219–225
Bell LS (2011) Forensic science in support of wildlife conservation efforts—morphological and
chemical approaches (global trends)—. Foren Sci Rev 23(1):31–36
Boore JL (1999) Animal mitochondrial genomes. Nucleic Acids Res 27(8):1767–1780
Bowen GJ, Wassenaar LI, Hobson KA (2005) Global application of stable hydrogen and oxygen
isotopes to wildlife forensics. Oecologia 143(3):337–348
Byrd JH, Tomberlin JK (eds) (2019) Forensic entomology: the utility of arthropods in legal
investigations. CRC Press, Boca Raton, FL
Cerling TE, Barnette JE, Chesson LA, Douglas-Hamilton I, Gobush KS, Uno KT et al (2016)
Radiocarbon dating of seized ivory confirms rapid decline in African elephant populations and
provides insight into illegal trade. Proc Natl Acad Sci 113(47):13330–13335
488 R. R. Darunde et al.

Coghlan ML, White NE, Parkinson L, Haile J, Spencer PB, Bunce M (2012) Egg forensics: an
appraisal of DNA sequencing to assist in species identification of illegally smuggled eggs. Foren
Sci Int Genet 6(2):268–273
Dalton DL, Kotze A (2011) DNA barcoding as a tool for species identification in three forensic
wildlife cases in South Africa. Forensic Sci Int 207(1–3):e51–e54
Dalton DL, Kotzé A, McEwing R, De Bruyn M, Mnisi C, Mwale M (2020) A tale of the traded cat:
development of a rapid real-time PCR diagnostic test to distinguish between lion and tiger bone.
Conserv Genet Resour 12(1):29–31
De Mandal S, Sanga Z, Nachimuthu SK (2014) Metagenomic analysis of bacterial community
composition among the cave sediments of Indo-Burman biodiversity hotspot region. PeerJ 2:
e631v1
Detwiler KM (2019) Mitochondrial DNA analyses of Cercopithecus monkeys reveal a localized
hybrid origin for C. mitis doggetti in Gombe National Park, Tanzania. Int J Primatol 40(1):
28–52
Edwards HGM, Hunt DE, Sibley MG (1998) FT-Raman spectroscopic study of keratotic materials:
horn, hoof and tortoiseshell. Spectrochim Acta A Mol Biomol Spectrosc 54(5):745–757
Espinoza EO, Mann MJ (1992) Identification guide for ivory and ivory substitutes. WWF, Gland
Espinoza EON, Mann MJ (1993) The history and significance of the Schreger pattern in probosci-
dean ivory characterization. J Am Inst Conserv 32(3):241–248
Everatt KT, Kokes R, Lopez Pereira C (2019) Evidence of a further emerging threat to lion
conservation; targeted poaching for body parts. Biodivers Conserv 28(14):4099–4114
Gouda S, Kerry RG, Das A, Chauhan NS (2020) Wildlife forensics: a boon for species identification
and conservation implications. Forensic Sci Int 317:110530
Green ME, Appleyard SA, White W, Tracey S, Devloo-Delva F, Ovenden JR (2019) Novel
multimarker comparisons address the genetic population structure of silvertip sharks
(Carcharhinus albimarginatus). Mar Freshw Res 70(7):1007–1019
Huffman JE, Wallace JR (2012) Wildlife forensics: methods and applications. John Wiley & Sons,
New York, NY
Jan C, Fumagalli L (2016) Polymorphic DNA microsatellite markers for forensic individual
identification and parentage analyses of seven threatened species of parrots (family Psittacidae).
PeerJ 4:e2416
Kanokwongnuwut P, Kirkbride KP, Linacre A (2020) Detecting latent DNA in wildlife forensic
science investigations. Sci Justice 60(4):358–362
Keskin BB, Griffin EC, Prell JO, Dilkina B, Ferber A, MacDonald J et al (2022) Quantitative
investigation of wildlife trafficking supply chains: a review. Omega 115:102780
Knecht L (2012) The use of hair morphology in the identification of mammals. In: Wildlife
forensics. Wiley, New York, NY, pp 129–143
Košinová K, Turek J, Cukor J, Linda R, Häckel M, Hart V (2022) The application of 3D imaging as
an appropriate method of wildlife craniometry: evaluation of accuracy and measurement
efficiency. Animals 12(23):3256
Kumar V, Sharma N, Singal K, Sharma A (2018) A wildlife forensic study for the species
identification of Indian blackbuck through forensically informative nucleotide sequencing
(FINS). Biosci Biotechnol Res Asia 15(1):175
Kumar V, Tyagi K, Chakraborty R, Prasad P, Kundu S, Tyagi I, Chandra K (2020) The Complete
Mitochondrial Genome of endemic giant tarantula, Lyrognathus crotalus (Araneae:
Theraphosidae) and comparative analysis. Sci Rep 10(1):1–11
Kurland J, Pires SF, McFann SC, Moreto WD (2017) Wildlife crime: a conceptual integration,
literature review, and methodological critique. Crime Sci 6(1):1–15
Lee EJ, Lee YH, Moon SH, Kim NY, Kim SH, Yang MS et al (2013) The identification of elephant
ivory evidences of illegal trade with mitochondrial cytochrome b gene and hypervariable D-loop
region. J Forensic Legal Med 20(3):174–178
Linacre A (ed) (2009) Forensic science in wildlife investigations. CRC Press, Boca Raton, FL
31 Evidence and Identification 489

Linacre A, Ciavaglia SA (2017) Wildlife forensic science. In Handbook of forensic genetics:

biodiversity and heredity in civil and criminal investigation. World Scientific Publishing,
Singapore, pp 449–471
Linacre A, Gusmão L, Hecht W, Hellmann AP, Mayr WR, Parson W et al (2011) ISFG:
recommendations regarding the use of non-human (animal) DNA in forensic genetic
investigations. Foren Sci Int Genet 5(5):501–505
Lorenzini R (2005) DNA forensics and the poaching of wildlife in Italy: a case study. Forensic Sci
Int 153(2–3):218–221
Luo X, Meng J, Chen X, Cheng L, Yan S, Gao L et al (2020) Metabolomics-based study reveals the
effect of lead (Pb) in the culture environment on Whitmania pigra. Sci Rep 10(1):1–10
Lyman RL (2019) Assumptions and protocol of the taxonomic identification of faunal remains in
zooarchaeology: a North American perspective. J Archaeol Method Theory 26(4):1376–1438
Mitra I, Roy S, Haque I (2018) Application of molecular markers in wildlife DNA forensic
investigations. J Foren Sci Med 4(3):156
Mosa KA, Gairola S, Jamdade R, El-Keblawy A, Al Shaer KI, Al Harthi EK et al (2019) The
promise of molecular and genomic techniques for biodiversity research and DNA barcoding of
the Arabian Peninsula flora. Front Plant Sci 9:1929
Negi SB (2013) Wildlife crime investigation a hand book for wildlife crime investigation officers.
Wildlife Crime Control Bureau, Ministry of Environment and Forests Government of India,
New Delhi
Nishant K, Vrijesh KY, Ajay KR (2017) Wildlife forensic: current techniques and their limitations.
J Foren Sci Criminol 5(4):402
Ogden R, Linacre A (2015) Wildlife forensic science: a review of genetic geographic origin
assignment. Foren Sci Int Genet 18:152–159
Sahajpal V, Goyal SP, Raza R, Jayapal R (2009) Identification of mongoose (genus: Herpestes)
species from Hair through band pattern studies using discriminate functional analysis (DFA) and
microscopic examination. Sci Justice 49(3):205–209
Sims ME, Baker BW, Hoesch RM (2011) Tusk or bone? An example of ivory substitute in the
wildlife trade. Ethnobiol Lett 2:40–44
Singh RR, Goyal SP, Khanna PP, Mukherjee PK, Sukumar R (2006) Using morphometric and
analytical techniques to characterize elephant ivory. Forensic Sci Int 162(1–3):144–151
Toren D, Barzilay T, Tacutu R, Lehmann G, Muradian KK, Fraifeld VE (2016) MitoAge: a
database for comparative analysis of mitochondrial DNA, with a special focus on animal
longevity. Nucleic Acids Res 44(D1):D1262–D1265
Trail PW (2021) Morphological analysis: a powerful tool in wildlife forensic biology. Foren Sci Int
Anim Environ 1:100025
Uno KT, Quade J, Fisher DC, Wittemyer G, Douglas-Hamilton I, Andanje S et al (2013) Bomb-
curve radiocarbon measurement of recent biologic tissues and applications to wildlife forensics
and stable isotope (paleo) ecology. Proc Natl Acad Sci 110(29):11736–11741
Viciano J, López-Lázaro S, Tanga C (2022) Post-mortem dental profile as a powerful tool in animal
forensic investigations—a review. Animals 12(16):2038
Warlow T (2004) Firearms, the law, and forensic ballistics. CRC Press, Boca Raton, FL
Zhou W, Qiu LZ, Liu H, Deng HF, Yue LX, Gao Y (2020) Corrigendum to “Notch1-mediated
histone demethylation of HCN4 contributes to aconitine-induced ventricular myocardial dys-
rhythmia” [Toxicol. Lett. 327 (2020) 19-31]. Toxicol Lett 331:257–258
Forensics in Bioterrorism
32
Monisha Samuel and Rutwik Shedge

Abstract

Terrorism can be defined as any method employed to threaten and terrorize large
groups of individuals, governments, armies, or society as a whole. Thus, one may
accept, in the milieu of historical analysis of bioterrorism, that it involves the
usage of different biological agents by any person or groups, including political or
military personnel and official states, motivated by various reasons (be they
political, religious, or other ideological objectives), in order to attain such
consequences (Barras and Greub, Clin Microbiol Infect 20:497–502, 2014).
Bioterrorism covers a very broad spectrum of issues, from catastrophic terrorism
with mass casualties, to microevents via biological agents, which leads to various
results like civil conflict, disturbance, illness, infirmities, and death (Barras and
Greub, Clin Microbiol Infect 20:497–502, 2014).

Keywords
Bioterrorism · Biological warfare · Biological weapons · Bio war · Public health
emergency · Forensics · Microorganisms · Bacteria · Toxins · Plague · Viruses

Definitions
Bioterrorism: The use of infectious agents or other harmful biological or biochemi-
cal substances as weapons of terrorism.
Biological Weapons: They are either microorganisms like virus, bacteria, or
fungi, or toxic substances produced by living organisms that are produced and
released deliberately to cause disease and death in humans, animals, or plants.
Plague: An epidemic disease causing a high rate of mortality.

M. Samuel (✉) · R. Shedge

Department of Forensic Science, National Forensic Sciences University, Tripura Campus, Agartala,
Tripura, India

# The Author(s), under exclusive license to Springer Nature Singapore Pte 491
Ltd. 2024
A. Puri et al. (eds.), Fundamentals of Forensic Biology,
https://doi.org/10.1007/978-981-99-3161-3_32
492 M. Samuel and R. Shedge

Quarantine: A restraint upon the activities or communication of persons or the

transport of goods designed to prevent the spread of disease or pests.
Epidemics: A widespread occurrence of an infectious disease in a community at a
particular time.

32.1 Brief History

The historical study of biological warfare (BW) and bioterrorism is enormously

tough, and any conclusions in this respect have to be obtained with extreme care,
because of various concomitant reasons: first, the lack of consistent scientific data
regarding alleged biological attacks, especially before the dawn of modern microbi-
ology. The second is the polemical situations surrounding any alleged bioterrorist
attack, within which the accessible documents become prone to multiple political
influences and manipulations, which makes it very difficult to interpret accurately.
The third possible reason is also the historical distance of primeval stories about
biological attacks, leading to misinterpretation when read with contemporary lenses
(Christopher et al. 1997; Joshua 1999). Thus, given such factors, it is easy to
understand why it may become taxing for historians to distinguish natural epidemics
from alleged biological attacks.

32.1.1 Use of Biological Weapons During Ancient Times, Middle

Ages, and Colonial Period

Infectious diseases and other biological weapons have been identified for their
potential effect on people from as early as the fourteenth century BC (Table 32.1).
Beginning from pre-historic times, the Melanesian tribesman (actual Vanuatu)
employed arrowheads contaminated with tetanus (Carus 2017). The delivery of
diseased rams potentially infected with tularemia by Hittites might have formed
the first documented example of biological warfare. This had been a strategy to
weaken their enemies (Trevisanato 2007). In the sixth century BC, as recorded by
the Greek historian Herodotus, the Scythian archers are used to infect their arrows by
plunging them in a concoction of rotting cadavers and human blood. According to
the interpretation of recent times, this mixture might possibly be a source of
Clostridium perfringens and Clostridium tetani (Grmek 1979). In the third century
BC, the army commander Hannibal of Cartagena destroyed his adversary’s fleet,
which belonged to King Eumenes II of Pergamon with pots full of venomous snakes.
Such classic examples have been reported by historians where the use of arrows and
other objects infected with different infectious or toxic products obtained from
animal parts or plants has been prevalent in order to destroy the enemy (Barras
and Greub 2014). Another event documented is the poisoning of wells by Emperor
Barbarossa with human bodies in Tortona, Italy. Also, another event was when Jean,
Duke of Normandy, cast dead horses over the wall into the castle of Thun l’Eveque,
captured by the Englishman (Geissler and Moon 1999).
32 Forensics in Bioterrorism 493

Table 32.1 Examples of biological warfare during the ancient times and Middle Ages
Year Events
Fourteenth The Hittites send rams infected with tularemia to their adversaries
century BC
Sixth Century BC The Scythian archers were immersing their arrows in a mixture of blood and
decaying corpses to infect them
1155 Barbarossa polluted water wells with human remains, Tortona (Italy)
1346 In the beleaguered city of Caffa, Mongols toss the remains of plague victims
over the walls (Crimea)
1422 The Lithuanian army throw manure, garbage, and diseased victims during
the siege of the town of Carolstein (Bohemia)
1495 Spanish sell wine to their French adversaries mixed with leprosy patients’
blood, Naples (Italy)
1500 Pizarro provided variola-infected garments to the native populations in
South America
1650 The Polish army attacks its adversaries by firing them with rabid canine
saliva.
1710 Russian soldiers launch plague cadavers over Swedish soldiers at Reval
(Estonia)
1797 To spread malaria among the enemy, the Napoleonic troops flooded the
fields around Mantua, Italy
1863 During the American Civil War, Confederates sold garments made from the
remains of patients with smallpox and yellow fever to Union forces

In the Middle Ages, a more famous example has been the siege of Caffa (now
known as Feodosia in Ukraine/Crimea), a Genovese base on the Black Sea coast, by
the Mongols. Tartar (Mongol) army catapulted dead bodies of plague fatalities over
the city walls of Caffa to attack the Genoese army with an epidemic of bubonic
plague (Geissler and Moon 1999). There has been speculation that quite plausibly
this was how the plague was transmitted by the Mongols by throwing diseased
cadavers with catapults into the Mediterranean ports and throughout Europe.
Though given the highly complex epidemiology of plague, this interpretation of
the Black Death, which might have killed more than 25 million people, starting from
a very specific and localized origin, remains highly controversial. Similarly, it is
provocative as to whether the effect of throwing infected bodies could have been the
only cause of the outburst of an epidemic. However, this occurrence of the use of
corpses in order to infect a population remains a milestone in the history of
bioterrorism (Geissler and Moon 1999; Wheelis 2002). Other similar incidents
have been the siege of the Bohemian city of Carolstein by Lithuanian troops in
1422. The Lithuanian army hurled corpses of those who died in battle along with
manure and garbage into the Bohemian town of Karlstein (Robertson and Robertson
1995). In 1495, it has been documented that the Spanish peddled wine contaminated
with the blood of leprosy patients to their French adversaries in Naples (Italy). In
1500, Pizarro offered variola-infected clothing to the South American native
communities (Noah et al. 2002). In 1650, it was witnessed that the Polish fired
saliva from rabid dogs in the direction of their enemies. In 1710, the Russian army
494 M. Samuel and R. Shedge

catapulted dead remains over the Swedish troops in Reval (Estonia) (Robertson and
Robertson 1995). In 1797, the Napoleonic armies further flooded the plains around
Mantua (Italy) to augment the spread of malaria (Cohen et al. 2003).
During the ensuing centuries, smallpox represented one of the most commonly
used biological weapon of occidental war and colonial history. Introduced in the
American mainland by the Europeans, it was explicitly employed several times as a
way to infect Native Americans. During the American civil war, the Confederate’s
troop sold yellow fever and smallpox-infected clothing to Union troops (Cohen et al.
2003) They also contaminated water supplies for the Union forces with animal
cadaver (Wheelis 2002).

32.1.2 Use of Biological Weapons During the Modern Era

The end of the nineteenth century and development of the germ theory of disease and
the foundation of microbiology by Louis Pasteur and Robert Koch led to the true
modern era of biological warfare. With the onset of World War I, many nations like
Germany and France (to a lesser scale) developed secret BW programs, such as the
infection of animal feed with Bacillus anthracis or Burkholderia mallei in order to
infect the enemy. German troops sold horses and mules diseased with glanders and
anthrax to their Allies (Noah et al. 2002). Sheep infected with glanders and anthrax
were peddled to Russian, Britain, and Indian armies by the Germans as well. Further
German troops also endeavored to spread cholera in Italy and plague in
St. Petersburg (Poupard and Miller 1992). Thus, between late 1914 and early
1915, Germany pioneered the dissemination of biological weapons and was
initiating a true BW campaign, using different biological pathogens against several
countries. Whatever the success of these programs might have been, the threat of
BW along with the terror of chemical warfare being used on the battlefield, became,
for the first time in history, a foremost political concern at the international level. As
a result, the Geneva Protocol for the Prohibition of the Use in War of Asphyxiating,
Poisonous or Other Gases, and of Bacteriological Methods of Warfare was approved
in 1925. The Geneva Protocol very clearly prohibited the use of biological weapons,
but did not prevent their research and production. Thus, states that had ratified the
Geneva Protocol continued researching and developing intense programs on
biological weapons (Christopher et al. 1997).
During the interwar period, under the command of Major General Shiro Ishii, the
first biological weapon research facility at the Tokyo Army’s medical school,
obscured as part of the Kwantung Army’s Water Purification Department, began
its research program on biological agents. Although the center lacked technical
sophistication, this program had the manpower. More than 3000 military personnel
along with hundreds of medical doctors and technicians were recruited for research
and development. More than 150 research centers, including the infamous unit
731 considered responsible for human experimentation during the Second Sino-
Japanese War, were spread throughout the Japanese empire, from Manchuria to
Indonesia. This research program, until today, is considered one of the most
32 Forensics in Bioterrorism 495

appalling programs, which performed atrocious experiments on humans. It is

estimated that at least 3000 prisoners of war (Chinese, Koreans, Mongolians,
Soviets, Americans, British, and Australians) were supposedly used as test subjects
in unit 731. These experiments included inoculation with many pathogens, weapons
tests, and germ warfare attacks (Barras and Greub 2014). As a result of the dissemi-
nation of pathogens during the Japanese BW program, it is estimated that thousands
of civilians perished as a direct consequence of the attacks. Moreover, the incapabil-
ity of controlling the dissemination caused the death of several Japanese soldiers
during attacks (Barras and Greub 2014).
The American BW program was a covert operation implemented in 1942 after
suspicion of the use of BW agents by Germany and Japan (Barras and Greub 2014).
Non-pathogenic bacteria like Bacillus globigii and Serratia marcescens were used
for open-air field testing along with the spreading of bacterial aerosols in various
public places. At its peak, the program involved more than 3000 people and multiple
research and development facilities. Research with more than 30 agents including
bacteria (e.g., B. anthracis, Brucella suis, Coxiella burnetii, and Francisella
tularensis), toxins (e.g., botulin and staphylococcal enterotoxin B), and viruses
(e.g., Venezuelan equine encephalitis and yellow fever virus) were conducted
(Joshua 1999). The program was officially dismantled in 1969, and the facilities
were converted for defense purposes only. Further to this, the Biological Weapon
and Toxin Convention (BWTC) was signed in the year 1972. However, amidst this
the country had successfully developed ten different BW agents and designed a
sophisticated delivery system (Khardori and Kanchanapoom 2005).
In the 1980s, one dramatic example of this can be provided by the Rajneesh cult, a
sect that in 1984 purposefully poisoned salad bars with Salmonella typhimurium in a
number of restaurants in Dalles, Oregon. In addition to carrying out its infamous
sarin gas attack in the Tokyo subway in March 1995, another religious cult known as
Aum Shinrikyo was also developing, at the same time, a program on crude biological
weapons containing Clostridium botulinum and B. anthracis, but with no proof of
effectiveness (Noah et al. 2002). Another famous attack was the “anthrax letters
case,” which caused 751 cases, 45 of which required hospitalization. This appears to
be one of the very few verified incidents of biological terrorism following World
War II. Over the course of the autumn, a number of letters were written to journalists
or elected politicians. Five of the 22 anthrax-infected individuals died as a direct
result of anthrax or its complications. The specific strain employed was linked to a
laboratory run by the US Army at Fort Detrick, but the attackers are still at large
(Jaton and Greub 2014). This case demonstrates that BW is still a huge concern to
the public and it must be handled seriously and addressed at the individual and
political levels as well. Additionally, it highlights the significance of being ade-
quately prepared for the occurrence of such an event.
496 M. Samuel and R. Shedge

32.2 Investigative Response to Bioterrorism

A wide-ranging approach to coping with bioterrorism must integrate efforts to avert

the proliferation of biological weapons along with designing methods for detecting
underground biological weapons programs; strategies for preventing their use in case
biological weapons do multiply; and mechanisms for defending civilian and military
populations where deterrence is unsuccessful. The emphasis in this multifaceted
approach should be on the investigation and defense strategies, simply because the
growth of biological weapons is tough to control and covert biological weapons
programs are difficult to track. The deterrence thus will likely be less effective.
Consequently, the way to move forward is by improving intelligence and informa-
tion management, the forensic community should be focused on improving investi-
gative responses along with defenses against biological weapons. The means to
achieve it encompass the rapid detection of biological agents together with preclini-
cal, clinical, and agricultural monitoring and diagnosis.
To begin with, increased vigilance in the intelligence community could reduce
the unplanned spread of knowledge that may aid in bioweapon planning by terrorist
organization. Voluntary international and national exertions to promote the
exchange of biotechnology-related information could easily advance security and
safety in the handling, storage, and transportation of sensitive biological substances
and equipment. Understanding the area of biotechnology, where various potential
bioagents are developed, and also becoming familiar with certain cultural
techniques, processes, and procedures are extremely essential in identifying potential
threat. In such cases, expert scientists and technologists can offer immense help to
the community.
The next thing is to design a systemic approach and target the completion of
various activities in a phased manner prior and through an incident for a successful
response to a bioterrorist attack. The various phases are as follows (Government of
India, Ministry of Home Affairs 2006).

32.2.1 Preparedness Phase

This phase encompasses actions to be taken by various agencies and response teams
to ensure an essential state of preparedness. These include assessment of the labora-
tory facilities and their constant upgradation. The hospitals should also be regularly
evaluated. Healthcare professionals, rapid response team (RRT), and quick response
medical team (QRMT) who would be the first responders should be provided with
adequate training so as to sustain and manage a case of an imminent attack. Ensuring
the availability of adequate stocks of medicines and vaccines is very essential. Along
with all this, proper coordination with security organization in order to organize
mock drills for health professionals, government departments, animal husbandry,
security, law enforcing, and other agencies so as to evaluate their preparedness levels
so they can act promptly in case of an attack is of utmost importance. To be able to
prepare contact details so that communications are unimpeded during an attack is
32 Forensics in Bioterrorism 497

also another vital task in this initial phase of response. The public also should be kept
aware of imminent attacks in a sensitive manner so as to not create unnecessary panic
but also encourage reporting in a voluntary manner.

32.2.2 Early Warning Phase

Various activities including case characterization, notification, compilation, and

analysis of epidemiological data are the main part of the surveillance system’s
early warning phase. Further, in order to assess the severity and scope of any
potential attack and to put effective measures in place, public health epidemiologists
require to identify the attack as quickly as possible and conduct an investigation.

32.2.3 Notification Phase

Any unusual sickness or typical symptoms seen in unusually high numbers must be
reported to the appropriate authorities. Rapid epidemiological investigations, swift
laboratory support for diagnosis confirmation, isolation, quarantine, keeping
healthcare facilities prepared for potential casualty management, and establishing
public health infrastructure for control are all initiatives in this phase.

32.2.4 Response Phase

Rapid epidemiological examination, prompt laboratory support, mass casualty man-

agement, and the implementation of preventive, curative, and targeted control
measures are all part of this phase’s operations. These are meant to stop the disease
from spreading further. Considering and understanding the time, place, and distribu-
tion of those affected, the routes of transmission, the impact on important infrastruc-
ture and healthcare facilities, the agencies and organizations involved in the
response, and the public health responders, local, state, and federal emergency
operation centers for disease management, are among other factors, which are
extremely critical before launching a response. Establishing contact with and
planning alongside health department staff members who are in charge of emergency
response to keep efficient tracking of every contact and activity that follows is
another important step in this phase.
Further to this, establishing specific, quantifiable, and realistic early health
response targets based on the evaluation of the problem and devising a plan of
action should be prioritized. Assigning duties and keeping a record of all actions also
help in this stage. This is finally followed by implementing the plan of action. The
RRTs/QRMTs have to further inspect the outbreak or upsurge in the disease
prevalence. There is a collection of samples, and a state or national testing laboratory
has to be assigned. Hospitals have to be informed so they can receive the patients and
provide them with adequate care. Immediate relief centers or temporary hospitals are
498 M. Samuel and R. Shedge

to be set up if required. Measures for quarantine and disease control have to be

implemented. Treatment guidelines should be communicated to all parties concerned
as soon as the disease has been recognized. The identified laboratory is required to
create a standard operating procedure (SOP) for laboratory testing, which is then
distributed for adoption to all other hospital laboratories and district hospitals.
Specific laboratory reagents are to be supplied to all the designated testing centers
and hospitals. To avoid any panic, the “Dos and Don’ts” list is disseminated through
print and electronic media. Hospitals take the necessary precautions for isolation,
quarantine, waste disposal, and personal safety. An impact assessment team is
essential for evaluating the impact of the outbreak on humans, animals, and plants.

32.2.5 Recovery Phase

The setbacks caused by the bioterrorist attack are mended, and the preparation plans
for the future incorporating the lessons learned through the attack are evaluated. The
harm done to the public health facilities is repaired, as are the necessities used during
the response phase. There are announcements made to the public on the return to
normal. The RRTs gather and examine data to find the shortcomings in the applica-
tion of the response measures. The future contingency plan is then updated with the
required revisions.

32.3 Tracing of Prospective Bioterrorism Agent Through SNP,

VNTR, and Whole-Genome Sequence Analysis

Finding the origin of a disease, especially in cases of potential bioterrorist attacks,

can save many lives. It enables actions to be taken to stop the disease from spreading
further and also track the perpetrator. Even though the process of transmission for
many human infections is well understood, it is frequently challenging to pinpoint
the precise origin of a disease outbreak using laboratory techniques (Schürch and
Siezen 2010). Today, microbial forensics has evolved into a wide range of laboratory
analytical techniques and methodologies, going far beyond those used in medical
diagnoses or epidemiological investigations, such as molecular sequencing, bio-
chemical analyses, microbial cultures, electron microscopy, mass spectrometry,
and crystallography (Echeonwu et al. 2018). As previously discussed, human
diseases can be brought on by many different biological agents. For example, it is
usually hard to distinguish between all bacterial strains involved in a single outbreak
using the current techniques of generating DNA fingerprints of various bacterial
agents of an infectious disease. Therefore, this makes it impossible to track the
disease’s spread, but the recent use of next-generation sequencers and whole-
genome sequencing tools has enabled genetic information of all isolates to be
analyzed and thus is a modern answer to this challenge.
Thus, these modern molecular methods that have been used in what is known as
molecular epidemiology to identify the origins of microbial disease epidemics have
32 Forensics in Bioterrorism 499

significant source tracing of potential threats. Some of these genetic markers are
single-nucleotide polymorphisms (SNPs), insertions and deletions, repetitive
sequences, mobile elements, housekeeping genes, pathogenicity islands, structural
genes, resistance and virulence genes, whole-genome sequences, sexual and asexual
reproduction, conjugation, transduction, horizontal gene transfer, lysogeny, gene
conversion, gene duplication, recombination, rearrangements, and mutational
hotspots, and they are very commonly used today to trace the origin of various
microbial strains (Budowle et al. 2005). Major nucleic acid-based technologies used
for this purpose include multilocus sequence typing (MLST). Further that has been
enhanced in the form of ribosomal multilocus sequence typing, multilocus variable
number tandem-repeat (VNTR) analysis (MLVA), clustered regularly interspaced
short palindromic repeats (CRISPRs), whole-genome sequencing, and microarray.
Apart from these, next-generation sequencing in recent times has momentously and
positively impacted the skills of forensic genetics. Some of them are enlisted below.

32.3.1 Using Single-Nucleotide Polymorphisms (SNP) for Source

Tracing

SNP stands for single-nucleotide polymorphism, a type of single-nucleotide varia-

tion that occurs at certain locations in the genome. These variances are found to be in
different extent in various populations. SNPs are present in every genome, including
that of humans, plants, and microorganism. Due to their large benefits in parentage
testing, SNPs have attracted the attention of forensic researchers. SNPs are excellent
for examining and identifying damaged samples with small amplicons since they
have very low mutation rates. SNPs offer useful details on the geographic origin and
unique identification of unknown people, plants, and microbes (Sobrino et al. 2005).
Yersinia pestis, the cause of the deadly plague, has been elaborately studied. One
such study showed that due to the evolutionary similarity between Y. pestis and
Y. pseudotuberculosis, it is difficult to differentiate them by techniques like MLST,
whereas the same scientists were able to find 76 conservative SNPs from 3250
orthologous coding sequences in their work. This was based on a comparative study
of three different Y. pestis genomes that represented various pathogen biovars
(Achtman et al. 1999). Further whole-genome sequencing analysis has shown an
even greater number of SNPs, which would discriminate even better when utilized
for genetic typing (Morelli et al. 2010).

32.3.2 Multilocus Variable Number Tandem Repeat Analysis

in Source Tracing

Tandem repeat genomic polymorphism in mammals has been very beneficial in

genetic mapping and is still an integral part of forensic DNA fingerprinting. These
repetitive sequences are regularly classified based on the varying ranges of base pair
numbers. They are further divided into satellites (megabases of DNA in association
500 M. Samuel and R. Shedge

with chromatin), minisatellites (repeat units of about 6–100 bp across hundreds of

base pairs), or microsatellites (with repeat units of between 1 and 5 bp across a few
tens base pairs).
It has been demonstrated that MLVA can both categorize strains that are distantly
related and tell them apart as well. Researchers have used multiple VNTR loci to
detect significant variations across these loci from various Y. pestis strains. A large
number of Y. pestis isolates were successfully divided into 61 unique genotypes by
Pourcel et al. They have been able to suitably distribute the three biovars among its
three major branches as well. They have also proposed that a subset of seven VNTR
markers would be sufficient for rapid comparison of a new strain with their collec-
tion and can be achieved very easily with a Web-based facility (Klevytska et al.
2001; Pourcel et al. 2004).
Another such study reported the use of MLVA technique to investigate and
effectively trace the origin of a 1993 aerosolization of B. anthracis spores by the
Aum Shinrikyo cult group. The publication highlighted the use of eight VNTR
markers and a missing pXO2 gene plasmid as markers that were able to identify the
attack strain as the Sterne vaccine strain of B. anthracis. This was locally available
then in Japan for veterinary purpose (Keim et al. 2001).

32.3.3 Whole-Genome Sequence Analysis for Source Tracing

Today, it is easily feasible to find several genetic changes using whole-genome

sequencing analysis, including SNPs, gene loss/gain, gene rearrangement, VNTRs,
and CRISPRs. Sequencing results in in-depth data regarding the variety of bacterial
genomes and thus enables an improved source-tracing analysis. Whole-genome
sequence typing (WGST) analyzes variations across the entire genome using the
fast-developing next-generation sequencing technology. Source-tracing databases
could be developed that comprise whole-genome sequences of hundreds of bacterial
strains using this technology. This will help in shortening the time span required for
source tracing and contribute to the assessment of potential strains that can be
manipulated for bioterrorism purpose (Yang and Keim 2012).

32.4 Conclusion

In conclusion, terrorists are more dedicated and have access to readily available
resources, information, and technology that can be used to create bioweapons that
can cause significant harm to civilizations that are unprepared and vulnerable.
Bioterrorism, biocrime, and biowarfare are likely to recur since similar incidents
have happened frequently occurred in the past. Today, various microorganisms are
more easily accessible, and technology to develop them as weapons are more
plausible (Jansen et al. 2014).
The development and/or validation of every step of the forensic investigation
process, from sample collection through result interpretation, is necessary for an
32 Forensics in Bioterrorism 501

effective program that could thwart such attacks. Beyond the conventional forensic
laboratory and its practitioners, additional existing and developing skills would also
be required. More laboratories must be implemented in researching new procedures
and constantly comparing them to those that have been accepted by the forensic
DNA science community (Broussard 2001). This will guarantee the required quality
when analyzing evidence and the results will be more readily accepted in the court of
law. The biggest challenge today is to be able to characterize bioweapons using our
knowledge and forensic skills. Microbial Forensics could thus play an enhanced role
in the coming years and can serve as an effective tool in the resolution of a biocrime
or an act of bioterrorism.

Multiple Choice Questions

1. Infectious diseases have been identified for their potential effect on people from
as early as _____ century
(a) Tenth century
(b) Fourth century
(c) Fourteenth century
(d) Eighth century
Answer: C
2. In 2001, 22 cases were reported in the USA where spores of a microorganism
were sent through mail. It caused thousands of people to be affected. Identify the
microorganism.
(a) Bacillus anthracis
(b) Clostridium botulinum
(c) Streptomyces griseus
(d) Staphylococcus aureus
Answer: A
3. Yersinia pestis is the causative agent for which disease
(a) Botulism
(b) Bubonic plague
(c) Smallpox
(d) Hay fever
Answer: B
4. Which microorganism was used as a bioterrorism weapon in the Oregan attack in
the year 1984?
(a) Salmonella typhimurium
(b) Clostridium botulinum
(c) Bacillus anthracis
(d) Yersinia pestis
Answer: A
5. SNPs stands for
(a) Single nitrogen polymerase
(b) Single-nucleotide polymorphism
(c) Single-nucleoside polymorphism
502 M. Samuel and R. Shedge

(d) Start nucleotide polymorphism

Answer: B
6. Minisatellites are defined as
(a) Repeat units of between 100 and 500 bp across a few tens base pairs
(b) Repeat units of about 6–100 bp across hundreds of base pairs
(c) Repeat units of between 1 and 5 bp across a few tens base pairs
(d) Repeat units of 250–2000 bp across hundreds of base pairs
Answer: B
7. Dead bodies of plague fatalities were thrown over the city walls of Caffa to attack
the Genoese army with an epidemic of _____ .
(a) Anthrax
(b) Bubonic plague
(c) Typhoid
(d) Pneumonia
Answer: B
8. Which phase restores the public health facilities and replenishes the necessities
used during the response phase?
(a) Recovery phase
(b) Preparedness phase
(c) Early warning phase
(d) Response phase
Answer: A

References
Achtman M, Zurth K, Morelli G et al (1999) Yersinia pestis, the cause of plague, is a recently
emerged clone of Yersinia pseudotuberculosis. Proc Natl Acad Sci U S A 96:14043–14048.
https://doi.org/10.1073/PNAS.96.24.14043
Barras V, Greub G (2014) History of biological warfare and bioterrorism. Clin Microbiol Infect 20:
497–502. https://doi.org/10.1111/1469-0691.12706
Broussard LA (2001) Biological agents: weapons of warfare and bioterrorism. Mol Diagn 6:323–
333. https://doi.org/10.2165/00066982-200106040-00013
Budowle B, Johnson MD, Fraser CM et al (2005) Genetic analysis and attribution of microbial
forensics evidence. Crit Rev Microbiol 31:233–254. https://doi.org/10.1080/
10408410500304082
Carus WS (2017) A short history of biological warfare: from pre-history to the 21st century.
Government Printing Office, Washington, DC
Christopher GW, Cieslak TJ, Pavlin JA, Eitzen EM (1997) Biological warfare. A historical
perspective. JAMA 278:412–417
Cohen A, Robenshtok E, Rotman E, Sagi R (2003) The history of biological warfare. Human
experimentation, modern nightmares and lone madmen in the twentieth century. EMBO Rep 4:
S47–S52. https://doi.org/10.1038/SJ.EMBOR.EMBOR849
Echeonwu B, Nwankiti O, Chollom S, Olawuyi K (2018) Bioterrorism threat: a review of microbial
forensics source-tracing of some bioterrorism agents. J Foren Sci Med 4:161. https://doi.org/10.
4103/JFSM.JFSM_5_18
32 Forensics in Bioterrorism 503

Geissler E, Moon JEC (1999) Biological and toxin weapons: research, development and use from
the middle ages to 1945. SIPRI Chemical and Biological Warfare Studies, vol 18. SIPRI, Solna.
296 pp
Government of India, Ministry of Home Affairs (2006) Standard Operating Procedures (SOP) for
responding to a terrorist attack using biological agents. Government of India, New Delhi
Grmek M (1979) Ruses de guerre biologiques dans l’Antiquité. Rev Etud Grec 92:141–163. https://
doi.org/10.3406/REG.1979.4222
Jansen HJ, Breeveld FJ, Stijnis C, Grobusch MP (2014) Biological warfare, bioterrorism, and
biocrime. Clin Microbiol Infect 20:488–496. https://doi.org/10.1111/1469-0691.12699
Jaton K, Greub G (2014) Clinical microbiologists facing an anthrax alert. Clin Microbiol Infect 20:
503–506. https://doi.org/10.1111/1469-0691.12682
Joshua L (1999) Biological weapons: limiting the threat. MIT Press, Cambridge, MA
Keim P, Smith KL, Keys C et al (2001) Molecular investigation of the Aum Shinrikyo anthrax
release in Kameido, Japan. J Clin Microbiol 39:4566–4567. https://doi.org/10.1128/JCM.39.12.
4566-4567.2001
Khardori N, Kanchanapoom T (2005) Overview of biological terrorism: potential agents and
preparedness. Clin Microbiol Newsl 27:1–8. https://doi.org/10.1016/J.CLINMICNEWS.2005.
01.001
Klevytska AM, Price LB, Schupp JM et al (2001) Identification and characterization of variable-
number tandem repeats in the Yersinia pestis genome. J Clin Microbiol 39:3179–3185. https://
doi.org/10.1128/JCM.39.9.3179-3185.2001
Morelli G, Song Y, Mazzoni CJ et al (2010) Yersinia pestis genome sequencing identifies patterns
of global phylogenetic diversity. Nat Genet 42:1140–1143. https://doi.org/10.1038/NG.705
Noah DL, Huebner KD, Darling RG, Waeckerle JF (2002) The history and threat of biological
warfare and terrorism. Emerg Med Clin N Am 20:255–271
Poupard JA, Miller LA (1992) History of biological warfare: catapults to capsomeres. Ann N Y
Acad Sci 666:9–20. https://doi.org/10.1111/J.1749-6632.1992.TB38020.X
Pourcel C, André-Mazeaud F, Neubauer H et al (2004) Tandem repeats analysis for the high
resolution phylogenetic analysis of Yersinia pestis. BMC Microbiol 4:22. https://doi.org/10.
1186/1471-2180-4-22
Robertson AG, Robertson LJ (1995) From Asps to allegations: biological warfare in history. Mil
Med 160:369–373. https://doi.org/10.1093/MILMED/160.8.369
Schürch AC, Siezen RJ (2010) Genomic tracing of epidemics and disease outbreaks. Microb
Biotechnol 3:628–633
Sobrino B, Brión M, Carracedo A (2005) SNPs in forensic genetics: a review on SNP typing
methodologies. Forensic Sci Int 154:181–194. https://doi.org/10.1016/J.FORSCIINT.2004.
10.020
Trevisanato SI (2007) The ‘Hittite plague’, an epidemic of tularemia and the first record of
biological warfare. Med Hypotheses 69:1371–1374. https://doi.org/10.1016/J.MEHY.2007.
03.012
Wheelis M (2002) Biological warfare at the 1346 Siege of Caffa. Emerg Infect Dis 8:971–975.
https://doi.org/10.3201/EID0809.010536
Yang R, Keim P (2012) Microbial forensics: a powerful tool for pursuing bioterrorism perpetrators
and the need for an international database. J Bioterror Biodef 2:1–8. https://doi.org/10.4172/
2157-2526.S3-007
Hair Analysis
33
Avinash Puri and Neelam Arya

Abstract

Hair is extremely important physical evidence being the most common biological
material, which plays a crucial role in a criminal investigation. Hair evidence is
generally associated with crimes involving physical contacts such as rape, mur-
der, road accidents, and trafficking and may be found at the crime scene, on the
body and clothes of victim/suspect, or attached to a weapon of offense, tool, or
vehicle. Even thefts of animals cause the shedding of animal hairs on the person
or vehicle involved in the offense. There are many differences between human
and animal hairs. The comparison and identification of human and animal hair
can provide investigators with valuable information for potential leads. Morpho-
logical and microscopic comparison is considered a reliable tool for the specific
identification of the characteristics found in hair.
With the advancement of technology and awareness, hair analysis is a widely
accepted tool to determine color, race, sex, age, metal poisoning, illegal wildlife
trade, sexual assault, and disputed maternity and paternity matters. Hair is
actually unique to the individual is very probable since, if it were not, it would
be the exception to the general rule of biological individuality. The molecular
analysis and microscopic comparison of morphological characteristics of hair
have been accepted both scientifically and legally for decades.

A. Puri (✉)
Department of DNA and Forensic Biology, Regional Forensic Science Laboratory, Indore, Madhya
Pradesh, India
N. Arya
Forensic Science Laboratory, madhuban, Haryana, India

# The Author(s), under exclusive license to Springer Nature Singapore Pte 505
Ltd. 2024
A. Puri et al. (eds.), Fundamentals of Forensic Biology,
https://doi.org/10.1007/978-981-99-3161-3_33
506 A. Puri and N. Arya

Keywords

Hair identification · Scalp hair analysis · Drug detection from hair · Hair DNA
profiling · Hair as bioindicator

33.1 Hair Analysis

Hair is found on most of the limbs of human beings and animals. In all natured
crimes such as murder, sexual assaults, traffic accidents, and hanging, hair is likely to
detach from the scalp, and other areas of the body and get transferred from one
person to another or on objects at the scene of crime. Hair is extremely important
physical evidence being the most common biological material, which plays a crucial
role in a criminal investigation. It must be collected in every case in which it occurs.
In murder cases, hairs may readily get attached/stick to the weapon of offense. The
examination of such hairs aid in establishing the involvement of weapon in the crime
committed. In cases like kidnapping, human trafficking, and robbery, hairs may
provide crucial evidence of contact of the accused/suspect with the scene of crime,
the victim, the vehicle, the weapon or article of clothing, etc. Hair examination may
be used for associative and investigative purposes and to provide information for
crime scene reconstruction. The comparison and identification of human and animal
hair can provide investigators with valuable information for potential leads. Mor-
phological and microscopic comparison is considered a reliable tool for the specific
identification of the characteristics found in human and animal hair.
Because of the small size of this evidence, hair may be difficult to find. Care and
patience are required to conduct a thorough search for this evidence. However, the
hairs are very resistant to decomposition and putrefaction thats why the hair remains
intact as an evidence for a longer period of time. Hair is usually used to study the
characterization of the known sample versus the questioned hairs recovered from the
scene of crime to verify if they are from a common source for the establishment of a
relation between crime and the criminal. It is not possible to determine the person
that a strand of hair come from. Because hair studies are slow and often difficult,
there has been a tendency to minimize the importance of hair as evidence. Even
though much worthwhile information can be determined through hair examination.
Significant information such as species, location of growth on the body, hair
treatment, and hair disease is some of the types of information that can be deter-
mined. Care must be taken at all times to avoid altering the hair itself or the debris
carried on it during such a preliminary observation. Perhaps it is even more impor-
tant to avoid contamination of the sample as several police investigators are not
aware of the technicality of it. Toxic elements such as arsenic and thallium are
preferably deposited in hair and other keratinous appendages like nails. Hair is often
analyzed for the detection of arsenic poisoning because the metabolic process takes
arsenic direct to the hair. Although the hair also absorb arsenic and hold tightly., so
that it cannot be assumed that hair analysis is always capable of indicating poisoning
from arsenic. It has been long known that other elements like lead, silica, iron, and
33 Hair Analysis 507

Fig. 33.1 Human vs

animal hair

phosphorous exist in small quantities in some hair. The distribution of such elements
in hairs of different persons has been found to be highly individual (Fig. 33.1).

33.1.1 Human Hair Characteristics

There are four types of human hair, they are primordial, lanugo, vellus, and terminal
hair. Primordial and lanugo hairs develop at three and 6 months in the baby during of
gestation period before the birth. Vellus hairs are fine and lack medullae inside the
cortex and are present all over the body. Terminal hairs are prominent in appearance
and hard in structure and are present on the scalp/head, eyebrows, eyelashes, face,
armpits, and around genital organs.
Hairs are complex fibrous outgrowths projecting from the skin that possess
different microscopic characteristics such as shape, color, and root appearance.
Human hair consists of a bundle of fibrils each of which is composed of protein
known as keratin. It contains certain excretory products. Environmental or external
contamination may cause a covering over the hair with dust, dirt, or oily substances.
Morphologically, a single hair strand on a macro-scale has a root, a shaft, and a tip.
The proximal-most portion of the hair is root. The main portion of the hair is known
as the shaft. The distal-most portion of the hair is known as the tip. The tip may be
natural or cut. If the tip bears clean cut, it may have been served with a sharp
instrument/article. If the cut is stepped or irregular or split in appearance, it is likely
to have been served by a blunt instrument/article. The shaft, i.e., length of the hair
may point to the body from which it came. A cross section of a hair may indicate the
508 A. Puri and N. Arya

part of body from which it originated. If it is triangular in shape with three concave
sides, it may be beard or mustache hair. Hair from the torso is usually oval- or
kidney-shaped. Hairs from the head are generally round, but curly hairs are some-
times oval. An examination of the root can tell the microscopic characteristic of hairs
such as

• Color.
• Hair form/texture.
• Length.
• Diameter.
• Pigmentation.
• Structure.
• Variability in growth pattern.

Hair varies from region to region on the body of the same person. Forensic
scientists distinguish six types of hair on the human body and each hair type has
its own shape and characteristics as follows:

1. Head hair.
2. Eyebrows and eyelashes.
3. Beard and mustache hair.
4. Underarm hair.
5. Auxiliary or body hair.
6. Pubic hair.

The experience in examining hair and the study of its characteristics will supply
far more information than can be obtained by the study of any classification pattern/
scheme. The identification has been focused majorly on morphological differences
rather than on physical properties. Using characteristics such as color, curliness, and
thickness may help identify different human hairs. Two of these properties, i.e.,
refractive index and density indicate great extension of their use in the future. The
refractive index of a pure compound is a constant and is an extremely valuable factor
in the identification of the compound. In case of hair, which is not a pure compound
and is not even homogenous, it is apparent that the refractive index is an empirical
value and its determination must be performed in a prescribed and reproducible
manner in order to achieve significant result. Studies of the density of hair have been
far less extensive than studies of refractive index. Because the determination and use
of density as a comparative factor permit a hair to be picked from among sample
taken from perhaps as many as eight or ten persons, the relation of the density of the
hair to sex, age, and origin is at present almost completely unknown.
Internally, there are three main structural layers in a hair, namely the cuticle, the
cortex, and the medulla. Examination of each of these parts gives useful information.
The outer layer, or cuticle, consists of overlapping scales, with the free ends of the
scales directed toward the tip of the shaft. Just beneath the cuticle is the cortex, made
up of compact, elongated cells and often containing pigment granules made of
33 Hair Analysis 509

Fig. 33.2 Structure of hair

melanin present in the hair follicles that are originally produced by melanocytes,
which appear like nerve cells. Inside or the cortex of a hair shaft is also different in
both inter- and intra-species as the medulla and pigmentation vary according to the
localities. When differentiating human and animal hair, it is necessary to look at
these features in detail. The central core of a hair shaft is the medulla, composed
largely of air spaces. Medulla is one of the more valuable morphological identifying
characteristics. In human and certain anthropoids the medulla is narrow, occupying
only about one-third of the shaft width. Medulla is classified as continuous, inter-
mittent, or fragmental. Human hair normally shows a fragmental medulla, but many
individual hairs show no medullary material at all, and sometimes a single hair may
have an almost continuous medulla. There is evidence to indicate that only hairs
above a certain diameter will contain medullation and the larger the hair the more
nearly continuous the medullation will be. The ratio of medulla diameter to that of
the shaft is known as the medullary index. The following information can be
obtained from the examination of hair (Fig. 33.2):

• Is the sample a hair or any other material?

• Are the hairs of human or animal origin?
• From what part of the body have they originated?
• Does the hair come from a man or woman?
• How old is the person from whom the hairs have originated?
• Does the hair belong to a certain individual?
• Are the hairs dyed?
• Does it fall naturally or not?

In humans, body hair is mostly reduced, and it does not play as large a role in
temperature regulation as it does in other animals. When humans are born, they have
about five million hair follicles, only 2 percent of which are on the head. This is the
510 A. Puri and N. Arya

largest number of hair follicles a human will ever have. As a human ages, the density
of hair decreases.

33.1.2 Animal Hair Characteristics

Human and animal hair are structures that have a similar appearance, but structurally
they differ. Animal hair is of three types: vibrissae, bristle, and wool. All those three
types are very important for their lifestyles as they involve different functions.
Identifying whether the hair is human or animal is the first step in forensic hair
analysis. Animal hair is sometimes very important as physical evidence, and its
distinction from human hair and its identification as to species are very important
matters. Experienced forensic experts have little difficulty in making the distinction
at any time, when police are required to make sure that any hair whether human or
animal in origin. The obtained information may be employed to establish facts
pertinent to the investigation. Human and animal hairs show similarities in having
an outer cuticle, cortex, and medulla. The outer surface of the hair is covered by
scales. Though there are similar morphological features, the scale pattern provides
distinguishing characteristics between animal and human hairs. The scales of an
animal’s hair show many distinctions such as coronal and spinous patterns, whereas
in the case of humans the scale of “imbricate” pattern. Human hairs usually have a
thin or an absent medulla region. Animal hairs usually have thick medullae. Human
and animal hairs can be differentiated by color, tip, cuticle, root, cortex, and other
special characteristics. Various morphological characters like the shaft diameter and
its variations along the length, spatial variation, cross-sectional shape, and pigment
distribution are often found suitable for the identification of human and animal hair.
The key difference between human and animal hair is that human hair does not stop
growing; hence, it is longer while animal hair stops growing when it reaches a certain
length; therefore, it is shorter (Table 33.1).
The next step is comparing the found hair to known suspects or animals present at
the crime scene. This analysis can be subjective based on the person’s experience
with identifying the shape of the medulla. As per the necessity of the case, many
times simple identification of animal or human origin is sufficient in providing
potential leads.

33.2 Comparison Process and Analysis

Morphological examination of hair samples is the first step in forensic hair

comparisons. The main medico-legal concerns with hair examination include identi-
fication of the species of origin, ascertainment of the hair’s provenance from the
body, and, finally, comparison of the control hair sample from the victim to the hair
sample from the crime scene. Though it is not possible to definitely identify a sample
of hair originating from a particular person’s head, unequivocal determination of
human origin can be established based on microscopic examination of the hair’s
33 Hair Analysis 511

Table 33.1 Differences between human hair and animal hair

Characteristics Human hair Animal hair
Cuticular – Flattened – Projecting large and in various
scales – Small with irregular margins patterns
Medulla – Fragmental discontinuous or – Discontinuous or even
may be absent continuous
– Diameter usually less than 1/3 – Diameter is usually more than
of the shaft diameter half of the shaft diameter
– Thinner – Thicker
Shaft – Diameter between 50 and – Diameter less than 25 or more
150 microns than 3000 microns.
Pigment – Rarely absent – May be absent
– Evenly distributed – Present near medulla
Length Much longer Shorter
Growth Does not stop growing Stop growing when reaches a certain
length
Color Consistent from root to tip May change several times from root to
tip

cuticle, cortex, medulla, and pigment granules. Hair proceeds through three stages as
it develops. The first stage is called the anagen stage and lasts approximately
1000 days. Eighty to ninety percent of all human hair is in the anagen stage. This
is the period of active growth when the cells around the follicle are rapidly dividing
and depositing materials within the hair. The second stage, i.e., catagen stage,
follows as the hair grows and changes. The catagen stage accounts for about
2 percent of all hair growth and development. The third and final stage is the telogen
stage. During this stage, the hair follicle is dormant or resting and hairs are easily
lost. About 10 to 18 percent of all hairs are in the telogen stage. There is no pattern as
to which hairs on the head are in a particular stage at any time. Forensic scientists
usually study the hair’s scale pattern and appearance of the medulla to identify hair
of unknown origin and perform three major types of hair analysis:

1. Testing the hair shaft for drugs in a person’s system.

2. Analyzing DNA collected from the root of the hair
3. Viewing Hair under a Microscope to Determine Its Origin

It is only in the last few years that serious attention has been given to the forensic
use of information obtained from hair analysis in the investigation.
In crimes involving struggle, a victim may have hairs in his fist. In sexual assault
cases, pubic hairs may be found on the genitals of the accused and victim. Therefore,
the search should be concentrated on places where one can expect to find hairs left by
criminals. Samples of questioned hair will most commonly be found in vacuum
sweepings or will be picked from a suspect’s clothing. In order to examine hair
evidence collected in an investigation, it is a must to take exemplars from the
individuals involved. A court order may be required to obtain hair specimens from
a defendant. Hair may be collected by the medico-legal doctor or investigator.
512 A. Puri and N. Arya

The standard hairs are collected from the head, pubes, and other relevant body
areas of the individual suspected of being the source of the questioned hairs, which
are necessary for comparison with questioned hairs.
Initially, color is ascertained by visual and microscopic examination and the
length and other broad characters are noted. The microscopic examination provides
a good deal of information about the shape and size of the cuticular scales, appear-
ance, and diameter of the medulla in relation to the shaft diameter. Attempts aimed at
identifying the intrinsic biochemical markers like the blood group substance, the
proteins, or their byproduct. The electrophoretic pattern of polypeptides of hair from
different primates has been found species-specific and applied to the study of
proteins and enzymes in hair root sheath. Conventional chemical methods for the
study of hair are destructive of the evidence. The applicability of such physic-
chemical method appears to be promising for use in the future. With the advance-
ment of forensic DNA typing, microscopic hair comparisons and DNA analysis can
be complementary and provide information on the source of hair. Hair analysis is
done by evaluating hair structure and DNA from cells attached to the root of the hair.
It can be used to find out if people are related. Forensic hair analysis can be done to
help identify a person who may have been present at a crime scene.
Human hair contains two types of DNA. Nuclear DNA is found in the tissue at the
root of a strand of hair, while mitochondrial DNA is found in the shaft of hair itself.
Initially, only nuclear DNA could be extracted and analyzed, but today, both types of
DNA can be used to help identify individuals. If a hair is deemed not suitable for
nuclear DNA analysis, it can be sent for mitochondrial DNA testing. A root does not
have to be present in order for a hair to be suitable for mitochondrial DNA testing.
Extensive work is yet necessary for universal acceptance of these approaches to
the examination of even small pieces of hair. All these techniques are suggestive of
hair identification in the criminal justice system.

Multiple Choice Questions

1. Which preservative is used for preserving hair?

(a) Rectified.
(b) Norman saline.
(c) Buffer.
(d) No preservative is required.
Answer (d)
2. Innermost layer of human hair is.
(a) Cortex.
(b) Scale.
(c) Medulla.
(d) Cuticle.
Answer (c)
3. Which of the gland secrets oil in hair?
(a) Sebaceous gland.
(b) Parotid gland.
33 Hair Analysis 513

(c) Pituitary gland.

(d) All of the above.
Answer (a)
4. The type of hair present on an unborn baby.
(a) Coarser hair.
(b) Vellus hair.
(c) Terminal hair.
(d) Lanugo hair.
Answer (d)
5. Hair samples collected from the scene of crime from different spots must be
packaged.
(a) Collectively.
(b) Separately.
(c) Hardly matters.
(d) Whatever is easy.
Answer (b)
6. DNA profiling of hair is possible.
(a) From hair tip.
(b) From cut hair.
(c) From rooted hair.
(d) All of the above.
Answer (c)
7. Study of hair is known as.
(a) Histology.
(b) Palynology.
(c) Trichology.
(d) Pathology.
Answer (c)
8. Difference between human hair and animal hair can be done on the basis of.
(a) Size.
(b) Medulla.
(c) Diameter of shaft.
(d) All of the above.
Answer (d)

References
Butler JM (2010) Fundamentals of forensic DNA typing. Academic, Cambridge, MA, p 101
Chojnacka K, Gorecka H (2006) The effect of age, sex, smoking habit and hair color on the
composition of hair. Environ Toxicol Pharmacol 22:52–57
Cortellini V, Carobbio A, Brescia G (2019) A comparative study of human and animal hairs:
microscopic hair comparison and cytochrome c oxidase. J Forensic Sci Med 5:20–23
Dahiya MS and Yadav SK (2013) Elemental composition of hair and its role in forensic investiga-
tion. Scientific Report https://doi.org/10.4172/sciencereports722
514 A. Puri and N. Arya

Elizabeth AG and David RF, 2005.A Simplified method for mitochondrial DNA extraction from
head hair shafts. J Forensic Sci 50:5
Fatma A, Madkour, Abdelsabour-Khalaf M (2021) Scanning electron microscopy of the nasal skin
in different animal species as a method for forensic identification. Microsc Res Tech 85(5):1643
Harrison S, Sinclair R (2003) Haircoloring, permanent styling and hair structure. J Cosmet
Dermatol 2:180–185
Kempson IM, Skinner WM, Kirkbride KP (2007) The occurrence and incorporation of copper and
zinc in hair and their potential as bioindicators : a review. J Toxicol Environ Health B10:611–
622
Patle S, Bagchi D, Singh KP (2022) Comparative study of morphology and keratin levels in hair
from deer and goat. J Threat Taxa 14(12):22346
Pilli E (2012) Human and animal hair in forensic evidence: problems, troubleshooting and
workarounds. J Forensic Sci:1–58
Rogers GE (2004) Hair follicle identification and regulation. Int J Dev Biol 48:163–170
Scientific Working Group on Materials Analysis (SWGMAT) (2005) Forensic human hair exami-
nation guidelines
Tafaro JT (2000) Use of microscopic postmortem changes in anagen hair roots to associate
questioned hairs with known hairs and reconstruct events in two murder cases. J Forensic Sci
45:495–499
Taylor AS (2007) The principles and practice of medical jurisprudence. Churchill Livingstone,
London
Forensic DNA Database
34
Rutwik Shedge, Aditi Iyengar, Monisha Samuel, and Tanya Chauhan

Abstract

In the previous chapters we learned about how DNA is extracted using different
methods and how its PCR amplification and STR typing is done. We receive
results of these methods in the form of an electropherogram—which gives us the
details about STR polymorphisms present in the DNA of a particular sample. If
we have different samples, for example, the blood of a suspect and the blood and
tissues recovered from underneath the fingernails of the victim, we can simply
extract and profile the DNA from both the samples and compare them to find out
whether they belong to the same individual. However, in certain cases, we do get
the perpetrator DNA, but without anything to compare it with. In the same case as
above, if the police do not have a suspect pool, any DNA profile generated from
the tissue recovered from victim’s fingernails will have to be stored until a suspect
is identified. Thus, the first DNA databases were created, which were essentially
repositories of DNA of convicted criminals, and were used as tools to assist law
enforcement individuals in solving crimes. Whenever any unknown biological

R. Shedge (✉)
School of Forensic Science, National Forensic Sciences University, Gandhinagar, Gujarat, India
A. Iyengar
Impact Science, Cactus Communications, Mumbai, India
M. Samuel
School of Forensic Science, National Forensic Sciences University, Gandhinagar, Gujarat, India
Department of Forensic Science, National Forensic Sciences University, Delhi Campus, New Delhi,
Delhi, India
T. Chauhan
Department of Forensic Science, National Forensic Sciences University, Tripura Campus, Agartala,
Tripura, India

# The Author(s), under exclusive license to Springer Nature Singapore Pte 515
Ltd. 2024
A. Puri et al. (eds.), Fundamentals of Forensic Biology,
https://doi.org/10.1007/978-981-99-3161-3_34
516 R. Shedge et al.

sample was recovered by the law enforcement agencies, its DNA was profiled and
compared with the profiles present in the DNA database.

Keywords

DNA database · DNA profile · CODIS · Extended CODIS · NDNAD

34.1 Definitions

DNA database: A repository of DNA profiles collected from unknown perpetrators,

crime scenes, missing individuals, relatives of missing individuals, convicts, and
accused individuals.
CODIS: Combined DNA Index System or the national DNA database of the
United States of America.
NDNAD: the National DNA Database of United Kingdom.

34.2 History of Forensic DNA Databases

34.2.1 NDNAD

In 1994, the Criminal Justice and Public Order Act was passed by the British
parliament, and this laid the foundation stone for the first ever forensic DNA
database: the National DNA Database (NDNAD) (Wallace 2006). The Criminal
Justice and Public Order Act allowed the police to take DNA samples from anyone
charged with a “recordable” offence without their consent, and to search the database
for any matching profiles (Wallace 2006). These recordable offences included
almost all the crimes, from homicide to even being drunk, begging, and participating
in an illegal protest. The NDNAD was declared to be functional in 1995 but was
restricted to only the most heinous crimes (homicides, sexual assaults, violent
crimes, etc.) because of the lack of funds and resources. By 2020, the NDNAD
had 6.6 million profiles stored within it.

34.2.2 DPD

In 1996, the New Zealand Police in collaboration with the Institute of Environmental
Science and Research (ESR) created a central DNA database known as the DNA
profile databank (DPD) that had a collection of DNA profiles from convicted
offenders and volunteers (Harbison et al. 2001). The DPD never included any
profiles from suspects and had profiles only of individuals convicted with offences
that had more than 7 years of imprisonment. The profiles within the DPD are never
removed unless the conviction is quashed.
34 Forensic DNA Database 517

34.2.3 Austrian DNA Intelligence Database

In 1997, the Austrian DNA Intelligence Database was established, and it consists of
two units: the executive branch located in the ministry of Interior in Vienna and the
laboratory present in the Institute of Legal Medicine, University of Innsbruck.
Buccal swabs of any individual suspected of commission of recordable crimes are
taken, and DNA profile is generated from it (Parson et al. n.d.). The profile is
removed only after acquittal.

34.2.4 The Dutch DNA Database

Netherlands made its own DNA database operational in 1997 and is administered by
the Secretary-General of the Dutch Forensic Institute (NFI). Complete, partial, and
mixed profiles are stored in the database (Amelung et al. 2020a). DNA of only those
individuals, whose profile is needed for investigation of a particular crime, whose
penalty may be imprisonment of more than 4 years, is stored in the database. Also,
the profile of the convicted individual is removed after 20–30 years of conviction
(Li 2021).

34.2.5 The German DNA Database

Germany established its DNA database in 1998 under the leadership of its Minister
of Interior (Amelung et al. 2020b). By 2018, there were about 900,000 profiles
stored within the database. DNA profiles of all individuals accused of commission of
crimes which have a penalty of more than 1 year imprisonment are entered in the
system. The profiles are removed only if the accused is found not guilty, or after
5–10 years of conviction in case of convicts exhibiting good behaviour in the prisons
(Li 2021).

34.2.6 DNA Databases in the Western Balkans

In the early 1990s, the identification of human skeletal remains from mass graves
was undertaken in the countries of western Balkan region – Bosnia and Herzegovina,
Croatia, Macedonia, and Kosovo (Marjanović et al. 2011). The scientists leading
these missions of humanitarian forensics faced a lot of issues while trying to develop
the biological profile of victims and started working towards the construction of
DNA databases. In 1998, Slovenia became the first western Balkan country to
establish a forensic DNA database. In Slovenia, the DNA profile of any individual
suspected of having committed a recordable crime is added to the database
(Li 2021). Croatia followed Slovenia’s lead and established its own DNA database
under the aegis of Mister of Interior in 2001. The countries of Bosnia and
Herzegovina, Croatia, Montenegro, and Macedonia have drafted action plans and
518 R. Shedge et al.

are currently in the process of establishing their DNA databases (Marjanović et al.
2011).

34.3 DNA Database Entries and Expansion

The criteria for the entry of a DNA profile in the DNA database varies from country
to country. As seen in the history section of the current chapter, a few countries such
as New Zealand and Netherlands add the DNA profile of only convicts who have
been jailed for crimes that have a punishment of imprisonment of 7 and 4 years,
respectively. On the other hand, in countries such as Austria and Switzerland, the
DNA profiles of even the suspects of a crime are added to the national database. In a
country like the United States of America, the criteria for entry of a DNA profile to
the database depends upon not only the federal laws, but also the laws of the state in
which the crime has occurred. 31 of 50 states of the USA have DNA arrestee laws,
29 out of these 31 states collect DNA for some state felonies, while 8 out of 31 collect
DNA from arrestees for certain misdemeanours too. Out of these 31states, 8 states
apply their laws to juveniles as well (Samuels et al. n.d.).
DNA databases are constructed with the goal of assisting the law enforcement
agencies in investigation of crimes. They are used to compare DNA profiles from
crime scenes with DNA profiles of known offenders, or profiles generated from other
crime scenes. Traditionally, the DNA profile in question includes a typical autoso-
mal STR panel along with amelogenin. However, a new strategy that is being
employed currently to increase the scope of comparison is to expand the DNA
profiles of the DNA database. This expansion entails DNA typing beyond the core
13 STR + amelogenin sex locus, by using Y-STRs (Short Tandem Repeats on the Y
chromosome), mitochondrial DNA typing (mtDNA), SNP profiling (Single Nucleo-
tide Polymorphisms) on autosomes, and whole genome sequencing (WGS). Y-STRs
have their applications in paternity testing, identification of missing male
individuals, identification of male DNA in a mixture of male and female DNA
(cases of sexual assaults), identification of number of male perpetrators in a sexual
assault case, etc. Mitochondrial DNA typing has its utility in maternity testing and
identification using shed and cut hair shafts, etc. SNPs are useful in identification
when the forensic evidence consists of degraded or low copy number DNA. Whole
genome sequencing may prove to be the best solution for forensic case work as it can
provide the most data (autosomal STRs, Y-STRs, SNPs, etc.) from a single sample.
Expansion of DNA databases also entails expansion of the DNA profile pool. For
instance, earlier samples were collected from only the convicted felons in violent
crimes for DNA profiling and entry into the database. However, as times progress,
newer crimes are being included in the list for which DNA profile from the convict is
necessary. Also, in some countries, the DNA is collected from suspects of a crime,
and the profile is maintained within the national DNA database unless the individual
is acquitted or removed from the suspect pool. In some countries, it is also suggested
that the database should include, along with the perpetrator, accused, and suspect
profiles, the general population profiles. This will ensure quick identification of
34 Forensic DNA Database 519

victims of abduction, kidnapping, missing individuals, and even major accidents and
mass disasters (Wickenheiser 2022).

34.4 CODIS

34.4.1 CODIS Infrastructure

CODIS, or the Combined DNA Index System, is the national DNA database of the
Unites States of America and was established by the Federal Bureau of Investigation
(FBI) through the Congressional DNA Identification act in 1998 (Panneerchelvam
and Norazmi 2003). CODIS identified 13 STR loci (Table 34.1) that were
implemented in 1998 for DNA profiling purposes. CODIS has three hierarchical
levels: LDIS, SDIS, and NDIS (Crouse et al. 2019; Li 2021).
LDIS stands for the Local DNA Index System and is maintained in all the local
laboratories managed by the police departments and Sheriff offices. Any DNA
profile generated at these law enforcement departments at a local level are uploaded
in the LDIS, and through LDIS, they are transmitted to the SDIS and the NDIS. SDIS
stands for the State DNA Index System and is present in each of the 50 states of
USA. The SDIS is maintained by a state forensic science laboratory. SDIS allows
any one local law enforcement agency to compare DNA profiles generated in that
local area across all the other DNA profiles generated by the different local agencies
in any state. SDIS also allows for the transmission of DNA profiles from LDIS to
NDIS, and any reports or messages from the NDIS to the LDIS. NDIS, or the
National DNA Index System is the highest level of CODIS, and has the DNA
profiles from all the LDIS and SDIS, along with any DNA profiles that the federal
labs generate. NDIS is administered and maintained by the FBI. FBI can also allow

Table 34.1 STR markers used in CODIS

Sl. No. Locus STRs
1 AMEL Amelogenin
2 CSF1O Human c-fms protooncogene of CSF-1 receptor
3 D3S1358
4 D5S818
5 D7S820
6 D8S1179
7 D13S317
8 D16S539
9 D18S51
10 D21S11
11 FGA Fibrinogen alpha chain
12 TH01 Tyrosine hydroxylase 1
13 TPOX Human thyroid peroxidase
14 VWA Von Willebrand factor
520 R. Shedge et al.

foreign governments to compare their DNA profiles in the CODIS upon proper
request by the foreign government to FBI or the INTERPOL (International Criminal
Police Organization).

34.4.2 CODIS Indices

CODIS organizes all the DNA profiles entered in it into categories known as indices.
DNA profiles of individuals convicted of crimes are added to the Convicted
Offender Index, while the DNA profiles of individuals that have been arrested for
commission of a crime, are added to the Arrestee index. The criteria for inclusion of
a DNA profile in the arrestee index varies from state to state. The DNA profiles
generated from evidences found at the scene of crime in forensic cases are stored in
the Forensic Index. The FBI has also established the NMPDD or the National
Missing Person DNA Database, for easier identification of missing persons and
unidentified skeletal remains. The NMPDD consists of three subcategories: the
Missing Person Index for storing DNA profiles of missing persons, the Unidentified
Human Remains index for storing DNA profiles generated from unknown dead
bodies and remains, and the Biological Relatives of the Missing Person Index which
stores the DNA profiles of relatives of missing persons that have voluntarily donated
their samples.

34.5 Forensic Investigation Using Database Searches

The goal of developing and maintaining a DNA database is to provide the law
enforcement agencies with a tool for further forensic investigation. The whole point
is to keep a repository of DNA profiles generated from convicts, arrestees, and
different scenes of crime, so that comparison can be made between a DNA profile
generated from a fresh case and the profiles stored in the repository. Broadly, there
are three scenarios in which forensic investigation is done using databases:

34.5.1 Case-to-Offender Searches

The hypothesis in case-to-offender searches is that the DNA profile generated from a
sample left by the perpetrator can be matched to a suspect or convict of some other
crime. For example, consider a case where in a female victim has been sexually
assaulted and killed in an overgrown farmland. The investigators find upon closer
examination, some tissue, and blood underneath the victim’s fingernails. The foren-
sic scientists working this case manage to generate a DNA profile from the blood and
tissue found underneath the victim’s fingernails. The DNA profile generated is
entered in the national DNA database of the country, and the investigators find a
match with an individual that was convicted 10 years ago for physical assault of
another female. This suspect had been released 3 years ago and has since then been
34 Forensic DNA Database 521

loose. Thus, forensic DNA database search helped the investigators in finding the
perpetrator of the case they are investigating.

34.5.2 Case-to-Case Searches

The hypothesis in case-to-case searches is that a serial offender may leave DNA at
each of their different crime scenes, and matching the profiles of different samples in
different scenes will help investigators in concluding that the multiple crimes have
been committed by the same individual. For example, consider a case series of
sexual assaults and homicides. At the first scene of crime, investigators find semen
sample near the inner thighs of the female victim. They send the collected biological
fluid to the forensic science laboratory, where a DNA profile is generated and stored
in the DNA database. A few months later, a similar scene of crime is identified where
another female victim has been sexually assaulted and murdered. Semen is again
recovered from the person of the victim and sent for DNA profiling. The DNA
profile is then stored in the national DNA database. When the DNA profiles of semen
recovered from scene 1 and scene 2 are compared through the DNA database, it is
observed that both the semen samples belonged to the same individual. Thus, two
cases are thus linked using case-to-case searches.

34.5.3 Familial Searches

Familial searches are employed in cases of missing persons, when the antemortem
DNA profile of the missing individual is absent. In this case, if an unknown dead
body is recovered, a DNA profile is generated from the body and stored in the DNA
database. Eventually, DNA profiles of suspected missing person’s relatives are
generated and compared with the missing person’s DNA profile stored in the
database. This can allow for repatriation of the victim.

Multiple Choice Questions

1. The first ever national DNA database was established in which of the following
countries?
(a) Austria.
(b) Moldova.
(c) United Kingdom.
(d) United States of America.
Answer: (c)
2. CODIS stands for.
(a) Combined DNA identification system.
(b) Combined DNA index system.
(c) Combined DNA identification service.
(d) Combined DNA international service.
522 R. Shedge et al.

Answer: (b)
3. The highest level in the CODIS infrastructure is __________.
(a) LDIS.
(b) SDIS.
(c) NDIS.
(d) NDNAD.
Answer: (c)
4. The STR panel used for DNA profiling in CODIS consists of ____________.
(a) 13 autosomal STR + Amel locus.
(b) 16 autosomal STR + Amel locus.
(c) 19 autosomal STR + Amel locus.
(d) 22 autosomal STR + Amel locus.
Answer: (a)
5. Which of the following is not a CODIS index?
(a) Arrestee index.
(b) Convicted offender index.
(c) Suspect index.
(d) Forensic index.
Answer: (c)

References
Amelung N, Granja R, Machado H (2020a) The Netherlands. Pp 73–87
Amelung N, Granja R, Machado H (2020b) Germany. Pp 55–71
Crouse CA, Bauer L, Sessa T et al (2019) Combined DNA index system (CODIS)-based analysis of
untested sexual assault evidence in Palm Beach County Florida. Forensic Sci Int Synergy 1:
253–270. https://doi.org/10.1016/j.fsisyn.2019.09.005
Harbison SA, Hamilton JF, Walsh SJ (2001) The New Zealand DNA databank: its development and
significance as a crime solving tool. Sci Justice 41:33–37. https://doi.org/10.1016/S1355-0306
(01)71846-1
Li R (2021) Forensic biology: identification and DNA analysis of biological evidence. CRC, Boca
Raton, FL
Marjanović D, Konjhodžić R, Butorac SS et al (2011) Forensic DNA databases in Western Balkan
region: retrospectives, perspectives, and initiatives. Croat Med J 52:235–244. https://doi.org/10.
3325/cmj.2011.52.235
Panneerchelvam S, Norazmi MN (2003) Forensic DNA profiling and database. Malays J Med Sci
MJMS 10:20–26
Parson W, Steinlechner M, Berger B, et al (n.d.) Laboratory Strategy of the Austrian DNA
Intelligence Database. 2
Samuels J, Dwyer A, Halberstadt R, Lachman P Collecting DNA from Juveniles. 67
Wallace H (2006) The UK national DNA database: balancing crime detection, human rights and
privacy. EMBO Rep 7:S26–S30. https://doi.org/10.1038/sj.embor.7400727
Wickenheiser RA (2022) Expanding DNA database effectiveness. Forensic Sci Int Synergy 4:
100226. https://doi.org/10.1016/j.fsisyn.2022.100226
Diatom Testing
35
Preetika M. Chatterjee

Abstract

Whenever a dead body is discovered in any water body, the prime question to be
dealt by a forensic pathologist is to determine whether the death is due to
drowning or it is the result of disposal after death. It is challenging to determine
the cause of death in such cases and to differentiate a death due to drowning or
other reasons. Drowning signs like pale skin colour, occurrence of froth in mouth
and nostrils are clearly apparent in recent deaths due to drowning, however, with
the passage of time these signs tend to disappear due to prolonged immersion of
the dead body in the water body and advancing decomposition process. In case of
drowning, water aspirated by the person into his lungs ultimately enters the main
blood stream via alveoli in addition to the other micro-organisms and small
impurities present in the water. Forceful inspiration and expiration causes the
development of microscopic tears in the alveolar wall and the micro-organisms
and micro-particles travel through these microscopic tears into the blood stream
and ultimately to multiple organ sites and get deposited in the capillaries of these
organs. These particles include a group of algae, commonly known as diatoms
which tend to remain in the biological tissues and organs for longer periods of
time and play a significant role in the determination of death due to drowning.

Keywords

Diatoms · Drowning · Death due to drowning · Postmortem drowning

P. M. Chatterjee (✉)
Department of Forensic Science, MATS University, Raipur, Chhattisgarh, India
e-mail: [email protected]

# The Author(s), under exclusive license to Springer Nature Singapore Pte 523
Ltd. 2024
A. Puri et al. (eds.), Fundamentals of Forensic Biology,
https://doi.org/10.1007/978-981-99-3161-3_35
524 P. M. Chatterjee

35.1 Use of Diatoms in Drowning

Whenever a dead body is discovered in any water body, the prime question to be
dealt by a forensic pathologist is to determine whether the death is due to drowning
or it is the result of disposal after death. It is challenging to determine the cause of
death in such cases and to differentiate a death due to drowning or other reasons.
Drowning signs like pale skin colour, occurrence of froth in mouth and nostrils are
clearly apparent in recent deaths due to drowning, however, with the passage of time
these signs tend to disappear due to prolonged immersion of the dead body in the
water body and advancing decomposition process. In case of drowning, water
aspirated by the person into his lungs ultimately enters the main blood stream via
alveoli in addition to the other micro-organisms and small impurities present in the
water. Forceful inspiration and expiration causes the development of microscopic
tears in the alveolar wall and the micro-organisms and micro-particles travel through
these microscopic tears into the blood stream and ultimately to multiple organ sites
and get deposited in the capillaries of these organs. These particles include a group of
algae, commonly known as diatoms which tend to remain in the biological tissues
and organs for longer periods of time and play a significant role in the determination
of death due to drowning.
Diatoms specifically pertaining to crime scene evidences and victims are studied
under a sub-field of fresh water ecology called Forensic Limnology. It includes
various methods of collection, analysis, identification and comparison to standard
database in order to estimate the diatom colonies ratio available in the sample with
those of crime scene locations. In forensic cases related to secondary crime scene,
the criminals sometime dump the dead body into the water body upon commission of
crime either to dispose off the body or to simulate cause of death to be due to
drowning. Macroscopic findings like plume of froth on mouth and nostrils, heavy
lungs and emphysema, Paltaufs spots, eodema aquosum, frothy trachea and pleural
effusions are major indicators of death due to drowning. However, these symptoms
diminish with the passage of time and effect of putrefaction. Diatoms are resistant to
decomposition and in cases of deaths due to drowning in skeletonized bodies or
bodies in advance decomposition stages, are the only prediction factors left with
respect to ant mortem or postmortem drowning. It is done by comparing diatom
density and nature or type of diatom species present in the organ sample to that of the
control water sample obtained from the water body site of recovery of the drowned
body. Since its discovery, diatom test has been the most important test used in
forensic case scenario for the detection of deaths due to drowning. Diatoms were
detected in the lung fluid for the first time by Hoffmann et al. followed by its
successful detection in the blood stream and parenchymal organs by Incze, who
also reported the entrance of diatom into bloodstream through lungs. Tamasaka et al.
discovered diatoms in organ tissues and bone marrow directly representing ante
mortem aspiration of water during drowning (Fig. 35.1).
Diatoms bear acid-resistant silica shells called frustules which enable its separa-
tion from the organ tissues using the extraction method of acid digestion. These
frustules bear morphological characters which are well preserved and apparent even
35 Diatom Testing 525

Fig. 35.1 Diatom colony of

Diatoma vulgaris spp.
(Source: Harding et al., 2007)

after rigorous chemical digestion. Diatom species which are unique and specific to
certain habitats are best suited to be used as evidence in linking a crime scene to the
victim. However, it is not the case in every crime scenario as most of the different
diatom species are available in varied aquatic environments. None the less, the
diatom species vary in abundance from water body to water body as it is highly
sensitive towards environmental changes such as temperature, nutrients, pH, etc.
Thus the site of drowning can be determined owing to comparison of diatom species
occurrence ratio or abundance patterns obtained from the tissues with those derived
from the suspected water body site samples. Diatom test can be further used for the
identification of individuals, clothing or belonging recovered from the sites of
drowning. The major factors pertaining to diatom test are concentration of diatoms
in lungs in addition to the development of river monitoring programme in the area of
investigation. Medicolegal investigation of drowning deaths are specifically
benefitted by the continuous fresh water site monitoring and a comprehensive
species level inventory development of diatom flora at such sites.
Qualitative and quantitative distribution of diatoms in human body is variable and
thus is an important distinguishing factor for ante mortem and postmortem drown-
ing. The easily available organs like lungs and stomach shoe higher diatom density
owing to the process of passive percolation through nostrils or mouth. The density of
diatoms undergoes decrease in concentration by factor of 10–100 during passage
from the drowning medium into lungs or stomach. However, this density dip reaches
the factor of 100–1000 upon transition from lungs to blood, kidneys, liver or bone
marrow. Deeper the organ tissue lesser will be the diatom deposition density.
However, contrary situation may arise in case of prolonged intake of contaminated
water from natural water bodies. It can also be utilized to identify the geographic
origin in case the unknown dead bodies. Hence, the validity of diatom test based on
shape and number of valves derived from the tissue sample varies from 20 to
40 diatoms per 5 gm of bone marrow, 5 complete diatoms from 100 μL of tissue
sediment of brain, kidney, liver, 37 diatom valves in heart tissue, 20 diatom valves in
526 P. M. Chatterjee

Fig. 35.2 Diatoms under

light microscope. (Source:
Harding et al., 2007)

Fig. 35.3 Diatoms under

Phase contrast microscope.
(Source: Harding et al., 2007)

liver tissue and lung tissue to positively include or exclude results due to contami-
nation. Species composition of diatoms varies in different sites of drowning based on
the factors such as salinity, temperature, pH, inter-species competition. Thus, the
species compositions pertaining to forensic samples are helpful in the prediction of
geographic locations, habitat and time of year. Diatoms found particularly in certain
restricted locations or site-specific endemic diatom species can be used as site
identification markers in suspected drowning cases. In case of putrefied drowning
cases, time of year can be predicted to a considerable extent. Hence, comparison of
diatom species derived from suspected drowning site and organ tissue of drowned
victim, based on nature, number and distribution of diatoms is indicative of death
due to drowning or otherwise (Figs. 35.2, 35.3 and 35.4)
Sometimes instant death in water body due to weak heart conditions, pulmonary
or circulatory system of the victim may decrease the time required for drowning,
hence, decrease the amount of water inspired. Only small sized diatoms or valve
35 Diatom Testing 527

Fig. 35.4 Diatom under

Scanning electron
microscope. (Source: USGS.
gov)

fragments can enter the organ tissues of drowning victims within the size range of
about <110 μm. Contamination from the reagents, glass containers may add to the
ambiguity of the test. Thus, diatom free water should be used while handling diatom
samples to prevent it from exogenous diatom contamination along with careful
handling of clothes and skin during autopsy to prevent contamination of internal
organs from them. All these factors contribute towards negative results or cause
ambiguity of diatom test, if not taken care of properly, lowering down its evidentiary
value in the court of law. Thus, all these factors should be kept in mind and dealt with
while handling diatom samples from both the body of the victim as well as the
suspected site of drowning.

35.2 Structure of Diatoms

Diatoms mostly exist singly, although some may combine to form colonies. They are
usually yellowish or brownish in colour and lack any flagella. Diatoms give a slimy
or mucilaginous feel. They appear in seston or suspended form. Diatoms secrete a
silicaceous outer covering or cell walls called frustules or test, marked with minute
pores or depressions allowing the organism to interact with its environment. Loco-
motion and attachment to substrata or other cells to form colonies is facilitated by
secretion of mucilage from the cell wall. The frustules are made up of two thecas
which are generally in the form of two valves one slightly smaller than the other in
order to facilitate proper fitting together of the two thecas one inside the other. When
present in abundance in the water body, diatoms impart a golden brown color and
thus are also known as Golden brown algae (Fig. 35.5).
They are unique in a way that silica which being virtually inert and indestructible,
settles down in the bed of the water body after the death of the organism and
ultimately forms the diatomaceous earth. In other words, the diatomaceous earth is
formed by continuous deposition of silicaceous skeleton of diatoms. These
silicaceous parts provide the basis of information regarding classification and
528 P. M. Chatterjee

Fig. 35.5 Structure of a

typical Diatom. (Source:
Harding et al., 2007)

identification of these diverse organisms. The size range of diatoms, in general,

varies from 2 to 200 μm in diameter or length, however, they can be as large as up to
2 mm long in certain species. Diatoms contain many photo pigments like Chloro-
phyll a and c which are stacked type having 3–5 thylakoid membranes along with
carotenoid namely fucoxanthin present in plastids. They reproduce mostly by simple
cell division although, certain species also shoe sexual mode of reproduction. The
cell wall or the frustules are made of silica (SiO2) which is often intricate and bears
highly patterned morphological characters including a variety of pores, ribs, spines,
marginal ridges and elevations which are characteristic to different genera and
species and thus can be used to predict the same in a suspected diatom sample.
Diatoms are highly polymorphic and may attach together by the means of a gelatin
like material forming colonies which appear like ribbons. Motile diatoms are
diamond or boat shaped.

35.3 Classification of Diatoms

Diatoms belong to kingdom Protista class Bacillariophyceae which are unicellular,

autotrophic and eukaryotic organisms although some heterotropic or symbiotic
species are also present in specific habitat. They commonly belong to genera such
as Chaetoceros, Pseudonitzschia and Skeletonema. They inhibit almost every water
body like springs, rivers, ponds, lakes, ditches in addition to freshwater, brackish
water and marine waters. They can also be detected in terrestrial habitats like wet
rocks, mosses and soils or even caves in addition to microhabitat like solid substrata,
damp sediments and stems of rooted vegetation. They have highly complex taxon-
omy including more than 2,00,000 known species. However, many more are yet to
35 Diatom Testing 529

Fig. 35.6 Pennate Diatom

Fig. 35.7 Centrale Diatom.

(Source: Science Photo
Library)

be identified and described. Based on the shape of frustules, the diatoms can be
further classified into Centrales and Pennales where the centrales are radially
symmetrical while the pennales are bilaterally symmetrical. The centric species
have circular shape in adaptation to watercolumn habitat of phytoplankton while
pennate species prefer benthic habitats with rarely suspended in the water column
(Figs. 35.6, and 35.7).

35.4 Sample Collection

See Fig. 35.8.

Tools required for Diatom Sample collection.
Simple tools like plastic tray/clean 2 L dishes with lids, wide mouth sample
bottles of 100 mL and zip-lock plastic bags are required for storing the collected
diatom sample. For collection toothbrush or other similar brush, knife or spoon,
waterproof marking pen or labels, envelopes for collection of soil samples, plankton
530 P. M. Chatterjee

Fig. 35.8 Sample collection from drowning site

net, depth gauge, pipettes, latex tube fitted 100 mL syringe, Perspex tubes of 25 mm
diameter in addition to field notebook, record forms and camera for documentation.
Acid digestion method of diatom extraction was first applied in the year 1904 and
had been widely used since then irrespective of various controversies like its
ambiguous nature causing deviations in cause of death, its entry into the body
from other ways apart from lungs and so on. Still, the diatom test is recognized as
one of the prescribed methods in drowning death cases. For this the forensic
pathologist distinguishes the different diatom species on the basis of morphological
examination and pattern analysis microscopically. Tissue samples need to be
completely destroyed for extraction and detection of the diatoms from organ tissue
samples. Diatom frustules are resistant against the mucus of the respiratory system
and embolize from the circulatory system into internal organs. Bone being a closed
system requires the blood circulation to transport the diatoms into the marrow, where
other organs such as the lungs may become invaded passively. Hence, commonly
used sample for acid digestion in diatom test is bone marrow as it supports the ante
mortem drowning hypothesis and is least affected by contamination due to postmor-
tem submersion. However, other organ tissues like liver, lungs, sternum bone,
kidney and brain can also be utilized. The process starts with the removal of bone
marrow with a spatula into a flask followed by addition of approx. 50 mL nitric acid.
Then this suspension is boiled in a fuming hood on hot plate for approximately 48 h.
Upon cooling, the mixture is centrifuged and washed with double distilled water.
The sediment so obtained is then placed on a microscopic slide and examined under
the microscope specifically the phase contrast microscope for the presence of
diatoms. Different organs have been used as samples for detection of diatoms
using acid digestion method like bone marrow, lungs and sternum bone, kidneys,
35 Diatom Testing 531

Fig. 35.9 Types of Substratum for sample collection from drowning site

brain, liver. Other than nitric acid, H2SO4, HNO3 and H2O2 can also be used as
solvent for digestion of soft tissues such as kidneys, brain, liver and lungs. H2O2 has
been reported to be best suited for the digestion of clothing samples aiding the
forensic investigations. Soluene-350 has been tested to be best suited for samples
pertaining to sea water drowning. Water sample derived from the drowning site is
also analysed for the presence of diatoms which are then compared with the sample
tissue diatom species. For this 1–2 L of water sample is obtained from the site of
suspected drowning and added with a few drops of formalin. This solution is left
undisturbed overnight, decanted and the concentrate available at the bottom is
subjected to microscopic examination and comparison (Fig. 35.9).
Acid digestion method, however, may cause destruction of diatom structure. In
certain species such as Chaetoceraceae, Corethronaceae, Bacteriastraceae,
Rhizospleniaceae and Leptocylindraceae, the frustules are thinly silicified and are
easily digested by the use of acids, thus giving a notion of diatom absent during
analysis. However, this can be overcome or minimized by using Lefort aqua regia,
i.e., 3:1 ratio of nitric acid and hydrochloric acid. Conventional methods of acid
digestion suffer from the limitations of being time consuming, dangerous and
strenuous. Enzymatic digestion method to solublize soft tissue using Qiagen pro-
teinase K enzyme in addition to Qiagen buffer ATL and 5 N HCl is rather faster and
simpler method of diatom extraction with respect to suspected drowning cases.
Sensitivity of molecular biology techniques in the contemporary scenario is so
high that 16S RNA subunits of ribosomal RNA present in the planktonic DNA
present in human tissues can be detected in case of drowned victims. Samples
pertaining to highly putrefied samples can be easily and rapidly diagnosed with
the use of electric impedance spectroscopy. Another technique in this list can be
fluorimetry which can locate or isolate diatom species present in tissue or bone
samples using luminescence and fluorescent tags which can be highly useful in
comparison and differentiation of diatom species found at the suspected drowning
532 P. M. Chatterjee

sites from those present naturally. In addition, NCS, Protosol, ultrasonic irradiation
and membrane filtration are some other methods which can be used in place of acid
digestion in both fresh water as well as sea water diatom species. Detection of
diatoms in the bone marrow samples is a strong indicative of that the person was
alive and breathing at the time of drowning.

35.5 Microscopic Analysis and Identification of Diatom

For morphological examination of diatoms light microscope or phase contrast

microscopes are generally used. However, for detailed image of diatoms both
SEM and TEM are best suited. The electron microscope provides taxonomical
details with species distinctions which are sometimes so minute to be visualized
by light microscope. Nowadays, dark phase or electron microscopy is the major
methodology utilized in the analysis of diatoms. TEM (transmission electron micro-
scope) is capable of noticing the fine and delicate details present in the diatom
species even in less silicified species such as Chaetoceraceae, Corethronaceae,
Bacteriastraceae, Rhizospleniaceae and Leptocylindraceae. SEM (scanning elec-
tron microscope) provides the best visualization of the complete diatom frustules and
the gross morphology of both internal as well as external features of the diatom.
Unequivocal occurrence of diatoms on the microscopic slide show positive results in
diatom test. This depends on the season and month of drowning in addition to the
type of water body. No concordance of diatom species present in organ tissue and
putative drowning site is an indicative of effect due to natural currents of human
activity in displacement of the body from the actual site of drowning or death. SEM
not only does not alter the morphology of the diatoms, it also is simple, relatively
rapid and enables the diagnosis of drowned bodies under specific conditions with
permanent photographic records.

Further Reading
Aghayev E, Thali MJ, Sonnenschein M, Hurlimann J, Kilchoer T et al (2005) Fatal streamer
accident; blunt force injuries and drowning in post-mortem MSCT and MRI. Forensic Sci Int
152(1):65–71
Ago K, Hayashi T, Ago M, Ogata M (2011) The number of diatoms from the lungs and other organs
in drowning deaths in bathwater. Legal Med 13(4):186–190
Ajay R, Sakshi M (2018) Significance of diatoms in diagnosis of drowning deaths: a review. Peer
Re J Foren Gen Sci 1(5):1. https://doi.org/10.32474/PRJFGS.2018.01.000121
Anand TP, Unmesh AK (2016) Diatom test: a reliable tool to assess death by drowning? Int J Res
Med Sci 4(5):1479–1484
Anon (2009) pseudocryptic species in the esturine benthic diatom navicula phyllepta
(bacillariophyceae). J Phycol 45:1278–1289
Auer A, Mottonen M (1988) Diatoms and drowning. Z Rechtsmed 101(2):87–98
Bortolotti F, Del Balzo G, Calza R, Valerio F, Tagliaro F (2011) Testing the specificity of
diatom test: search for false positives. Med Sci Law 21:7–10
35 Diatom Testing 533

Buri S, Saini OP, Garg R, Purohit RN, Soni K (2015) Detection of diatoms in autopsy of normal
population vis a vis drowning. IJSAR 2(6):22–28
Bychkov D, Linder N, Turkki R et al (2018) Deep learning based tissue analysis predicts outcome in
colorectal cancer. Sci Rep 8:3395
Cameron NG (2004) The use of diatom analysis in forensic geosciences. In: Pye K, Croft DJ (eds)
Forensic geosciences: principles, techniques and applications, vol 232. Geological Society,
London, pp 277–280
Carballeira R, Vieira DN, Febrero-Bande M et al (2018) A valid method to determine the site of
drowning. Int J Legal Med 132:487–497
Chen XG, Zhang J, Huang Y et al (2013) Diatom taxa identification based on single-cell isolation
and rDNA sequencing. Forensic Sci Int Genet Suppl 4:e308–e309
Coudray N, Ocampo PS, Sakellaropoulos T et al (2018) Classification and mutation prediction from
nonsmall cell lung cancer histopathology images using deep learning. Nat Med 24:1559–1567
Cruz-Roa A, Gilmore H, Basavanhally A et al (2017) Accurate and reproducible invasive breast
cancer detection in whole-slide images: a deep learning approach for quantifying tumor extent.
Sci Rep 7:46450
DiGiancamillo A, Domeneghini C, Gibelli D et al (2011) Diatom extraction with HCl from animal
tissues: a technical note. Legal Med 13:268–271
Ertosun MG, Rubin DL (2015) Automated grading of gliomas using deep learning in digital
pathology images: a modular approach with ensemble of convolutional neural networks.
AMIA Annu Symp Proc 2015:1899–1908
Farrugia A, Ludes B (2011) In: Viera DN (ed) Diagnostic of drowning in forensic medicine,
forensic medicine-from old problems to new challenges. INTECH, Rijeka, Croatia, pp 53–60
Fucci N (2012) A new procedure for diatom extraction in the diagnosis of drowning. Clin Exp
Pharmacol 2(1):1–3
Fukushima K, Miyake S (1982) Neocognitron: a new algorithm for pattern recognition tolerant of
deformations and shifts in position. Pattern Recogn 15:455–469
Yadav G, Mishra MK, Gupta AK, Shailesh (2013) Identification of site specific diatom at Yamuna
River of Allahabad. IOSR J Pharm 8(2):87–89
Giri BS, Tripathi CB, Cowdhary YB (1993) Characterization of drowning by diatom test. Indian J
Med Res 98:40–43
Hasle GR, Syvertsen EE (1997) Marine diatoms. In: Tomas Carmelo R (ed) Identifying marine
phytoplankton. Academic, San Diego, pp 5–385
Hofmann E (1878) Textbook of legal medicine.:629
Horton BP (2007) Diatom and forensic science. Paleontological study papers, vol 13. The Paleon-
tological Society, Baltimore, pp 13–22
He F, Huang D, Liu L, Shu X, Yin H et al (2008) A novel PCR-DGGE-based method for identifying
plankton 16S rRNA for the diagnosis of drowning. Forensic Sci Int 176(2–3):152–156
Hurlimann J, Feer P, Elber F, Niederberger K, Dirnhofer R et al (2000) Diatom detection in the
diagnosis of death by drowning. Int J Legal Med 114(1–2):6–14
Incze G (1942) Fremdkorper in Blutkreislauf Ertrunkener. Zentralbl Allg Pathol Anat 79:176
Jian J, Wan L, Shao Y et al (2019) Postmortem chest computed tomography for the diagnosis of
drowning: a feasibility study. Forensic Sci Res 6:152. https://doi.org/10.1080/20961790.2018.
1557386
Kakizaki E, Sonoda A, Shinkawa N et al (2019) A new enzymatic method for extracting diatoms
from organs of suspected drowning cases using papain: optimal digestion and first practical
application. Forensic Sci Int 297:204–216
Kakizaki E, Yukawa N (2015) Simple protocoal for extracting diatoms from lung tissues of
suspected drowning cases with in 3h: first practical application. Forensic Sci Int 251:179–185
Kane M, Fakunaga T, Maeda H, Nishi K (2000) Phylogenetic analysis of picoplankton in Lake
Biwa and application to legal medicine. Electophoresis 21(2):351–354
Knight B (1996) Immersion deaths. In: Forensic pathology, 2nd edn. Arnold Publication, London,
p 390
534 P. M. Chatterjee

Krstic S, Duma A, Janevska B, Levkov Z, Nikolova K et al (2002) Diatom in forensic expertise of

drowning. A Macedonian experience. Forensic Sci Int 127(3):198–203
Kumar M, Deshkar J, Naik SK, Yadav PK (2012) Diatom test-past, present and future: a brief
review. IJRRMS 2(3):28–32
Lecun Y, Bengio Y, Hinton G (2015) Deep learning. Nature 521:436–444
Levin EA, Morgan RM, Scott KR et al (2017) The transfer of diatoms from freshwater to footwear
materials: an experimental study assessing transfer, persistence, and extraction methods for
forensic reconstruction. Sci Justice 57:349–360
Li Z, Liu X, Yu Y et al (2019) Barcoding for diatoms in the Yangtze River from the morphological
observation and 18S rDNA polymorphic analysis. Forensic Sci Int 297:81–89
Ludes B, Coste M, North N, Doray S, Tracqui A et al (1999) Diatom analysis in victim’s tissues as
an indicator of the site drowning. Int J Legal Med 112(3):163–166
Ludes B, Coste M, North N et al (1999) Diatom analysis in victim’s tissues as an indicator of the site
of drowning. Int J Legal Med 112:163–166
Ludes B, Coste M, Tracqui A, Mangin P (1996) Continuous river monitoring of the diatoms in the
diagnosis of drowning. J Forensic Sci 41(3):425–428
Lunetta P, Modell JH (2005) Macroscopical, microscopical, and laboratory findings in drowning
victims, vol 3. Humana Press, New York, NY, pp 3–77
Lunetta P, Penttil€a A, H€allfors G. (1998) Scanning and transmission electron microscopical
evidence of the capacity of diatoms to penetrate the alveolocapillary barrier in drowning. Int J
Legal Med 111:229–237
Lunetta P, Penttila A, Hallfors G (1998) Scanning and transmission electron microscopical evi-
dence of the capacity of diatoms to penetrate in the alveo-capillary barrier in drowning. Int J
Legal Med 111(5):229–237
Magrey AH, Raj M (2014) Role of diatoms in forensic diagnosis of drowning cases from Jammu &
Kashmir, India. Biosci Biotech Res Comm 7(1):72–77
Mann DG, Droop SJM (1996) Biodiversity, biogeography and conservation of diatoms.
Hydrobiologia 336(1–3):19–32
Matsumoto H, Fukui Y (1993) A simple method for diatom detection in drowning. Forensic Sci Int
60(1–2):91–95
Ming M, Meng X, Wang E (2007) Evaluation of four digestive methods for extracting diatoms.
Forensic Sci Int 170:29–34
Modi JP (1996) Textbook of medical jurisprudence & toxicology, 21st edn. NM Tripathi Private
Ltd, Mumbai, pp 196–220
Mohanty NK, Rao B (1964) The diagnosis of death from drowning with particular reference to
diatom method. J Indian Acad Forensic Sci 3:21–27
Network ACN, Related SOR, Rank T et al (2006) A fast learning algorithm for deep belief nets.
Neural Comput 18:1527–1554
Pachar JV, Cameron JM (1993) The diagnosis of drowning by qualitative and quantitative diatom
analysis. Med Sci Law 33(4):291–299
Parmar P, Rathod GB, Rathod S, Parikh A (2014) Nature helps to solve the crimes-diatoms study in
case of drowning death. Int Arch Integr Med 1(3):58–65
Pathak A, Mangal HM (2009) Decomposition: cast a shadow over the drowning deaths. J Indian
Acad Forensic Med 31(2):112–117
Peabody AJ (1980) Diatoms and drowning a review. Med Sci Law 20(4):254–261
Pedraza A, Bueno G, Deniz O et al (2017) Automated diatom classification (part B): a deep learning
approach. Appl Sci 7:460
Piette MHA, De Letter EA (2006a) Drowning: still a difficult autopsy diagnosis. Forensic Sci Int
163(1–2):1–9
Pollanen MS (1998a) Diatoms and homicide. Forensic Sci Int 91(1):29–34
Pollanen MS (1998b) Forensic diatomology and drowning. Elsevier, Amsterdam
Porawski R (1966) Investigation of occurrence of diatoms in organs in death from various causes. J
Forensic Med 13(4):134–137
35 Diatom Testing 535

Racz E, Konczol F, Toth D et al (2016) PCR-based identification of drowning: four case reports. Int
J Legal Med 130:1303–1307
Ranga Rao GSRKG, Jakkam S, Prasad GKV (2014) A comprehensive study of drowning in and
around Kakinada, two years retrospective study. Sch J Appl Med Sci 2(4D):1397–1401
Rohn EJ, Frade PD (2006) The role of diatoms in medico-legal investigations II: a case for the
development and testing of new modalities applicable to the diatom test for drowning. Forensic
Exam 15(4):1
Sankhla MS, Kumari M, Nanadan M, Kumar R (2016) Forensic identification of drowning death by
the use of diatom analysis. Int J Dev Res 6(9):9491–9493
Sasidharan A, Resmi S (2014) Forensic diatomology: a review. Peer Rev E J Health Sci 1(3):
JS002B
Saukko P, Knight B (2015) Knight’s forensic pathology, 4th edn. CRC, Boca Raton, FL
Scott KR, Morgan RM, Jones VJ, Cameron NG (2014) The transferability of diatoms to clothing
and the methods appropriate for their collection and analysis in forensic geosciences. Forensic
Sci Int 241:127–137
Scott KR, Morgan RM, Jones VJ et al (2014) Reply to A. Dragutinovic, A reply to: the transfer-
ability of diatoms to clothing and the methods appropriate for their collection and analysis in
forensic geoscience. Forensic Sci Int 241:127–137
Shen X, Liu Y, Xiao C et al (2019) Analysis of false-positive results of diatom test in the diagnosis
of drowning—would not be an impediment. Int J Legal Med 133:1819–1824
Shiwei M, Feng F, Dong X, Seese R, Wang Z (2010) A contributory diagnosis of drowning in
putrefactive corpses using the electric impedance spectroscopy. Rom J Leg Med 18(4):283–288
Sidari L, Nunno ND, Costantinides F, Melato M (1999) Diatom test with Soluene 350 to diagnose
drowning in seawater. Forensic Sci Int 103(1):61–65
Singh M, Kulshrestha P, Satpathy DK (2004) Synchronous use of maggots and diatoms in
decomposed bodies. J Indian Acad Forensic Med 26:121–124
Singh R, Singh R, Kumar S, Thakar MK (2006) Forensic analysis of diatoms-a review. Anil
Aggarwal Internet J Forensic Med Toxicol 7(2):1
Sitthiwong N, Ruangyuttikarn W, Vongvivach S, Peerapornpisal Y (2014) Detection and identifi-
cation of diatoms in tissue samples of drowning victims. Chiang Mai J Sci 41(5):1020–1031
Siver PA, Lord WD, Mccarthy DJA (1994) Forensic limnology: the use of freshwater algal
community ecology to link suspects to an aquatic crime scene in southern New England. J
Forensic Sci 39(3):847–853
Sumiko A, Miwako S, Hidemasa N et al (2003) A novel PCR method for identifying plankton in
cases of death by drowning. Med Sci Law 43:23–30
Suto M, Kato N, Abe S et al (2009) PCR detection of bacterial genes provides evidence of death by
drowning. Legal Med 11:S354–S356
Tamasaka L (1949) Diatom content of bone marrow in corpses in water. Orv Hetil 16:509–511
Timperman J (1972) The diagnosis of drowning-a review. J Forensic Sci 1(4):397–409
Uchiyama T, Kakizaki E, Kozawa S et al (2012) A new molecular approach to help conclude
drowning as a cause of death: simultaneous detection of eight bacterioplankton species using
real-time PCR assays with TaqMan probes. Forensic Sci Int 222:11–26
Vanelslander B, Creach V, Vanormelingen P, Ernst A, Chepurnov VA, Sahan E, Muyzer G, Stal LJ,
Vyverman W, Sabbe K (2009) Ecological differentiation between sympatric pseudocryptic
species in the estuarine benthic diatom Navicula Phyllepta (Bacillariophyceae) 1. J Phycol 45
(6):1278–1289
Vanormelingen P, Verleyen E, Vyvermn W (2008) The diversity and distribution of diatoms: from
cosmopolitanism to narrow endemism. Biodivers Conserv 17(2):393–405
Verma K (2013) Role of diatoms in the world of forensic science. J Forensic Res 4:181–184
Vinayak V, Goyal MK, Mishra V, Rai N (2010) Diatoms as great forensic tool in investigating of
deaths due to drowning: a case study. J Forensic Med Toxicol 27(1):51–54
Wang H, Liu Y, Zhao J, Sunlin H, Wang Y et al (2014) A simple digestion method with a Lefort
aqua Regia solution for diatom extraction. J Forensic Sci 60(1):227–230
536 P. M. Chatterjee

Williams DM, Kociolek JP (2017) Historical biography of diatoms in in Australasia: a preliminary

assessment. In: Ebach MC (ed) Handbook of Australasian biogeography. CRC press, Boca
Raton, FL, pp 17–46
Zhao Y, Chen X, Yang Y et al (2018) Potential forensic biogeographic application of diatom colony
consistency analysis employing pyrosequencing profiles of the 18S rDNA V7 region. Int J Legal
Med 132:1611–1620
Zhao J, Liu C, Bardeesi ASA et al (2017) The diagnostic value of quantitative assessment of diatom
test for drowning: an analysis of 128 water-related death cases using microwave digestion-
vacuum filtrationautomated scanning electron microscopy. J Forensic Sci 62:1638–1642
Zhao J, Liu C, Hu S et al (2013) Microwave digestionvacuum filtration-automated scanning
electron microscopy as a sensitive method for forensic diatom test. Int J Legal Med 127:459–
463
Zhao J, Ma Y, Liu C et al (2016) A quantitative comparison analysis of diatoms in the lung tissues
and the drowning medium as an indicator of drowning. J Forensic Legal Med 42:75–78
Zhou Y, Zhang J, Huang J et al (2019) Digital wholeslide image analysis for automated diatom test
in forensic cases of drowning using a convolutional neural network algorithm. Forensic Sci Int
302:109922
Nanotechnology and Its Uses in Forensic
Science 36
Prashant Kumar and Paromita Banerjee

Abstract

Nanotechnology has had a significant impact on the field of forensic science.

Different nanoparticles, including silver, zinc oxide, silicon dioxide, aluminum
oxide, gold (with the silver physical developer), europium, fluorescent carbon,
and amphiphilic silica, could be applied to a variety of object surfaces to produce
characteristics like distinct ridge details of fingerprints; among all of these, gold is
the most frequently used. The fingerprint is regarded as significant evidence at
any crime scene, and nanotechnology has enormous potential for fingerprint
analysis in the future. This chapter will explore the current and potential
applications of nanotechnology in forensics. The chapter will begin by
introducing nanotechnology and its potential applications. A discussion of the
advantages and limitations of nanotechnology in forensics will follow this. The
chapter will then explore the current and emerging nanotechnology techniques
used in forensic science. These techniques include nanoscale imaging, nanoscale
spectroscopy, nanoscale chemical analysis, and nanoscale DNA sequencing.
Finally, the chapter will discuss the implications of nanotechnology for the future
of forensics.

Keywords

Nanotechnology · Forensic nanotechnology · Crime detection · Forensic

investigation

P. Kumar (✉) · P. Banerjee

Department of Bioinformatics, Kalinga University, Raipur, Chhattisgarh, India
e-mail: [email protected]

# The Author(s), under exclusive license to Springer Nature Singapore Pte 537
Ltd. 2024
A. Puri et al. (eds.), Fundamentals of Forensic Biology,
https://doi.org/10.1007/978-981-99-3161-3_36
538 P. Kumar and P. Banerjee

36.1 Introduction

Forensic nanotechnology is a rapidly emerging field in the forensic sciences. This

field focuses on applying nanotechnology to forensic investigations, providing a new
level of insight and accuracy to the analysis of evidence. It involves using nanoscale
materials and processes to analyze evidence and identify the presence of physical
and chemical components that may not be detected using traditional methods. The
term ‘nanotechnology’ refers to manipulating matter at the nanometer scale. This
scale is smaller than that of a human cell which is around 100 nanometers in size
(Pitkethly 2010). Nanotechnology is an interdisciplinary field that combines
elements of physics, chemistry, materials science, and engineering. The application
of nanotechnology to forensic science can be used to improve the accuracy and
speed of investigations. It has the potential to revolutionize the way forensic
evidence is collected, analyzed, and interpreted. This chapter will provide an over-
view of forensic nanotechnology, including its current applications in forensic
science, potential future uses, and the associated challenges. Forensic nanotechnol-
ogy has a wide range of potential applications in forensic science. For example, it
can be used to detect and analyze trace amounts of evidence, such as fingerprints,
bodily fluids, and drugs (Hussain et al. 2021) It can also identify specific chemicals
or substances that may not be visible to the naked eye. Nanotechnology can also be
used to analyze evidence at the molecular level, allowing for a more detailed analysis
than traditional methods. This can provide more accurate results and enable
investigators to make more informed decisions when analyzing evidence. In addi-
tion, nanotechnology can detect and analyze DNA, providing a more precise and
reliable method of identifying individuals. RNA may also be seen and examined by
this technique, which can be used to identify the source of a specific sample (Sinha
and Rao 2020) Future Uses of Forensic Nanotechnology The potential applications
of nanotechnology in forensic science are far-reaching, and the field is expanding.
Nanotechnology can be used to create more accurate and efficient ways to analyze
evidence and identify individuals. In the future, nanotechnology could develop
devices and sensors that can detect and analyze evidence at the nanoscale. This
could allow for more accurate and efficient forensic investigations and provide a new
level of insight into cases. Nanotechnology could also create devices capable of
detecting and analyzing evidence in real time. This could enable investigators to
quickly and accurately identify evidence and speed up the process of investigations
(Lodha et al. 2016). There are difficulties with applying nanotechnology to forensic
science. One of the biggest challenges is the potential cost of implementing nano-
technology in forensic investigations. Nanotechnology is a complex field, and the
materials and equipment needed to use it can be expensive. Another challenge is that
nanotechnology is still relatively new, and many unknowns exist about its potential
applications. This can make it difficult to accurately predict the benefits and risks of
using nanotechnology in forensic investigations. Finally, there are ethical
considerations surrounding using nanotechnology in forensic science. For example,
the use of nanotechnology could infringe on the privacy of individuals, which is a
significant concern.
36 Nanotechnology and Its Uses in Forensic Science 539

36.2 Applications of Forensic Nanotechnology

Forensic nanotechnology has a wide range of applications in crime investigation and

resolution. These include 1. DNA and other biological material analysis: Nanotech-
nology can identify DNA, proteins, and other biological material, enabling forensic
scientists to quickly and accurately identify individuals from a crime scene. Forensic
nanotechnology can also be used to detect and identify nanotoxicity substances
(Sinha et al. 2020) 2. Evidence tagging and tracking: Nanotechnology can be used
to tag and track evidence from a crime scene. This could help reduce the time it takes
to process evidence and ensure it is handled correctly. 3. Finger printing: Nanotech-
nology can more accurately identify fingerprints from a crime scene than traditional
methods. Fingerprinting nanotechnology is used to identify the unique
characteristics of nanomaterials and nanosystems. It uses various analytical
techniques to characterize the size and shape, elemental composition, surface area,
structure, and other physical and chemical properties of nanomaterials and
nanosystems. This is done to build a “fingerprint” or a “signature” of the
nanomaterial. This process can identify the same nanomaterials in different
environments and monitor the changes in nanomaterials over time. This can be
important for tracking the safety and environmental impact of nanotechnology.
4. Gunshot residue analysis: Nanotechnology can be used to analyze gunshot residue
and link it to a particular weapon. Gunshot residue analysis is an important tool used
in forensic science to determine the distance at which a gun is fired. Recently,
nanotechnology has been used to improve gunshot residue analysis. Nanostructured
materials, such as carbon nanotubes, can be used to detect the presence of gunshot
residue particles. These nanostructures can form sensitive and selective sensors that
detect particles at low concentrations. They can also be used to detect a variety of
different types of particles, such as lead, copper, and zinc. Nanostructured materials
can also detect the presence of other compounds that may be associated with gun
firings, such as nitrates and chlorides. In addition, nanotechnology can be used to
create devices that can analyze gunshot residue more quickly and accurately. For
example, nanotechnology can be used to develop devices that can detect the pres-
ence of gunshot residue particles in a much shorter amount of time. This can be
especially useful in crime scenes, where time is of the essence. Nanotechnology can
also be used to create devices that can analyze gunshot residue particles more
accurately, leading to more accurate conclusions about the distance and angle of
fire. Overall, nanotechnology has the potential to revolutionize the field of gunshot
residue analysis. Using nanostructured materials, researchers can develop sensitive
and selective sensors that detect gunshot residue particles at low concentrations.
They can also be used to detect a variety of different types of particles, such as lead,
copper, and zinc. Nanotechnology can also be used to create devices that can analyze
gunshot residue more quickly and accurately, leading to more accurate conclusions
about the distance and angle of fire. 5. Drug testing: Nanotechnology can be used to
analyze and identify illicit drugs and trace amounts of drugs in a person’s system.
Nanotechnology is currently being used to develop new and improved methods for
drug testing. The use of nanotechnology in drug testing provides a more sensitive
540 P. Kumar and P. Banerjee

and accurate way to detect the presence of drugs in a sample. It can detect the
presence of a wide range of drugs, including drugs of abuse and illicit drugs. This
technology is also being used to develop methods for drug screening that are quicker
and more cost effective than traditional methods. For example, nanotechnology can
detect a drug’s presence in a sample without requiring expensive and time-
consuming laboratory analysis. Additionally, nanotechnology can be used to
develop rapid drug screens that can be used in the field to detect the presence of
drugs quickly (Paikrao et al. 2022)0.6. Trace evidence analysis: Nanotechnology can
analyze trace evidence, such as fibers, paint chips, and glass, to identify a perpetrator
(Sharma et al. 2022). Drug testing in nanotechnology is still in its early stages.
However, it is becoming increasingly important as nanotechnology is used in various
consumer products, from cosmetics to medical devices. Drug testing in nanotech-
nology is designed to ensure that nanoparticles used in these products are safe,
effective, and reliable. It involves testing the properties of particles to ensure they
meet safety and quality requirements. This includes testing for toxicity, biocompati-
bility, and performance. Drug testing in nanotechnology also involves assessing
nanoparticles’ potential environmental and health impacts and their interactions with
other materials. Both government and private organizations conduct this type of
testing to ensure the safety of nanotechnology products. Trace evidence analysis in
nanotechnology is the analysis of particles and other materials that are too small to be
seen with the naked eye. This type of evidence is often used to aid in investigating
criminal cases and in the study of the properties and behavior of nanomaterials.
Trace evidence analysis in nanotechnology involves the use of various analytical
techniques to detect and identify particles, such as scanning electron microscopy
(SEM), energy-dispersive X-ray spectroscopy (EDS), and transmission electron
microscopy (TEM). These techniques allow investigators to measure particles’
size, shape, composition, and surface characteristics and determine their origin and
distribution. In addition to providing important evidence for criminal investigations,
trace evidence analysis in nanotechnology has also been used to study the behavior
of nanoparticles in the environment and to develop new materials and products. For
example, researchers have used trace evidence analysis to study the interactions
between nanoparticles and cells and assess the potential toxicity of nanomaterials. In
addition, trace evidence analysis has been used to develop and optimize the perfor-
mance of nanoscale devices, such as transistors, sensors, and medical implants.
7. Explosive detection: Nanotechnology can detect explosives, reducing the risk of
a terrorist attack. The forensic application of explosive detection nanotechnology
(EDN) is a growing field used to examine materials and items for traces of
explosives. EDN can detect many explosives, including C-4, TNT, and Semtex.
EDN also screens items for explosives residue to identify potential threats (Pandya
et al. 2012).
36 Nanotechnology and Its Uses in Forensic Science 541

36.3 Conclusion

Forensic nanotechnology is a rapidly emerging field in the forensic sciences that has
the potential to revolutionize the way evidence is collected, analyzed, and
interpreted. It has a wide range of potential applications, including the detection
and analysis of trace amounts of evidence, the identification of individuals, and the
detection and analysis of DNA and RNA. However, the use of nanotechnology in
forensic science has its challenges. These include the potential cost of implementing
nanotechnology, the lack of knowledge about its possible applications, and ethical
considerations. In conclusion, nanotechnology can significantly improve the accu-
racy and speed of forensic investigations, but more research is needed to fully
understand its potential and challenges.

Acknowledgments None.

Conflicts of Interest The author declares that there are no conflicts of interest.

References
Hussain CM, Rawtani D, Pandey G, Tharmavaram M (2021) Chapter 19–Nanotechnology in
forensic science. In: Hussain CM, Rawtani D, Pandey G, Tharmavaram M (eds) Handbook of
analytical techniques for forensic samples. Elsevier, Amsterdam, pp 359–379. ISBN
9780128223000. https://doi.org/10.1016/B978-0-12-822300-0.00019-7
Lodha AS, Pandya A, Shukla RK (2016) Nanotechnology: an applied and robust approach for
forensic investigation. Forensic Res Criminol Int J 2(1):35–37. https://doi.org/10.15406/frcij.
2016.02.00044
Paikrao HM, Tajane DS, Patil AS, Dipale AD (2022) Applications of nanotechnology in forensic
science. In: Sarma H, Gupta S, Narayan M, Prasad R, Krishnan A (eds) Engineered
nanomaterials for innovative therapies and biomedicine. Nanotechnology in the life sciences.
Springer, Cham. https://doi.org/10.1007/978-3-030-82918-6_11
Pandya A, Goswami H, Lodha A, Menon S (2012) A novel nanoaggregation detection technique of
TNT using selective and ultrasensitive nanocurcumin as a probe. Analyst 137:1771
Pitkethly M (2010) Nanotechnology and forensics, mat. Today 12(6):6. https://www.
materialstoday.com/nanomaterials/articles/s1369702109701671/
Sharma B, Bhat A, Singh AP, Kumar P, Khanna S, Vita D, Kaur E, Singh J (2022) Railway disaster:
a track of forensic investigation. Neuro Quantol 20(9):5313–5319. https://doi.org/10.14704/nq.
2022.20.9.NQ44617
Sinha M, Rana M, Kushwaha P (2020) Applications of mitochondrial DNA in forensic science. In:
Shrivastava P, Dash HR, Lorente JA, Imam J (eds) Forensic DNA typing: principles,
applications and advancements. Springer, Singapore. https://doi.org/10.1007/978-981-15-
6655-4_16
Sinha M, Rao IA (2020) SNP testing in forensic science. In: Shrivastava P, Dash HR, Lorente JA,
Imam J (eds) Forensic DNA typing: principles, applications and advancements. Springer,
Singapore. https://doi.org/10.1007/978-981-15-6655-4_18